Luận văn Đánh giá chất lượng hạt và nghiên cứu đặc điểm cấu trúc gen LTP ở đậu xanh (Vigna radiata L.Wilczek)

MỤC LỤC

Trang phụ bìa

Lời cam đoan

Lời cảm ơn

Danh mục những chữ viết tắt trong luận văn

Danh mục các bảng trong luận văn

Danh mục các hình trong luận văn

MỞ ĐẦU 1

1. Lý do chọn đề tài 1

2. Mục tiêu nghiên cứu 2

3. Nội dung nghiên cứu 2

4. Ý nghĩa khoa học 2

CHƯƠNG 1. TỔNG QUAN TÀI LIỆU 3

1.1. SƠ LƯỢC VỀ CÂY ĐẬU XANH 3

1.1.1. Nguồn gốc và phân loại cây đậu xanh 3

1.1.2. Đặc điểm nông sinh học của cây đậu xanh 3

1.1.3. Sinh trưởng và phát triển của cây đậu xanh 7

1.1.4. Đặc điểm hoá sinh của hạt đậu xanh 8

1.1.5. Tầm quan trọng của cây đậu xanh 9

1.1.6. Tình hình nghiên cứu và sản xuất đậu xanh 10

1.2. GEN LTP VÀ KHẢ NĂNG CHỊU HẠN CỦA CÂY ĐẬU XANH 15

1.2.1. Hạn và tác động của hạn đối với cây trồng 15

1.2.2. Cơ sở hóa sinh và sinh học phân tử của tính chịu hạn 17

1.2.3. Protein vận chuyển lipid (LTP) và gen LTP (Lipid Transfer Protein) 21

CHƯƠNG 2. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 24

2.1. VẬT LIỆU 24

2.2. HOÁ CHẤT, THIẾT BỊ, ĐỊA ĐIỂM NGHIÊN CỨU 25

2.3. PHƯƠNG PHÁP NGHIÊN CỨU 26

2.3.1. Phương pháp sinh lí, hoá sinh 26

2.3.2. Phương pháp sinh học phân tử 30

2.3.3. Phương pháp xử lí số liệu 35

 

CHƯƠNG 3. KẾT QUẢ VÀ THẢO LUẬN 36

3.1. PHÂN TÍCH ĐẶC ĐIỂM HÌNH THÁI, HOÁ SINH HẠT CỦA CÁC GIỐNG ĐẬU XANH NGHIÊN CỨU 36

3.1.1. Đặc điểm hình thái và khối lượng 1000 hạt của các giống đậu xanh 36

3.1.2. Chiều dài rễ, thân của các giống đậu xanh ở giai đoạn cây non 38

3.1.3. Đặc điểm hoá sinh hạt của các giống đậu xanh 39

3.2. KẾT QUẢ ĐÁNH GIÁ KHẢ NĂNG CHỊU HẠN CỦA CÁC GIỐNG ĐẬU XANH NGHIÊN CỨU Ở GIAI ĐOẠN CÂY NON 42

3.3. KẾT QUẢ PHÂN LẬP VÀ XÁC ĐỊNH TRÌNH TỰ GEN LTP 46

3.3.1. Kết quả tách chiết DNA tổng số 46

3.3.2. Kết quả nhân gen LTP 47

3.3.3. Kết quả tinh sạch sản phẩm PCR 48

3.3.4. Kết quả biến nạp vector tái tổ hợp vào tế bào khả biến E.coli DH5α 48

3.3.5. Kết quả chọn lọc plasmid tái tổ hợp bằng clony-PCR 49

3.3.6. Kết quả tách plasmid từ các khuẩn lạc của 2 mẫu nghiên cứu 50

3.3.7. Kết quả xác định trình tự nucleotide của 2 mẫu nghiên cứu 51

KẾT LUẬN VÀ ĐỀ NGHỊ 57

TÀI LIỆU THAM KHẢO 58

 

 

doc65 trang | Chia sẻ: maiphuongdc | Ngày: 26/12/2013 | Lượt xem: 3522 | Lượt tải: 15download
Bạn đang xem nội dung tài liệu Luận văn Đánh giá chất lượng hạt và nghiên cứu đặc điểm cấu trúc gen LTP ở đậu xanh (Vigna radiata L.Wilczek), để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
được kích thích tăng tổng hợp ngoại bì giúp thực vật có thể giảm mất nước nhờ tăng độ dày của lớp vỏ ngoài [27]. Ở đậu xanh, gen LTP cũng đã được phân lập và công bố trên ngân hàng gen quốc tế [34]. 1.2.3. Protein vận chuyển lipid (LTP) và gen LTP (Lipid Transfer Protein) 1.2.3.1. Protein LTP LTP là tên thường gọi của một nhóm protein có khả năng vận chuyển lipid, có liên quan đến tính chịu hạn ở thực vật. LTP có khả năng tạo phức với một số acid béo và xúc tác cho quá trình vận chuyển lipid qua màng tế bào, giúp hạn chế sự mất nước. LTP được gắn tại một vị trí cố định trên màng sinh chất của tế bào, nó có đặc điểm như một receptor vận chuyển acid béo qua màng tế bào. Phức hợp LTP - linoleic acid đã được chiết ra từ màng sinh chất của cây thuốc lá trong điều kiện gây hạn nhân tạo [39]. Bên cạnh đó, LTP còn liên quan đến quá trình hình thành tầng cutin của tế bào thực vật, làm tăng khả năng chống chịu và hạn chế tác hại của stress muối và stress hạn. Nghiên cứu trên cây đậu xanh, Liu K.H. và cs (2003) nhận thấy rằng hàm lượng mRNA của LTP sẽ tăng cao trong điều kiện stress muối, stress hạn hay khi hàm lượng ABA ngoại bào tăng cao [41]. LTP còn tham gia vào hệ thống miễn dịch của thực vật. Nghiên cứu trên cây lúa, Blilou I. và cs (2005) nhận thấy tốc độ tổng hợp LTP tăng nhanh khi có sự xâm nhập của loài nấm Glomus mosseae vào biểu bì rễ và giảm khi nấm tấn công vào khoảng gian bào [24]. Carvalho A.O. và cs (2006) khi nghiên cứu trên cây đậu đũa (Vigna unguiculata (L.) Walp) nhận thấy LTP là peptide kháng khuẩn tham gia vào việc bảo vệ cây chống lại các mầm bệnh [26]. LTP được chia thành hai dạng khác nhau về khối lượng phân tử. Dạng thứ nhất có khối lượng phân tử khoảng 9 kDa (LTP1) và dạng thứ hai có khối lượng phân tử khoảng 7 kDa (LTP2). Cả LTP1 và LTP2 đều có một vùng bảo thủ gồm 8 amino acid loại cystatin và 4 amino acid loại prolin [36]. 1.2.3.2. Gen LTP LTP thuộc họ gen pathogenesis relate, có khả năng tổng hợp ra protein thúc đẩy quá trình vận chuyển phospholipid giữa các màng. Vai trò của LTP là tham gia vào cấu tạo cutin, phản ứng bảo vệ chống bệnh của cây và đáp ứng sự thích nghi biến đổi của môi trường [25], [29], [35]. Khi gặp các điều kiện cực đoan của môi trường, các nhân tố như hormone, các quá trình trao đổi ion, các con đường truyền tín hiệu… sẽ điều khiển gen LTP hoạt động và tổng hợp nên các sản phẩm protein tương ứng nhằm giúp cho cây tăng khả năng chống chịu stress, chịu bệnh… Những phân tử protein này thường bao gồm nhiều đặc điểm chung như: điểm đẳng điện cao, khối lượng phân tử khoảng 9,12 kDa và sự có mặt của 8 phân tử cystein làm nhiệm vụ tạo ra 4 cầu nối disulfide [36]. LTP đã được chứng minh trong việc ngăn chặn nguồn gây bệnh như: Pseudomonas solanacearum, Clavibacter michiganasis, Fuarium solani, Rhizoctonia solani, Trichodelmar viride và Cercospora beticola [36], [45]. Trong những năm gần đây, gen LTP đã được nghiên cứu ở một số thực vật như: Arabidopsis thaniana L. [22], Paphanus sativus L. [53], Zea mays L. [49], [51], Capsicum annuum [55], Vigna radiata L. [41], Triticum L. [44], Daucus carota L. [52], Nicotiana tabacum L. [43], [48], Oryza sativa L. [56], Valencia orange [60], Lycopesium esculentum [54]. LTP có khả năng xúc tác tới sự vận chuyển phospholipid giữa các lớp màng của tế bào. LTP có thể hỗ trợ việc tạo ra các lớp sáp hoặc lớp biểu bì giúp thực vật bảo vệ, phản ứng và đáp ứng lại những thay đổi của môi trường [23], [25]. Hiện nay, LTP ở thực vật được biết có 4 nhóm lớn: Nhóm I: Bao gồm các CsLTP chứa các bộ mã hoá protein đã được cô lập và biểu hiện ở trong quả. Nhóm II: Bao gồm những gen LTP tổng hợp ra protein được biểu hiện trong hạt. Nhóm III: Bao gồm các gen LTPs tổng hợp ra protein được biểu hiện trong mô lá. Chúng được tạo ra khi có những ảnh hưởng của môi trường như tình trạng khô hạn và các tác nhân có thể gây bệnh. Nhóm IV: Bao gồm các gen LTP tổng hợp nên các chuỗi polypeptide được cô lập và biểu hiện trong hoa [36], [45]. Ở cây đậu xanh, Liu K.H. và cs (2003) đã phân lập thành công hai dạng khác nhau của gen LTP và đặt tên là Vrltp1 và Vrltp2 [41]. Trình tự các amino acid suy diễn của Vrltp1 và Vrltp2 đều có hai đoạn pentapeptide mang tính bảo thủ cao ở thực vật. Trong hạt đậu xanh ở giai đoạn nảy mầm, nhóm nghiên cứu chỉ tìm thấy mRNA của Vrltp1, còn trong mô sinh dưỡng thì mRNA của cả Vrltp1 và Vrltp2 chỉ tìm thấy ở lá và thân, không có ở chóp rễ. Các tác giả cũng nhận thấy, khi gặp điều kiện bất lợi như stress hạn hay muối hoặc khi hàm lượng ABA ngoại bào quá cao sẽ làm tăng tốc độ phiên mã của mRNA Vrltp1 và Vrltp2. Từ đó đưa ra giả thuyết rằng gen LTP có ảnh hưởng rõ rệt tới sự phát triển các mô non và rất có thể đóng vai trò quan trọng trong sự thích nghi của thực vật trong điều kiện khô hạn. CHƯƠNG 2. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 2.1. VẬT LIỆU Hạt của 13 giống đậu xanh do Viện nghiên cứu Ngô cung cấp và một số giống thu thập tại các tỉnh Bắc Giang, Thái Nguyên, Lạng Sơn, Hà Nội, Hà Giang. Danh sách các giống đậu xanh nghiên cứu được trình bày trong bảng 2.1. Bảng 2.1. Các giống đậu xanh nghiên cứu TT Tên giống Nguồn gốc 1 ĐXVN 4 Do Viện NC Ngô lai tạo giữa giống Mungo 113 với ĐX 113 2 ĐXVN 5 Do Viện NC Ngô lai tạo giữa giống ĐX 04 với ĐX 113 3 VN 99-3 Do Viện NC Ngô lai tạo giữa giống VN 93-1 với Vigna mungo 4 044/ĐX06 Do Viện NC Ngô lai tạo giữa giống ĐX 044 với ĐX 06 5 TN Đồng Hỷ - Thái Nguyên 6 LS Bắc Sơn - Lạng Sơn 7 HN 1 Ba Vì - Hà Nội 8 HN 2 Mỹ Đức - Hà Nội 9 BG 1 Việt Yên - Bắc Giang 10 BG 2 Yên Dũng - Bắc Giang 11 BG 3 Sơn Động - Bắc Giang 12 HG 1 Bắc Quang - Hà Giang 13 HG 2 Hoàng Su Thùy - Hà Giang VN 99-3 LS 044/ĐX06 BG 1 HG 2 BG 2 22 BG 3 ĐXVN 5 HN 2 HG 1 ĐXVN 4 TN HN 1 Hình 2.1. Hạt của các giống đậu xanh nghiên cứu 2.2. HOÁ CHẤT, THIẾT BỊ, ĐỊA ĐIỂM NGHIÊN CỨU Các loại hóa chất: các hoá chất phục vụ nghiên cứu phân lập gen do các hãng Invitrogen, Fermentas, Bioneer cung cấp. Các loại thiết bị máy móc: các thiết bị máy móc phục vụ sinh học phân tử như máy PCR, máy li tâm, máy soi gel, bộ điện di, box cấy, máy lắc, lò vi sóng, cân điện tử, tủ sấy, tủ lạnh, bể ổn nhiệt, máy xác định trình tự nucleotide tự động, pipetman, máy làm khô DNA (Speed Vac) và một số thiết bị, máy móc cần thiết khác. Địa điểm nghiên cứu: Các thí nghiệm được tiến hành tại Bộ môn Sinh học phân tử và Công nghệ gen - Viện Khoa học Sự sống - Đại học Thái Nguyên; Phòng thí nghiệm Di truyền và Sinh học hiện đại - Khoa Sinh - Kỹ thuật Nông nghiệp - Trường Đại học Sư phạm - Đại học Thái Nguyên và Phòng Miễn Dịch học - Viện Công nghệ Sinh học - Viện Khoa học và Công nghệ Việt Nam. 2.3. PHƯƠNG PHÁP NGHIÊN CỨU 2.3.1. Phương pháp sinh lí, hoá sinh 2.3.1.1. Đánh giá nhanh khả năng chịu hạn Đánh giá nhanh khả năng chịu hạn theo phương pháp của Lê Trần Bình và cs (1998) [1]. Hạt đậu xanh được gieo vào trong các chậu trồng cây chứa cát vàng sạch. Sau khi cây có 3 lá thật, tiến hành gây hạn nhân tạo bằng cách không tưới nước đến khi cây héo, trong quá trình gây hạn cho cây che không cho nước mưa có thể vào chậu thí nghiệm, thời điểm tiến hành thí nghiệm được thực hiện vào mùa khô từ tháng 9 đến tháng 11 âm lịch. Khi cây non 3 lá thật bắt đầu héo, tiến hành theo dõi mức độ héo của cây trong vòng 3, 5, 7, 9, 11 ngày kể từ khi lô thí nghiệm bắt đầu có cây héo, tỉ lệ cây phục hồi sau 3, 5, 7, 9, 11 ngày. Các chỉ tiêu phân tích gồm: - Tỷ lệ cây không héo. - Tỷ lệ cây phục hồi. - Chỉ số chịu hạn tương đối. Khả năng chịu hạn tương đối của cây được biểu hiện bằng đồ thị rada, gồm các trục a, b, c, d, e, g, h, i, k, l và mang các trị số tương ứng an, bn, cn, dn, en, gn, hn, in, kn,ln và chỉ số chịu hạn tương đối được tính bằng đồ thị rada theo công thức: Sn = ½ sin α (an bn + bn cn + cn dn + dnen + engn + gnhn + hnin + inkn+knln+lnan) Trong đó: - Góc α được tạo bởi 2 trục mang trị số gần nhau - Sn: chỉ số chịu hạn tương đối. - n: ký hiệu các giống nghiên cứu. - Các chỉ tiêu theo dõi gồm: - a: % cây không héo sau 3 ngày hạn. - b: % cây phục hồi sau 3 ngày hạn. - c: % cây không héo sau 5 ngày hạn. - d: % cây phục hồi sau 5 ngày hạn. - e: % cây không héo sau 7 ngày hạn. - g: % cây phục hồi sau 7 ngày hạn. - h: % cây không héo sau 9 ngày hạn. - i: % cây phục hồi sau 9 ngày hạn. - k: % cây không héo sau 11 ngày hạn. - l: % cây phục hồi sau 11 ngày hạn. Chỉ số chịu hạn càng lớn thì khả năng chịu hạn càng cao. 2.3.1.2. Định lượng lipid tổng số [3]. * Nguyên tắc Dựa vào khả năng hoà tan của lipid trong dung môi hữu cơ để chiết lipid có trong hạt đậu xanh. Dung môi hữu cơ được sử dụng là petroleum ether. * Tiến hành Hạt đậu xanh được sấy khô ở 700C đến khối lượng không đổi, nghiền mịn, cân 0,05 g bột mẫu cho vào ống eppendorf 2 ml, thêm 1,5 ml petroleum ether, lắc đều trong 10 phút, bảo quản mẫu ở 40C trong 24 giờ. Sau đó mang đi li tâm 12000 vòng/phút ở 40C trong 20 phút, loại bỏ dịch. Lặp lại quy trình như trên 3 lần. Hàm lượng lipid tính bằng hiệu số khối lượng mẫu trước và sau khi chiết phần trăm khối lượng khô. Trong đó: % L - % của lipid a - khối lượng mẫu trước khi chiết b - khối lượng mẫu sau khi chiết 2.3.1.3. Định lượng protein Định lượng protein tan trong hạt đậu xanh theo phương pháp Lowry [3]. * Nguyên tắc Dựa vào cường độ màu xanh của phức chất đồng, protein khử hỗn hợp phosphomolipdate - phosphovonphramate (thuốc thử Foling - Ciocalteau). Cường độ màu tỷ lệ thuận với hàm lượng protein. * Lập đồ thị chuẩn định lượng protein Nguyên liệu và hoá chất: Albumin tiêu chuẩn 100%. Dung dịch A: Na2CO3 2% trong NaOH 0,1N. Dung dịch B: CuSO4 0,5% trong Natri, kali tactrate 1%. Dung dịch C: 49 ml dung dịch A : 1 ml dung dịch B. Thuốc thử Foling. Pha dung dịch albumin 0,02% từ albumin gốc tinh khiết 100%. Lấy 6 ống nghiệm, đánh số thứ tự từ 1 đến 6, cho các chất tham gia phản ứng như trong bảng 2.2. Sau đó đo độ hấp thụ quang phổ ở bước sóng 750 nm. Bảng 2.2. Xây dựng đường chuẩn định lượng protein theo Lowry Các ống nghiệm Hóa chất 1 2 3 4 5 6 Protein 0,02% (ml) 0,0 0,2 0,4 0,6 0,8 1,0 Nước cất (ml) 1,0 0,8 0,6 0,4 0,2 0,0 Lượng protein (mg) 0,00 0,04 0,08 0,12 0,16 0,20 Dung dịch C (ml) 4 4 4 4 4 4 Thuốc thử Folin (ml) 0,5 0,5 0,5 0,5 0,5 0,5 Kết quả đo OD ở 750 nm 0,00 0,11 0,20 0,31 0,39 0,49 Đồ thị chuẩn định lượng protein theo phương pháp Lowry được thể hiện như hình 2.2. * Tiến hành định lượng Dùng các dung dịch đệm phosphate citrate (pH = 10), NaCl 1M và nước cất để chiết protein tan có trong hạt. Mẫu sấy khô tuyệt đối ở 1050C, nghiền mịn, cân 0,05 g bột mẫu cho vào ống eppendorf 2 ml, thêm 1,5 ml dung dịch đệm chiết, lắc đều trong 10 phút, bảo quản mẫu ở 40C trong 24 giờ. Sau đó mang đi li tâm 12000 vòng/phút ở 40C trong 20 phút, thu lấy dịch. Lặp lại quy trình như trên 3 lần nhưng lần thứ hai chỉ cần để lạnh trong 8 - 10 giờ, lần ba là 6 - 8 giờ. Sau khi chiết bằng dung dịch đệm phosphate citrate (pH = 10), tiếp tục tiến hành chiết bằng dung dịch NaCl 1M và nước cất. Dịch chiết chứa protein hoà tan đem xác định hàm lượng cùng protein chuẩn là albumin huyết thanh bò theo phương pháp quang phổ hấp thụ bước sóng 750 nm với thuốc thử Foling. Đơn vị tính hàm lượng protein là phần trăm khối lượng khô. Hàm lượng protein được xác định dựa trên đồ thị chuẩn định lượng protein theo phương pháp Lowry (hình 2.2). Cách tính hàm lượng protein: Trong đó: a: số đo trên máy quang phổ H : hệ số pha loãng G : số mg mẫu phân tích 2.3.2. Phương pháp sinh học phân tử 2.3.2.1. Phương pháp tách chiết DNA tổng số Phương pháp tách chiết DNA tổng số theo Gawel và Jarret (1991) [31] như sau: (1) Lấy 200mg lá non nghiền trong nito lỏng thành bột mịn. (2) Bổ sung 0,8 ml đệm rửa (Tris HCl 1M, EDTA 0,5M, pH=8, Sobitol 2M, NaH2PO4 0,4 %, H2O), li tâm 15 phút tốc độ 12000 vòng /phút, loại bỏ dịch nổi. Thêm 700 μl đệm tách (Tris HCl 1M, pH=8, NaCl 5M, EDTA 0,5M, CTAB 4%, H2O), trộn nhẹ. Ủ 650C ít nhất 1 giờ, 5 phút lắc đều 1 lần, lấy ra để ở nhiệt độ phòng 5 phút. (3) Thêm 600 μl chloroform : isoamyl (24:1), trộn đều 20 phút. (4) Li tâm 13000 vòng/phút trong 10 phút. (5) Hút 500 μl dịch trong sang ống 1,5 ml, bỏ tủa. (6) Thêm 500 μl isoprropanol, trộn nhẹ đặt lên đá chờ có tủa trắng. (7) Li tâm 13000 vòng /phút trong 5 phút, bỏ dịch, úp xuống giấy cho khô. (8) Bổ sung 300 μl cồn 70% búng nhẹ. (9) Li tâm 13000 vòng/phút, 5 phút, loại bỏ cồn. (10) Làm khô DNA bằng máy speed vac. (11) Hoà tan DNA trong H2O khử ion. 2.3.2.2. Định lượng và kiểm tra độ tinh sạch của DNA tổng số Kiểm tra độ tinh sạch của DNA bằng 2 phương pháp: (1) Phương pháp quang phổ hấp thụ: Kiểm tra nồng độ và độ tinh sạch của DNA trên máy quang phổ ở bước sóng 260nm và 280nm. Nồng độ DNA trong dung dịch tách chiết được tính theo công thức: Nồng độ DNA (ng/μl) = A260 x 50 x hệ số pha loãng. Độ sạch của DNA được xác định bằng tỷ lệ A260/A280. Dung dịch chứa DNA có tỷ lệ A260/A280 là 1,8- 2,0 được coi là đảm bảo chất lượng. (2) Phương pháp điện di: Điện di kiểm tra DNA của các mẫu thí nghiệm trên gel agarose 0,8%. Sản phẩm điện di được nhuộm bằng ethidium bromide, soi và chụp ảnh dưới ánh sáng cực tím. Dựa vào hình ảnh điện di kiểm tra nồng độ và độ tinh sạch của DNA trong mẫu thí nghiệm đã tách chiết. 2.3.2.3. Kỹ thuật PCR Sau khi tách chiết và kiểm tra được độ tinh sạch của DNA tiến hành nhân gen LTP bằng kỹ thuật PCR theo Mullis và cs (1985) với cặp mồi đặc hiệu được trình bày trong bảng 2.3. Bảng 2.3. Trình tự cặp mồi nhân gen LTP Mồi Trình tự mồi (5’-3’) Xuôi ATGGCTAGCCTGAAGGTTGC Ngược TTACTTGATGTTAGCGCAGTT Thành phần, chu kỳ nhiệt cho phản ứng PCR được trình bày trong bảng 2.4 và bảng 2.5. Bảng 2.4. Thành phần phản ứng PCR STT Thành phần Thể tích (µl) 1 Nước cất khử ion khử trùng 12,5 2 Dung dịch đệm 10X 2,5 3 MgCl2 (25mM) 2,5 4 dNTPs (2,5 mM) 2,0 5 Mồi xuôi (10 pM/µl) 2,0 6 Mồi ngược (10 pM/µl) 2,0 7 Taq-polymerase (5U/1µl) 0,5 8 DNA mẫu 1 Tổng 25 Bảng 2.5. Chu kỳ nhiệt cho phản ứng PCR Bước Phản ứng Nhiệt độ (0C) Thời gian Chu kỳ 1 Biến tính 94 3 phút 1 2 Biến tính 94 1 phút 30 3 Gắn mồi 56 1 phút 4 Kéo dài chuỗi 72 1 phút 30 giây 5 Hoàn tất kéo dài 72 10 phút 1 6 Kết thúc phản ứng 4 ∞ Sản phẩm PCR được điện di kiểm tra trên gel agarose 1% trong TAE 1X, với sự có mặt của marker chuẩn và chụp ảnh dưới ánh sáng cực tím. Sau đó, sản phẩm được tinh sạch (thôi gel) theo bộ Kit DNA extraction Kit K05013 của hãng Fermentas. 2.3.2.4. Phương pháp tinh sạch sản phẩm PCR Điện di sản phẩm PCR trên gel agarose 1% và cắt lấy băng quan tâm có kích thước khoảng 350 bp cho vào ống eppendort 1,5 ml . Bổ sung 1000µl dung dịch Binding esdution. Ủ ở 550C trong khoảng 20 phút, 5 phút trộn nhẹ cho gel tan hoàn toàn thành dịch trong suốt. Bổ sung 5 - 10µl Silica power vào và ủ sản phẩm ở 550C khoảng 5 phút rồi vontex khoảng 2 phút. Li tâm 10000 vòng/phút trong 1 phút, loại dịch nổi, thu cặn màu trắng. Bổ sung tiếp khoảng 500µl Buffer wash, vontex 2 phút. Li tâm 10000 vòng/phút trong 1 phút để loại dịch nổi, thu tủa (bước này lặp lại 3 lần). Làm khô DNA trong box. Hoà tan DNA trong 20µl H2O deion khử trùng rồi ủ sản phẩm ở 550C trong 5 - 10 phút. Li tâm 10000 vòng/phút trong 1 phút để thu dịch nổi, bỏ tủa. Điện di kiểm tra sản phẩm thôi gel trên gel agarose 1%. Sản phẩm điện di được nhuộm bằng ethidium bromide, soi và chụp ảnh dưới ánh sáng cực tím. 2.3.2.5. Phương pháp gắn gen vào vector tách dòng Sản phẩm PCR sau khi được tinh sạch sẽ được gắn trực tiếp vào vector tách dòng pBT. Thành phần phản ứng gắn gen vào vector tách dòng pBT được thể hiện ở bảng 2.6. Bảng 2.6. Thành phần phản ứng gắn gen vào vector tách dòng pBT STT Thành phần Thể tích (µl) 1 Nước cất khử ion khử trùng 12,2 2 DNA 4 3 Ligation buffer 10X 2 4 Vector pBT 1 5 Enzyme T4 ligase 0,8 Tổng 20 Hỗn hợp được ủ ở 220C trong 1h, sau đó được biến nạp vào tế bào khả biến E.coli DH5α Hình 2.3. Sơ đồ vector pBT 2.3.2.6. Biến nạp vector tái tổ hợp vào tế bào khả biến E.coli DH5α Bổ sung 7µl vector đã gắn gen vào ống đựng tế bào khả biến và trộn nhẹ. Đặt hỗn hợp vào đá trong 30 phút, rồi ủ ở 420C chính xác 1 phút. Sau đó tiếp tục đặt hỗn hợp vào đá 5 phút. Bổ sung 400µl môi trường LB lỏng (pepton, cao nấm men, NaCl) vào hỗn hợp rồi đem hỗn hợp nuôi lắc 200 vòng/phút trong 1 giờ ở 370C. Sử dụng que cấy trải, trải 200µl dịch khuẩn lên đĩa môi trường LB đặc (pepton, cao nấm men, NaCl, agarose) có chứa kháng sinh ampicillin (100mg/l), X-gal (40mg/l) và IPTG (100µM). Ủ đĩa ở 370C trong 16 giờ. Sau đó, chọn những khuẩn lạc có màu trắng nuôi trong môi trường LB lỏng (có bổ sung ampicillin) qua đêm. 2.3.2.7. Phương pháp PCR trực tiếp từ khuẩn lạc (clony-PCR) Lấy dịch nuôi chứa vi khuẩn kiểm tra sản phẩm chọn dòng bằng phản ứng clony-PCR. Thành phần của phản ứng clony-PCR tương tự như trong phản ứng PCR chỉ khác mẫu DNA thay bằng DNA plasmid. Chu trình nhiệt của phản ứng clony-PCR tương tự như trong phản ứng PCR, chỉ thay đổi nhiệt độ gắn mồi là 540C. Sản phẩm clony-PCR được kiểm tra trên gel agarose 1% trong đệm TAE 1X, nhuộm gel trong ethidium bromide 1% và chụp ảnh dưới ánh sáng đèn cực tím. 2.3.2.8. Tách chiết plasmid Sau khi kiểm tra sản phẩm clony-PCR tiến hành tách plasmid bằng bộ Kit AccuPrep Plasmid Extraction của hãng Bioneer. Các bước tách chiết plasmid: Lấy dịch vi khuẩn li tâm 3000 vòng/phút trong 7 phút, bỏ dịch thu cặn. Hòa cặn trong 250 ml Resuspension Buffer for plasmid (Buffer 1), đảo nhẹ. Bổ sung 250 ml Lysis Buffer for plasmid (Buffer 2) vào ống trên, đảo nhẹ. Bổ sung 350 ml Neutralization Buffer for plasmid (Buffer 3), đảo nhẹ để tránh kết tủa cục bộ. Li tâm 13000 vòng/phút trong 10 phút. Hút dịch nổi cho chảy qua cột tinh sạch plasmid của hãng Bioneer. Li tâm 13000 vòng/phút trong 1 phút, loại bỏ dịch chảy qua cột. Bổ sung 500 ml Denaturation Buffer for plasmid (Buffer D), li tâm 13000 vòng/phút trong 1 phút, loại bỏ dịch chảy qua cột. Bổ sung 700 ml Washing Buffer for plasmid (Buffer 4), li tâm 13000 vòng/phút trong 1 phút, loại bỏ dịch chảy qua cột. Đặt cột sang ống 1,5 ml mới, cho 20 ml H2O vào chính giữa cột, để ở nhiệt độ phòng khoảng 3 phút và li tâm 13000 vòng/phút trong 1 phút. Thu nhận plasmid. Kiểm tra sản phẩm tách plasmid trên gel agarose 1% trong đệm TAE 1X, nhuộm gel trong ethidium bromide 1% và chụp ảnh dưới ánh sáng đèn cực tím. 2.3.2.9. Phương pháp xác định trình tự nucleotide Trình tự của gen được xác định trên máy đọc trình tự nucleotide tự động ABI PRISM@ 3100 Advant Genetic Analyzer (Applied Biosystem) sử dụng bộ hoá chất sinh chuẩn BigDyeÒ Terminator v3.1 Cycle Sequencing. 2.3.3. Phương pháp xử lí số liệu 2.3.3.1. Phương pháp thống kê bằng chương trình Excel Xác định giá trị trung bình, phương sai, độ lệch chuẩn, sai số trung bình mẫu ... bằng chương trình Excel trên máy vi tính theo Chu Văn Mẫn (2003) [14]. 2.3.3.2. Phương pháp xử lý trình tự gen Sử dụng phần mềm DNAstar và Bioedit để phân tích, so sánh trình tự gen. CHƯƠNG 3. KẾT QUẢ VÀ THẢO LUẬN 3.1. PHÂN TÍCH ĐẶC ĐIỂM HÌNH THÁI, HOÁ SINH HẠT CỦA CÁC GIỐNG ĐẬU XANH NGHIÊN CỨU 3.1.1. Đặc điểm hình thái và khối lượng 1000 hạt của các giống đậu xanh Kết quả nghiên cứu một số đặc điểm hình thái và khối lượng 1000 hạt của các giống đậu xanh nghiên cứu được trình bày ở bảng 3.1. Bảng 3.1. Một số đặc điểm hình thái của các giống đậu xanh nghiên cứu TT Tên giống Màu gốc thân mầm Hình dạng hạt Màu vỏ hạt P 1000 hạt (g) 1 ĐXVN 4 Tím Bầu dục Xanh mỡ 51,50±0.20 2 ĐXVN 5 Xanh Trụ Xanh mốc 53,40 ± 0,25 3 VN 99-3 Tím Ô van Xanh mốc 52,36 ± 0,28 4 044/ĐX06 Xanh Trụ Xanh mốc 46,40 ± 0,44 5 TN Tím Ô van Xanh mốc 48,10 ± 0,62 6 LS Tím Ô van Xanh mốc 50,20 ± 0,84 7 HN 1 Xanh Trụ Xanh mốc 51,46 ± 0,18 8 HN 2 Tím Ô van Xanh mốc 53,15 ± 0,24 9 BG 1 Xanh Trụ Xanh mốc 54,30 ± 0,47 10 BG 2 Xanh Bầu dục Xanh mỡ 58,00 ± 0,60 11 BG 3 Xanh Ô van Vàng 47,25 ± 0,55 12 HG 1 Tím Ô van Xanh mốc 52,20 ± 0,55 13 HG 2 Xanh Trụ Xanh mỡ 57,32 ± 0,33 Qua bảng 3.1, chúng tôi rút ra một số nhận xét sau: * Về màu gốc thân mầm: sau khi hạt đậu xanh nảy mầm khoảng 7 ngày thì màu gốc thân được phân biệt rõ, gồm màu xanh và màu tím. Các giống có màu gốc thân mầm màu xanh là ĐXVN 5, 044/ĐX06, HN 1, BG 1, BG 2, BG 3 và HG 2, còn các giống có màu gốc thân mầm màu tím là ĐXVN 4, VN 99-3, TN, LS, HN 2 và HG 1. Cây càng lớn thì màu sắc gốc thân càng không rõ và có màu nâu gần như nhau. Hiện chưa có nghiên cứu nào tìm thấy mối liên quan giữa màu sắc gốc thân với một tính trạng nào của cây đậu xanh. * Về hình dạng hạt: các giống đậu xanh nghiên cứu có nhiều hình dạng khác nhau, bao gồm hình trụ, ô van và bầu dục. Trong đó, hạt có hình trụ có các giống ĐXVN 5, 044/ĐX06, HN 1, BG 1 và HG 2. Hạt có hình ô van có các giống VN 99-3, TN, LS, HN 2, BG 3 và HG 1. Còn lại hai giống ĐXVN 4 và BG 2 thì hạt có dạng hình bầu dục. Tuy nhiên, tìm hiểu về mối quan hệ giữa hình dạng hạt với các đặc tính sinh lý, hoá sinh của cây đậu xanh chưa có công trình khoa học nào công bố. * Về màu sắc vỏ hạt: màu vỏ hạt của các giống đậu xanh nghiên cứu bao gồm xanh bóng, xanh mốc và vàng bóng. Trong đó, màu xanh mốc là màu chủ đạo. Có tới 9 giống trong tổng số 13 giống đậu xanh nghiên cứu là vỏ hạt có màu xanh mốc, bao gồm các giống ĐXVN 5, VN 99-3, 044/ĐX06, TN, LS, HN 1, HN 2, BG 1 và HG 1. Ba giống là ĐXVN 4, BG 2 và HG 2 vỏ hạt có màu xanh mỡ. Còn lại giống BG 3 vỏ hạt có màu vàng bóng. Trong các màu trên, màu xanh mốc là màu được người tiêu dùng ưa chuộng và cho là có vị thơm ngon hơn hai màu còn lại nhưng chưa có nghiên cứu nào khẳng định mối tương quan giữa màu sắc vỏ hạt với chất lượng hạt. * Về khối lượng 1000 hạt: khối lượng 1000 hạt là một trong các yếu tố quan trọng cấu thành năng suất của cây đậu xanh. Khối lượng 1000 hạt của 13 giống đậu xanh nghiên cứu dao động trong khoảng 46,40g (044/ĐX06) đến 58,00g (BG 2). Khối lượng 1000 hạt của các giống xếp theo thứ tự giảm dần như sau: BG 2 > HG 2 > BG 1 > ĐXVN 5 > HN 2 > VN 99-3 > HG 1 > ĐXVN 4 > HN 1 > LS > TN > BG 3 > 044/ĐX06. Khối lượng hạt có thể thay đổi do chế độ chăm sóc, mùa vụ và điều kiện môi trường. 3.1.2. Chiều dài rễ, thân của các giống đậu xanh ở giai đoạn cây non Mối quan hệ giữa rễ và thân là mối quan hệ kích thích: Rễ sinh trưởng tốt sẽ kích thích các bộ phận trên mặt đất, trong đó có thân sinh trưởng và ngược lại. Rễ cung cấp nước và chất khoáng cho thân lá, còn thân lá lại cung cấp cho hệ thống rễ các sản phẩm quang hợp để sinh trưởng. Mối quan hệ hữu cơ này biểu hiện hết sức chặt chẽ trong giai đoạn cây còn non. Vì vậy, nghiên cứu kích thước của rễ và thân ở giai đoạn cây non là cơ sở để đánh giá năng suất và khả năng chống chịu của cây. Kết quả nghiên cứu kích thước rễ và thân của các giống đậu xanh nghiên cứu ở giai đoạn cây non được thể hiện ở bảng 3.2. Bảng 3.2. Kích thước rễ, thân của các giống đậu xanh ở giai đoạn cây non STT Tên giống Chiều dài thân (cm) Chiều dài rễ (cm) 1 ĐXVN 4 11,22 ± 0,17 9,35 ± 0,21 2 ĐXVN 5 9,50 ± 0,20  8,13 ± 0,14 3 VN 99-3 8,32 ± 0,07  7,15 ± 0,09 4 044/ĐX06 14,12 ± 0,09  11,45 ± 0,16 5 TN 8,7 8 ± 0,12 7,59 ± 0,20 6 LS 11,50 ± 0,13  10,47 ± 0,22 7 HN 1 8,29 ± 0,03 6,80 ± 0,10 8 HN 2 8,05 ± 0,21  6,24 ± 0,12 9 BG 1 10,45 ± 0,15  8,15 ± 0,15 10 BG 2 10,80 ± 0,31  8,29 ± 0,12 11 BG 3 12,14 ± 0,10 10,65 ± 0,15 12 HG 1 11,75 ± 0,05 10,80 ± 0,32 13 HG 2 11,65 ± 0,13  10,50 ± 0,27 Qua bảng 3.2 cho thấy: Chiều dài thân ở giai đoạn cây non của các giống đậu xanh nghiên cứu dao động từ 8,05 - 14,12 cm. Giống có chiều dài thân ngắn nhất là HN 2 (8,05 cm), giống có chiều dài thân dài nhất là 044/ĐX06 (14,12 cm). Chiều dài thân của các giống đậu xanh nghiên cứu có thể xếp theo thứ tự giảm dần như sau: 044/ĐX06 > BG 3 > HG 1> HG 2 > LS > ĐXVN 4 > BG 2 > BG 1 > ĐXVN 5 > TN > VN 99-3 > HN 1 > HN 2. Chiều dài rễ ở giai đoạn cây non của các giống đậu xanh nghiên cứu dao động từ 6,24 - 11,45 cm. Giống có chiều dài rễ ngắn nhất là HN 2 (6,24 cm), giống có chiều dài rễ dài nhất là 044/ĐX06 (11,45 cm). Chiều dài rễ của các giống đậu xanh nghiên cứu có thể xếp theo thứ tự giảm dần như sau: 044/ĐX06 > HG 1 > BG 3 > HG 2 > LS > ĐXVN 4 > BG 2> BG 1 > ĐXVN 5 > TN > VN 99-3 > HN 1 > HN 2. Những giống đậu xanh 044/ĐX06, HG 1, BG 3, HG 2 có chiều dài thân và rễ dài nhất nên rất có thể đây là những giống có khả năng chịu hạn cao nhất trong các giống mà chúng tôi nghiên cứu. Còn hai giống HN 1 và HN 2 có chiều dài thân và rễ ngắn nhất nên đây cũng rất có thể là những giống có khả năng chịu hạn kém nhất. Vì vậy, cần tiếp tục nghiên cứu khả năng chịu hạn của các giống đậu xanh để làm sáng tỏ mối liên quan này. Theo Nguyễn Vũ Thanh Thanh (2003), chiều dài thân của các giống đậu xanh tác giả nghiên cứu dao động từ 9,53 - 15,60 cm. Chiều dài rễ

Các file đính kèm theo tài liệu này:

  • docLuanvanOanhsua3.doc
Tài liệu liên quan