Luận văn Nghiên cứu ứng dụng chiếu xạ nhằm tạo ra các dòng cà chua đột biến cho năng suất cao từ nguồn vật liệu của Cuba

MỞ ĐẦU 4

1.Tính cấp thiết của đề tài 4

2. Mục đích nghiên cứu 5

3. Ý nghĩa khoa học và thực tiễn của đề tài 5

Chương1. TỔNG QUAN TÀI LIỆU 6

1.1. Nguồn gốc, phân loại, đặc điểm và giá trị của cây cà chua 6

1.1.1. Nguồn gốc 6

1.1.2. Phân loại thực vật 6

1.1.3. Đặc tính thực vật 78

1.1.4. Gía trị dinh dưỡng và ý nghĩa kinh tế 10

1.2. Tình hình sản xuất cà chua trên thế giới và ở Việt Nam 12

1.2.1. Tình hình sản xuất cà chua trên thế giới 12

1.2.2. Tình hình sản xuất cà chua ở Việt Nam 14

1.3. Khái quát về các nghiên cứu sử dụng đột biến trong chọn tạo giống cây trồng 15

1.3.1. Ý nghĩa của đột biến trong công tác chọn tạo giống cây trồng 15

1.3.2. Cơ sở di truyền của đột biến 17

1.3.3. Các tác nhân gây đột biến 18

1.4. Ứng dụng của phương pháp gây đột biến trong nghiên cứu chọn giống 20

 

doc81 trang | Chia sẻ: mimhthuy20 | Ngày: 22/09/2020 | Lượt xem: 66 | Lượt tải: 0download
Bạn đang xem trước 20 trang tài liệu Luận văn Nghiên cứu ứng dụng chiếu xạ nhằm tạo ra các dòng cà chua đột biến cho năng suất cao từ nguồn vật liệu của Cuba, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
n ADN. Tuy nhiên, phương pháp RFLP vẫn còn có một vài hạn chế như sau: - Đòi hỏi mẫu ADN đem phân tích phải có số lượng và chất lượng tốt - Nó phụ thuộc váo sự phát triển của thư viện các mẫu dò đặc hiệu đối với từng loài. - Kỹ thuật này rất khó tự động hóa. - Mức độ đa hình thấp và chỉ có một vài locus được nhận biết sau mỗi lần thử. - Tốn thời gian, thiết bị và đắt tiền - Yêu cầu phải có mẫu dò đánh dấu phóng xạ. Các chỉ thị dựa trên PCR PCR là một kỹ thuật sinh học phân tử, nó là sự sao mã các đoạn ADN nhờ enzyme mà không cần đến cơ thể sống. Chỉ cần một lượng nhỏ ADN có thể nhân bản một số lượng lớn các gen cần thiết nhờ một thiết bị biến đổi nhiệt và enzyme ADN polymerase. Những ưu điểm chính của kỹ thuật PCR so với phương pháp phân tích dựa trên sự lai hoá đó là chỉ cần một lượng nhỏ ADN và có thể không cần đến mẫu dò gắn phóng xạ, có khả năng khuếch đại trình tự ADN từ các mô đã được bảo quản, có thể ứng dụng cho nhiều loại chỉ thị di truyền, có khả năng chọn lọc nhiều gen trong cùng một thời điểm và trong thời gian ngắn và đây là một phương pháp có thể áp dụng được ở tất cả các phòng thí nghiệm quy mô nhỏ và có thể tiết kiệm về chi phí. Ngày nay dựa trên kỹ thuật PCR nhiều loại chỉ thị phân tử đã được phát triển và cho kết quả rất triển vọng. Các loại chỉ thị phân tử khác nhau dựa trên PCR được chia thành hai dạng dựa vào các mồi sử dụng để khuếch đại như sau: - Chỉ thị phân tử mồi ngẫu nhiên hoặc bán ngẫu nhiên không phát triển trên các đoạn ADN không cần biết trước trình tự (như AP- PCR, RADP, DAF, AFLP, ISSR) - Chỉ thị phân tử có chủ đích được phát triển từ các trình tự ADN đã biết (như ETS, CAPS, SSR, SCAR, STS) SSR (Simple Sequence Repeat, Microsatellites) SSR hay còn gọi là vi vệ tinh, là những đoạn trình tự ADN đơn giản lặp lại nối tiếp và chỉ gồm 1- 6bp có trong hệ gen của các loài sinh vật bậc cao (Litt and Luty, 1989; Jacob et al, 1991). Phản ứng PCR đối với chỉ thị SSR được thực hiện nhờ sự có mặt của mồi xuôi, mồi ngược và kéo dài mạch từ đầu 5’ đến 3’ của ADN mạch khuôn. Các đoạn sản phẩm PCR thường được phân tích bằng cách điện di trên băng polyacrylamide kết hợp với nhuộm AgNO3 hoặc Ethylrium bromua (EtBt). Gel agarose (thường 3%) với EtBr cũng được sử dụng khi sự khác biệt về kích thước của các allen giữa các mẫu lớn hơn 10 bp. Tuy nhiên, tuỳ từng loài mà số lượng các nucleotid trong mỗi đơn vị lặp lại có thể thay đổi từ một đến hàng chục và số lượng đơn vị lặp lại có thể biến động từ hai đến hàng chục lần hoặc nhiều hơn. Thông thường có các kiểu lặp lại: Lặp lại hoàn toàn: các đơn vị lặp lại sắp xếp nối tiếp nhau. Lặp lại không hoàn toàn: xen kẽ vào các đơn vị lặp lại là một hoặc một số nucleotid khác. Lặp lại phức tạp: xen kẽ giữa các đơn vị lặp lại khác nhau. Thông thường, các SSR có mặt chủ yếu ở các vùng dị nhiễm sắc của nhiễm sắc thể như vùng tâm động hoặc các đầu mút, chúng giữ vai trò quan trọng trong việc điều hoà phiên mã đối với các gen hoạt động ở vùng nguyên nhiễm sắc, góp phần làm tăng tính ổn định cơ học của nhiễm sắc thể trong các quá trình phân bào và có thể chứa đựng những thông tin di truyền liên quan đến sự xác định giới tính ở cả động vật và thực vật. Bản chất đa hình của SSR có thể được sinh ra do sự nhân bội từ ADN tổng số của hệ gen nhờ sử dụng 2 đoạn mồi bổ trợ với trình tự gần kề hai đầu của vùng lặp lại. Sự khác nhau về độ dài ở locut SSR được phát hiện bởi sự nhân đoạn ADN nhờ phản ứng PCR. Kích thước của sản phẩm PCR được xác định một cách chính xác bằng điện di trên gel agarose hoặc gel polyacrylamide với sự khác nhau về độ dài có thể rất nhỏ (2bp). Chỉ thị SSR dùng để đánh giá đa dạng di truyền, xác lập quan hệ di truyền của cây trồng, chọn lọc tính kháng bệnh, một số tính trạng có quan hệ chặt chẽ với năng suất ở cây lúa, lập bản đồ, nghiên cứu locut tính trạng số lượng (QTL). Ưu điểm và hạn chế của chỉ thị SSR Thuận lợi to lớn của sự phân tích SSR là phương pháp này biểu hiện số lượng lớn sự đa hình. Hơn nữa, khả năng phân biệt các cá thể khi có sự kết hợp các locus được kiểm tra làm cho phương pháp này rất hữu dụng trong các thí nghiệm dòng chảy gene, xác định cây trồng và phân tích mối quan hệ di truyền [35]. SSR là chỉ thị đồng trội, do đó dị hợp tử có thể dễ dàng được xác định trong quá trình thực nghiệm. Tính đồng trội của SSR sẽ gia tăng sự hiệu quả và độ chính xác của những phép tính toán di truyền quần thể dựa trên những chỉ thị này so với những chỉ thị khác, như AFLP và RAPD. Hơn nữa, việc xác định dị hợp tử ở thế hệ F1 sẽ làm cho những phân tích phả hệ, sự lai giống, dòng chảy gen trở nên dễ dàng hơn (Schlotterer và Pemberton, 1994). SSR là công cụ hữu hiệu để chọn lọc giống, đa dạng hoá về các vật liệu di truyền và dùng trong thiết lập bản đồ di truyền. Chẳng hạn, Parasnis phát hiện đoạn lặp lại GATA kích thước 5 kb chỉ có ở cây đu đủ đực không có ở cây đu đủ cái bằng chỉ thị SSR. Khi các mồi SSR đã được xác định, việc sàng lọc các vật liệu sử dụng kỹ thuật này hoàn toàn không đắt tiền. Hơn nữa, sự khuếch đại SSR giữa các loài nghĩa là sự xác định những mồi SSR thích hợp không cần thiết trong những loài có quan hệ gần [24]. Các chỉ thị SSR ngày nay là chỉ thị được lựa chọn ở hầu hết các lĩnh vực di truyền phân tử vì chúng có độ đa hình cao thậm chí ở các dòng có quan hệ gần gũi, nó không đòi hỏi chất lượng và số lượng DNA cao, có thể trao đổi thông tin giữa các phòng thí nghiệm [23]. Hạn chế của chỉ thị này là quá trình thiết kế mồi quá đắt, mỗi loại mồi chỉ đặc trưng cho một loài và không thể áp dụng phân tích trên một hệ thống lớn bao gồm nhiều loài có quan hệ di truyền xa nhau. RAPD (Random amplified polymorphic DNA) RADP hay còn gọi là đa hình khuếch đại ngẫu nhiên ADN là kỹ thuật sử dụng các đoạn mồi có trình tự nucleotide ngẫu nhiên để nhân bản các đoạn ADN mạch khuôn trong bộ gen mà không cần biết trước trình tự của nó [32]. Kỹ thuật RADP thường sử dụng các mồi ngẫu nhiên có khoảng 10bp có nhiệt độ bắt cặp mồi thấp (thường từ 34-37oC). Ưu điểm của kỹ thuật này là không cần biết trình tự nucleotide của đoạn ADN khuôn, quy trình tiến hành tương đối nhanh, dễ thực hiện ở quy mô phòng thí nghiệm nhỏ, cần một lượng mẫu ADN nhỏ. Tuy nhiên, chỉ thị RADP có một số hạn chế đó là các phản ứng PCR phụ thuộc vào nồng độ và chất lượng của ADN khuôn, nồng độ của MgCl2, tỉ lệ giữa mồi và mạch khuôn, nhiệt độ bắt cặp, nguồn enzyme taq polymerase. Tuy nhiên những hạn chế này có thể được khắc phục bởi việc lựa chọn phương pháp tách chiết ADN thích hợp và tối ưu hoá các thông số đã nêu trên. Một hạn chế khác của chỉ thị RAPD đó là RADP có tính trội do đó những gen nào điều khiển tính trạng lặn sẽ khó tìm thấy sự đa hình trong quá trình điện di. Chỉ thị DAF (DNA amplification fingeprinting) khác biệt với RAPD chủ yếu là sử dụng các mồi ngắn (ít nhất 5 bp), nồng độ mồi cao hơn, hai chu kỳ nhiệt thay cho ba chu kỳ nhiệt và nhận biết sản phẩm khuếch đại băng gel polyacrylamide nhuộm AgNO3. Đặc tính chủ yếu của AP- PCR khi so sánh với RAPD và DAF là: AFLP (Amplified Fragment Length Polymorphism) Chỉ thị AFLP là sự kết hợp của RFLP với khả năng linh hoạt của kỹ thuật PCR bằng cách gắn các mồi đã biết trình tự với các đoạn DNA được phân cắt bởi enzyme giới hạn [32 ] Ưu điểm của AFLP là: 1) Độ tin cậy cao và có khả năng tái bản 2) Không yêu cầu bất cứ thông tin về trình tự DNA của các sinh vật cần nghiên cứu 3) Cung cấp nhiều thông tin nhờ khả năng phân tích đồng thời một số lượng lớn các locus đa dạng (tỉ lệ đa phần hiệu quả) với sự kết hợp của các mồi riêng rẽ trên một bản gel riêng rẽ khi so sánh với RADPs, RFLP và microsatellites 4) Các sản phẩm khuếch đại AFLP cùng di chuyển hầu hết là tương đồng và ở locus đặc trưng ngoại trừ các loài đa bội So sánh với phương pháp RAPD hạn chế của AFLP là: a) Phương pháp này yêu cầu thực hiện nhiều bước để thu được kết quả. b) Phương pháp này yêu cầu các mẫu ADN sạch các thành phần ức chế có thể ảnh hưởng đến enzyme giới hạn. c) Kỹ thuật này yêu cầu sử dụng gel polyacrylamide kết hợp với nhuộm AgNO3, hoặc phương pháp đánh dấu phóng xạ hoặc đánh dấu huỳnh quang để xác định, nó sẽ đắt hơn và khó khăn hơn so với gel agarose. d) Phương pháp này đòi hỏi bổ sung chi phí để mua các emzyme giới hạn và các enzyme nối mạch cũng như các adapter. Giống như RAPD, phần lớn các locus AFLP là trội nó không phân biệt được sự đồng trội từ các thể dị hợp. Điều này làm giảm độ chính xác của chỉ thị AFLP trong phân tích di truyền quần thể, lập bản đồ di truyền ISSR (inter- simple sequence repeat) ISSR là sự khuếch đại của các đoạn ADN tồn tại ở một khoảng có thể khuếch đại được giữa hai vùng lặp vi vệ tinh giống hệt nhau định hướng theo chiều đối diện. Kỹ thuật này sử dụng các vùng vi vệ tinh như các mồi trong một phản ứng PCR hướng tới nhiều locus của hệ gen để khuếch đại chủ yếu các đoạn lặp trình tự đơn giản của các đoạn có kích thước khác nhau. Ưu điểm của kỹ thuật này: Kỹ thuật này đơn giản, nhanh và không cần phải sử dụng các chất đánh dấu phóng xạ. Nhược điểm của ISSR là chỉ phân tích được các gen trội, không phát hiện được sự đa hình của gen lặn trong các cơ thể dị hợp và ISSR cũng không có khả năng phân tích các đoạn cùng dịch chuyển trên gel bắt nguồn từ các vùng không tương đồng [26]. EST (Expressed sequence tags) EST là chỉ thị phân tử bắt nguồn từ cDNA (complementary DNA) được tổng hợp của một phân tử mRNA. Mỗi cDNA là điển hình cho một gen được phân lập do đó các nhà khoa hoc có thể giải trình tự một vài trăm nucleotide từ đầu 5’ hoặc 3’ để tạo ra các đoạn đánh dấu trình tự biểu hiện 5’ (5’EST) hoặc 3’EST [25]. Việc tạo ra các chỉ thị EST được bắt đầu từ việc thiết lập các thư viện về cDNA. Chỉ thị EST đầu tiên được sử dụng để nhận dạng các bản sao của gen nhưng sau này nó là một công cụ để khám phá gen, thu thập số liệu về sự biểu hiện và điều hoà của gen và xác định trình tự gen để phát triển các trình tự có giá trị cao như RFLP, SSR, CAPS dựa trên chỉ thị EST. EST cũng đã được sử dụng để thiết kế các mẫu dò cho ADN microarray. CAPS (Cleaved Amplified Polymorphic Sequence) CAPS là sự kết hợp của PCR và RFLP và đầu tiên nó được gọi là PCRRFLP [34]. Do sự đa hình giữa các cá thể sinh vật được xác định dựa vào kết quả so sánh kích thước các băng ADN của chúng, vì vậy mà sản phẩm PCR gồm các băng ADN của các mẫu sinh vật có thể không khác nhau về kích thước nhưng lại có thể khác nhau về trình tự sắp xếp các nucleotide. Từ lý giải nói trên, các nhà khoa học đã sử dụng các enzym giới hạn để cắt sản phẩm RAPD, STS, SSR... nếu trình tự nucleotide của các sản phẩm đó chứa vị trí nhận biết của enzym nào đó thì nó sẽ bị cắt tại đó. Sự đa hình sẽ được phát hiện khi sản phẩm cắt được tiếp tục được điện di trong gel. SCAR (Sequence characterized amplified region) Chỉ thị SCAR là một đoạn ADN của hệ gen được xác định bằng sự khuếch đại bởi PCR sử dụng một cặp mồi oligonucleotide đặc hiệu [32]. Các chỉ thị SCAR được thu nhận bằng cách nhân dòng và giải trình tự hai đầu mút của chỉ thị RAPD mà xuất hiện ở dạng đặc trưng cho các mục đích riêng biệt (ví dụ như băng RADP biểu hiện trong các dòng kháng bệnh nhưng không có ở trong các dòng dễ mắc bệnh). Chỉ thị SCAR có ưu điểm hơn chỉ thị RAPD vì chúng chỉ xác định một locus riêng biệt, sự khuếch đại của các chỉ thị này ít nhạy cảm với các điều kiện phản ứng và chúng có khả năng biến đổi trong các chỉ thị đồng trội . STS (sequence tagged site) Chỉ thị STS là một đoạn duy nhất, ngắn có trình tự xác định, mỗi chỉ thị STS được ghi nhận trên bản đồ tại một vị trí chuyên biệt nào đó trong hệ gen. Ở thực vật các chỉ thị STS là một cặp mồi được thiết kế bằng cách giải trình tự một mẫu dò RFLP mà có số bản sao ít nhất khi phân tích [22] hoặc là các đoạn AFLP. Các mồi được thiết kế dựa trên chỉ thị RAPD đôi khi cũng được coi như chỉ thị STS. Chỉ thị STS là tiền đề cho phép chuyển đổi bản đồ di truyền thành bản dồ vật lý. Các chỉ thị STS là chỉ thị đồng trội, nó thích hợp với việc phân tích mẫu với số lượng nhiều và khả năng tự động hoá cao. SNP (single nucleotide polymorphism) Trong một số những công bố về trình tự hệ gen của một vài sinh vật đã có những nghiên cứu sự khác nhau về trình tự giữa các cá thể, giữa các giống hoặc dưới loài. Những nghiên cứu này đã khám phá ra sự đa hình của các nucleotide đơn (SNP) và cho thấy các gen bị thêm hoặc mất nucleotide rất nhiều và phân bố trong toàn bộ gen của các loài khác nhau kể cả thực vật. Đúng như tên của nó, một chỉ thị SNP là một base thay đổi trong một đoạn DNA với sự chuyển đổi thường xảy ra của hai nu bổ sung ở vị trí nhất định. Do đó SNP ngược lại với tất cả các phương pháp đã nói ở trên, việc xác định các allele không thể dựa trên sự khác biệt về kích thước khi điện di trên gel. Trong nhiều năm qua một số lượng lớn các phương pháp xác định kiểu gen SNP khác nhau và các hoá chất đã được phát triển dựa trên nhiều phương pháp khác nhau của việc đánh giá các allele và phát hiện các lý thuyết nền tảng. Tất cả các phương pháp của việc xác định kiểu gen SNP đều kết hợp hai yếu tố: đầu tiên là sự tạo ra của một sản phẩm của allele đặc hiệu và thứ hai là phân tích các sản phẩm đó. Ưu điểm của SNP đó là nó có tính ổn định rất cao về mặt di truyền, có thể ước đoán được tần suất allele dễ dàng trong bất cứ một quần thể nào thông qua một loạt các kỹ thuật xét nghiệm. Tuy nhiên nhược điểm của phương pháp này là nó đòi hỏi chi phí rất cao. 1.5.2 Các nghiên cứu ứng dụng chỉ thị phân tử trong chọn giống cà chua Việc sử dụng các chỉ thị phân tử trong chọn giống cà chua đã có rất nhiều tác giả thực hiện, nhưng dùng chi thị SSR để đánh giá sự đa dạng của cà chua thì phải kể đến một số tác giả như: Kwo,YS, 2009 đã sử dụng chỉ thị SSR để đánh giá đa dang di truyền của cà chua. Tác giả sử dụng 33 mồi SSR được sàng lọc từ 63 giống cà chua có tổng số 132 mảng đa hình thu được hệ số PIC là 0,628 dị hợp là 0,21- 0,88 có 1302 locus hệ số tương đồng là 0,644. Solomon Benor, Mengyu Zhang, Zhoufe Wang, Hongsheng Zhang (2008) đã xác định tính đa dạng của 39 dòng cà chua chọn lọc từ Trung Quốc, Nhật Bản, Hàn Quốc và Mỹ. Sử dụng 35 mồi SSR thu được tổng cộng 150 alen, số lượng alen trung bình của mỗi locus là 4,3. Hệ số PIC là 0,31, hệ số tương đồng di truyền là 0.85, dòng được chia thành 4 nhóm. Pritesh Parmor, Vihol Poza, Vaishnavi Chauhan (2008) đã sử dụng 23 cặp mồi SSR trên 25 giống cà chua có 13% mồi không biểu hiện khuếch đại PCR, 40 alen được thể hiện, hệ số PIC thấp 0,08 ở mồi SSR 304 và hệ số PIC là 0,4 khi sử dụng với bảng mồi khác. Liwang Liu, Yan wang, Yi QinGong (2007) đã sử dụng chỉ thị phân tử RAPD, ISSR và SSR để kiểm tra độ tinh khiết di truyền giống lai của hai dòng cà chua thương mại là giống Hezuo 90 và Sufen số 8 và các dòng tương ứng được sàng lọc với 148 cặp mồi RAPD và mồi ISSR và 49 mồi SSR. Subramarian Geethanjali, Kai-Yichen, David Son V. patrana and Jaw-Fen Wang (2009) xác định tính đa hình của các locus được đánh giá trong một bảng điều khiển của 16 kiểu gen bao gồm Solanum lycopersicum và họ hàng hoang dã của nó. Hai mươi-một dấu SSR bắt nguồn từ 13 dòng vô tính BAC được đa hình ở 2 loại cà chua là: West Virginia 700 và Hawaii 7996 và đã được lập bản đồ bằng cách sử dụng một số dòng cận giao tái tổ hợp có nguồn gốc từ giao phối chéo. Các dấu hiệu được phân phối trải rộng khắp các nhiễm sắc thể tổng chiều dài 117,6 cM theo thứ tự của các dòng vô tính BAC gốc. Một chỉ tiêu (QLT) chủ yếu liên quan đến tính kháng bệnh héo vi khuẩn đã được ánh xạ trên nhiễm sắc thể 6 ở vị trí tương tự của các báo cáo T-6 locus. Chương 2. NỘI DUNG, VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 2.1. Nội dung nghiên cứu Xác định liều chiếu xạ thích hợp với hạt cà chua. Đánh giá khả năng sống và sinh trưởng của hạt cà chua chiếu xạ M1. Đánh giá, chọn lọc đột biến ở thế hệ M2. Nghiên cứu các đột biến ở thế hệ M3 về năng suất, chất lượng và bằng các chỉ thị phân tử. 2.2. Vật liệu nghiên cứu 2.2.1. Vật liệu thực vật Hạt của các giống cà chua Cu ba là: Carucha, Delmay, Maybel 2.2.2. Hoá chất - Một số hóa chất thông dụng dùng trong nghiên cứu sinh học phân tử của các hãng Sigma, Merck, bao gồm CTAB, Tris base, Boric acid, NaCl, EDTA, 6X orange loading dye solution, Taq Polymerase, Ethanol, 2- Propanol, Acetic acid glacial, Phenol, Chloroform, isoamyalcohol, Ribonuclease A, Formaldehyde 37%, Ethylrium Bromua, Bind Silane, Sigma Cote, Acrylamide, Bis- Acrylamide, Sodium thiosunfate, Urea. - Các hóa chất dùng cho phản ứng PCR: bốn loại deoxynucleotit triophosphat (dNTPs) của Sigma, Taq-ADN Polymerase của Fementas; - 24 mồi SSR cà chua TT Marker Chromosome Repeat type Primer 1 SSR51 1 (ACAA)6 F: CTACCCTGGTCTTGGTGGAA P: AAAGGATGCTCTAGCTTCTCCA 2 SSR135 1 (ATT)6 F: TGATCGCTTGTGTCCACCTA P: AAAGGAAGTGATGGAAAGCG 3 SSR66 2 (ATA)8 F: TGCAACAACTGGATAGGTCG P: TGGATGAAACGGATGTTGAA 4 SSR96 2 (AT)12 F: GGGTTATCAATGATGCAATGG P: CCTTTATGTCAGCCGGTGTT 5 SSR111 3 (TC)6(TCTG)6 F: TTCTTCCCTTCCATCAGTTCT P: TTTGCTGCTATACTGCTGACA 6 SSR11 3 (CAG)6 F: CCTTCAATTGACCTCCCTAC P: GCATCTGGAATTAGAGGCG 7 SSR43 4 (TAC)7 F: CTCCAATTGGGAATAACA P: TTAGGAAGTTGCATTAGGCCA 8 SSR593 4 (TAC)7 F: TGGCATGAACAACCAAT P: AGGAAGTTGCATTAGGCCAT 9 SSR115 5 (AT)16 F: CACCCTTTATTCAGATTCCTCT P: ATTGAGGGTATGCAACAGCC 10 SSR590 5 (TC)6(AC)4 F: TCTCAAAGTCGTTCCTTCTTGA P: GGAAGAGAAACGCGGACATA 11 SSR47 6 (AT)14 F: TCCTCAAGAAATGAAGCTCTG P: CCTTGGAGATAACAACCACAA 12 SSR578 6 (ACC)6(ATC)5 F: ATTCCCAGCACAACCAGACT P: GTTGGTGGATGAAATTGTG 13 SSR285 7 (TTAT)2(AT)6 F: AGTGGCTCTCACCTACTGCG P: CAATTCTCAGGCATGAAACG 14 SSR45 7 (AAT)14 F: TGTATCCTGGTGGACCAATG P: TCCAAGTATCAGGCACACCA 15 SSR38 8 (TCT)8 F: GTTTCTATAGCTGAAACTCAACCTG P: GGGTTCATCAAATCTACCATCA 16 SSR594 8 (TCT)8 F: TTCGTTGAAGAAGATGATGGTC P: CAAAGAGAACAAGCATCCAAGA 17 SSR73 9 (AG)2(AGA)7(TAGTGA)2 F: TGGGAAGATCCTGATGATGG P: TTCCCTTTCCTCTGGACTCA 18 SSR383 9 (ATA)9 F: ATTGTACAAAGACCCGTGGC P: GTTGCACACTGGATCAATGC 19 SSR4 10 (CGG)7 F: TTCTTCGGAGACGAAGGGTA P: CCTTCAATCCTCCAGATCCA 20 SSR248 10 (TA)21 F: GCATTCGCTGTAGCTCGTTT P: GGGAGCTTCATCATAGTAACG 21 SSR80 11 (TTTCAA)2(GTACAA)2(CAA)7 F: GGCAAATGTCAAAGGATTGG P:AGGGTCATGTTCTTGATTGTCA 22 SSR46 11 (AT)14 F: CCGAGGCGAATCTTGAATAC P:GCACCATCTCTTGTGCCTCT 23 SSR20 12 (GAA)8 F: GAGGACGACAACAACAACGA P: GACATGCCACTTAGATCCACAA 24 SSR124 12 (CACC)2(GA)7 F: TCAATCCATCACACCTTGGA P :GAGGAAGAAGACCACGCAAA 2.3. Phương pháp nghiên cứu 2.3.1. Phương pháp chiếu xạ gây đột biến Sử dụng nguồn chiếu xạ tia gamma Co60. Để tìm liều chiếu xạ thích hợp đối với cà chua một thí nghiệm xác định liều được thiết lập 1000 hạt/liều ở các liều: 0, 5, 7, 10,15, 20 và 25 Kr. 2.3.2. Phương pháp đánh giá ngoài đồng ruộng 1000 hạt mỗi giống được chiếu xạ và giống đối chứng, gieo trồng để đánh giá sinh trưởng phát triển của cây ở thế hệ M1. Sau khi gieo 14 ngày cây con được đem trồng ở ruộng thí nghiệm, khoảng cách trung bình 35 x 40 cm. Quan sát và đánh giá sơ bộ về khả năng sinh trưởng, phát triển của cây chiếu xạ và cây đối chứng. Đối với cây chiếu xạ, thu hạt của những quả đầu để tạo quần thể hạt M2. Lượng phân sử dụng và cách bón: Lượng phân bón/ 1000m2: 20 kg urea, 50 kg super lân, 20 kg clorua kali, 12 kg calcium nitrat, 50 kg NPK 16-16-6 (dành cho giống thấp cây), 1 tấn phân chuồng hoai và 100 kg vôi bột Cách bón: Bón lót (3-7 ngày trước khi trồng): Toàn bộ phân chuồng, vôi bột và super lân, 3 kg clorua kali, 2 kg calcium nitrat và 10-15 kg NPK 16-16-6. Vôi rải đều trên mặt đất trước khi cuốc đất lên luống, phân chuồng hoai và lân rải đều trên mặt luống rồi xới đều. Bón thúc đợt 1 (15 ngày sau khi trồng): 4 kg urea, 3 kg clorua kali, 10 kg 16-16-8 và 2 kg calcium nitrat. Bón phân vào lỗ giữa 2 gốc cà. Bón thúc đợt 2 (35-40 ngày sau cấy, khi cây đã đậu trái đều): 6 kg urea, 5 kg clorua kali, 10-15 kg 16-16-8 và 2 kg calcium nitrat. Bón phân vào lỗ giữa 2 gốc cà. Bón thúc đợt 3 (60-65 ngày sau trồng, bắt đầu thu trái rộ): 6 kg urea, 5 kg clorua kali, 10-15 kg 16-16-8 và 3 kg calcium nitrat. Cách bón vẫn như trên. Hạt M2 được gieo trồng để chọn các biến dị có lợi về năng suất, chất lượng. Mỗi giống cà chua gieo 1000 hạt. Thí nghiệm được bố trí theo khối ngẫu nhiên 3 lần lặp lại cho mỗi công thức. Các chỉ tiêu đánh giá: - Khả năng sinh trưởng, phát triển của cây cà chua M1: Màu sắc thân, màu sắc lá, mức độ phân nhánh, hiều cao cây, Thời gian trồng đến nở hoa 50%, số quả. - Đánh giá, chọn lọc các biến dị ở thế hệ M2: Chiều cao cây, màu sắc lá, hình dạng quả, kích thước quả, số cây khác dạng gốc. - Đánh giá các chỉ tiêu năng suất và yếu tố cấu thành năng suất: + Số quả/cây: + Khối lượng quả. + Năng suất lý thuyết. NSLT = Mật độ x số quả/cây x khối lượng trung bình quả - Đánh giá các chỉ tiêu về năng suất: + Trọng lượng thịt quả + Tỉ lệ giữa trọng lượng thịt quả/ trọng lượng trung bình quả. + Độ Brix: Đo bằng Brix kế. 2.3.3. Phương pháp tách chiết ADN tổng số Phương pháp tách chiết ADN tổng số dựa theo phương pháp của P. ObaraOkeyo & Kako (1998)[31] có cải tiến. Quy trình tách chiết như sau: - Nghiền 0,3g mẫu lá trong nitơ lỏng bằng chày cối sứ thành dạng bột mịn, cho vào ống eppendoff 2ml - Bổ sung 800ml đệm chiết CTAB có nhiệt độ 60oC và 60ml dung dịch SDS 10% vào mẫu rồi cho vào máy vortex đảo đều. - Ủ mẫu trong bể ổn nhiệt ở nhiệt độ 65oC trong 30 phút, lấy ra để nguội ở nhiệt độ phòng. - Bổ sung chloroform với tỉ lệ 1:1 về thể tích so với dịch mẫu sau đó đảo đều. - Ly tâm 11.500 vòng/phút ở nhiệt độ 4oC trong 15 phút. Hút dịch nổi phía trên sang ống eppendoff mới, bỏ cặn. - Bổ sung 2µl RNase (nồng độ 10µg/ml) vào dung dịch thu được, ủ ở nhiệt độ 37oC trong 1giờ - Bổ sung 2- propanol với tỉ lệ 1:1 về thể tích để thu tủa ADN. Ly tâm 11.500 vòng/phút ở nhiệt độ 4oC trong 10 phút để thu tủa. - Loại bỏ dịch nổi phía trên, rửa kết tủa ADN bằng ethanol 70% rồi làm khô ADN ở nhiệt độ phòng. - Hoà tan ADN bằng đệm TE. Kiểm tra nồng độ và chất lượng ADN bằng cách điện di 5µl dung dịch ADN trên gel agarose 1% với thang nồng độ ADN chuẩn là 25µg. 2.3.4. Phương pháp PCR Phương pháp PCR được tiến hành với các thành phần phản ứng như sau: ADN mẫu 25ng, dung dịch đệm PCR 1X, MgCl2 2mM, dNTP 10µM, Taq polymerase 1U, mồi SSR 1µM và bổ sung H2O để tổng thể tích phản ứng là 15µl. Chu trình nhiệt phản ứng PCR như sau: Bước Phản ứng Nhiệt độ(0C) Thời gian Chu kỳ 1 Biến tính 95 5 phút 1 2 Biến tính 95 1 phút 35 3 Bắt cặp môi 35 1 phút 30 giây 4 Kéo dài mạch 72 1phút 45 giây 5 Hoàn tất kéo dài 72 7 phút 1 6 Kế thúc phản ứng 4 ∞ 1 2.3.5. Điện di sản phẩm PCR Sản phẩm PCR sau khi biến tính được điện di trên gel polyacrylamide biến tính với các bước chuẩn bị như sau: + Chuẩn bị kính: - Kính ngắn được lau sạch bằng nước cất 3 lần, lau lại bằng ethanol 95% ba lần, xử lý chống dính bằng dung dịch Sigma Cote sau đó loại bỏ Sigma Cote dư thừa bằng lau ethanol 95% hai lần. - Kính dài được lau sạch bằng nước cất 3 lần, lau lại bằng ethanol 95% 3 lần, rồi xử lý dính bằng Bind Silane (bổ sung 2µl Bind Silane vào 1ml dung dịch có chứa 95% ethanol + 5% glacial acetic acid), sau đó lau lại kính bằng ethanol 95% hai lần. + Gel polyacrylamide bao gồm các thành phần sau (bản gel có kích thước 30cm x 38cm): - Dung dịch acrylamide 4,5%: 70ml - Dung dịch APS 10%: 700µl - Dung dịch TEMED: 70µl Trộn đều hỗn hợp các dung dịch trên và dùng xilanh bơm vào giữa hai tấm kính. + Sau 1-2 giờ gel được polyme hoá hoàn toàn. Lắp ráp máy điện di, tiến hành tiền điện di ở công suất 80W, cho đến khi nhiệt độ trên gel đạt đến 550C thì dừng lại và bắt đầu tra sản phẩm PCR vào các giếng. Tiếp tục điện di với công suất 65W, nhiệt độ trên gel là 500C - 550C trong thời gian 55- 60 phút. 2.3.6. Phương pháp nhuộm Ethidium Bromide với gel polyacrylamide Hoà Ethidium Bromide1% vào khay. Đặt bản gel đã điện di vào và điều chỉnh sao cho ethidium Bromide ngập hết bản gel, sau đó đậy khay trong 15 phút. Lấy gel ra rửa lại sạch bằng nước. 2.3.7. Phương pháp phân tích số liệu - Sử lý số liệu nông sinh học bằng các phần mềm: EXCEL, IRRISTAT. - Để xác định quan hệ di truyền giữa các mẫu nghiên cứu, các kết quả thu được từ quá trình điện di, sản phẩm PCR được thành lập dựa vào sự xuất hiện hay không xuất hiện của các băng ADN. - Số 1: các alen có xuất hiện băng ADN; - Số 0: các alen không xuất hiện băng ADN; - Số 9: các dòng không xuất hiện băng ADN ở tất cả các alen (khuyết số liệu); Các số liệu trên được nhập vào phần mềm Exel lần lượt theo từng mồi. - Hệ số PIC (Polymorphic Information Content) được coi là thước đo tính đa hình của các allele ở từng locus SSR. Hệ số PIC được tính theo công thức của Nei (Nei, 1973) như sau: PIC =1 - SPi2 (trong đó Pi là tần số xuất hiện của allele thứ i). - Số liệu được chuyển sang chương trình NTSYSpc 2.1 để phân tích, tìm ra hệ số tương đồng di truyền (I) (theo Jaccard) và thành lập cây quan hệ chủng loại. - Khoảng cách di truyền (D) được tính theo công thức: D = 1 - I - Tỷ lệ dị hợp (H%) của mỗi mẫu được tín

Các file đính kèm theo tài liệu này:

  • docluanvanthacsi_dinhdangword_275_4984_1869897.doc
Tài liệu liên quan