Luận văn Phân lập và định danh tác nhân gây bệnh đốm lá cây cải ngọt tại TP HCM bằng kỹ thuật PCR và giải trình tự vùng 16S-23S rDNA

MỤC LỤC

CHưƠNG TRANG

Trang tựa

Lời cảm tạ . i

Tóm tắt . ii

Mục lục . iii

Danh sách các chữ viết tắt . vi

Danh sách các bảng. vii

Danh sách các hình . viii

1. MỞ ĐẦU . 1

1.1. Đặt vấn đề . 1

1.2. Mục đích và yêu cầu . 2

1.2.1. Mục đích . 2

1.2.2. Yêu cầu . 3

2. TỔNG QUAN TÀI LIỆU . 4

2.1. Tổng quan nghiên cứu ngoài nước . 4

2.1.1. Lịch sử phát hiện và sự phân bố. . 4

2.1.2. Tác nhân và triệu chứng bệnh . 5

2.1.3. Tác động kinh tế của bệnh. . 6

2.1.4. Sinh lý, sinh thái và điều kiện phát triển bệnh. . 7

2.1.5. Hình thái, đặc điểm sinh lý, sinh hóa của vi khuẩn gây bệnh. . 8

2.1.6. Phương pháp phân lập và dịnh danh tác nhân gây bệnh . 8

2.1.7. Những nghiên cứu về phát hiện và dịnh danh tác nhân gây

bệnh bằng phương pháp sinh học phân tử .10

2.2. Tổng quan nghiên cứu trong nước . 12

2.3. Vùng ITS (rDNA intergenic spacer) và gen hrpF

(hypersensitive reaction and pathogenicity). . 13

2.3.1. Gen hrpF (hypersensitive reaction and pathogenicity). . 13

2.3.2. Ribosome DNA (rDNA). . 13

3. VẬT LIỆU VÀ PHưƠNG PHÁP TIẾN HÀNH . 15

3.1. Thời gian và địa điểm . 15

3.1.1. Thời gian . 15

3.1.2. Địa điểm . 15

3.2. Vật liệu . 15

3.3. Hóa chất . 15

3.3.1. Các hóa chất dùng ly trích DNA từ vi khuẩn . 15

3.3.2. Các hóa chất dùng trong điện di . 16

3.3.3. Hóa chất cho phản ứng PCR (do công ty Bio – Rad cung cấp) . 16

3.3.4. Môi trường . 17

3.4. Dụng cụ, thiết bị . 17

3.5. Phương pháp . 17

3.5.1. Phương pháp thu thập mẫu bệnh . 17

3.5.2. Phương pháp phân lập vi sinh vật từ mẫu bệnh . 18

3.5.3. Phương pháp chủng bệnh trên rau cải trồng trong nhà lưới . 18

3.5.3.1. Phương pháp trồng cây kí chủ . 18

3.5.3.2. Chủng bệnh . 19

3.5.4. Phương pháp ly trích DNA từ vi khuẩn . 20

3.5.5. Phương pháp PCR . 20

3.5.5.1. Khuếch đại đoạn DNA trong vùng ITS của vi khuẩn . 20

3.5.5.2. Khuếch đại đọan DNA trong gen hrpF . 22

3.5.6. Phương pháp điện di và đọc kết qủa . 22

3.5.6.1. Điện di trên gel agarose . 22

3.5.6.2. Đọc kết quả điện di. 22

3.5.7. Phương pháp xác định trình tự gen từ sản phẩm PCR. . 23

3.5.7.1. Chuẩn bị khuôn DNA. . 23

3.5.7.2. Phản ứng đọc trình tự sử dụng BigDye Terminator V3.1

Cycle Sequencing Kit (Applied Biosystems). . 24

3.5.7.3. Tinh sạch sản phẩm khuếch đại. . 25

3.5.7.4. Chạy điện di và ghi nhận tín hiệu trên máy sequencer. . 25

3.5.7.5. Quy trình tóm tắt các bước đọc trình tự. . 26

4. KẾT QUẢ VÀ THẢO LUẬN . 27

4.1. Kết quả thu thập và phân lập mẫu vi khuẩn gây bệnh. . 27

4.2. Kết quả chủng bệnh trên rau cải ngọt trồng trong nhà lưới. 28

4.3. Kết quả ly trích và pha loãng DNA vi khuẩn. . 31

4.4. Kết quả phản ứng PCR. . 32

4.4.1. Kết quả PCR khuếch đại vùng ITS. . 32

4.4.2. Kết quả điện di tinh sạch sản phẩm PCR . 32

4.4.3. Kết quả PCR khuếch đại vùng hrpF. . 33

5. KẾT LUẬN VÀ ĐỀ NGHỊ . 34

TÀI LIỆU THAM KHẢO . 36

PHỤ LỤC . 39

 

pdf52 trang | Chia sẻ: leddyking34 | Ngày: 23/04/2013 | Lượt xem: 1970 | Lượt tải: 12download
Bạn đang xem nội dung tài liệu Luận văn Phân lập và định danh tác nhân gây bệnh đốm lá cây cải ngọt tại TP HCM bằng kỹ thuật PCR và giải trình tự vùng 16S-23S rDNA, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
syringae pv. maculicola gây triệu chứng đốm lá, vết bệnh thƣờng không định hình, kích thƣớc vết bệnh khoảng 2 mm, khi nhiều vết bệnh liên kết lại với nhau, đƣờng kính vết bệnh có thể lên tới 1 cm. Màu sắc vết bệnh thƣờng có dạng sũng nƣớc, viền úa vàng bao quanh vết bệnh. Trong nghiên cứu của mình về bệnh đốm lá trên cây canola (Brassica napus), một loại cây trồng thuộc họ thập tự, S. Geatan, N. Lopez (2005) đã xác định rằng, tác nhân của bệnh này là do vi khuẩn Xanthomonas campestris gây nên. Vi khuẩn xâm nhiễm qua lỗ khí khổng tạo nên các vết đốm hoại tử. Triệu chứng bệnh đôi lúc có dạng cháy lá chữ V, đó là kết quả của sự xâm nhiễm qua lỗ thủy khổng ở mép lá. 6 Từ tháng 12 năm 2001, K. Pernezn, E. Dickstein phát hiện dịch bệnh đốm lá cải bắp ở trang trại vùng Everglades thuộc phía nam bang Florida. Triệu chứng là các đốm nhỏ, kích thƣớc khoảng 1 – 2 mm và thƣờng xuất hiện ở phần mặt lá. Tác nhân là do vi khuẩn Xanthomonas campestris pv. armoraciae gây nên. Xanthomonas campestris pv. campestris và các chủng khác thuộc loại này nhƣ X. campestris pv. abbrans, raphani, armmoraciae, và incanae đƣợc biết đến nhƣ là những chủng gây bệnh đốm lá hoặc cháy lá chữ V trên các cây trồng họ thập tự (J.G. Vicente, 2001). Cũng theo J.G. Vicente và ctv (2006) phân lập và định danh tác nhân gây bệnh đốm lá trên cây củ cải trắng và cây cải ngựa (horseradish), kết quả cho thấy, tác nhân gây bệnh là vi khuẩn Xanthomonas campesrtis pv. armoraciae hoặc Xanthomonas campesrtis pv. raphani. Ở Queensland, Australia, tác nhân gây bệnh đốm lá họ thập tự do vi khuẩn Xanthomonas campestris pv. campestris gây nên. Vi khuẩn thƣờng gây hại mạnh trên các giống cải (Moffett, M.L và ctv, 1976). Nhƣ vậy, tác nhân gây bệnh đốm lá họ tập tự cho đến nay bao gồm hai giống chính, giống Xanthomonas bao gồm: Xanthomonas campestris pv. armoraciae, Xanthomonas campestris pv. campestris, Xanthomonas campesrtis pv. raphani. Và giống Pseudomonas gồm có: Pseudomonas syringae pv. maculicola. 2.1.3. Tác động kinh tế của bệnh Bệnh đốm lá vi khuẩn họ thập tự phân bố rộng rãi, gây hại nhiều loại cây trồng có giá trị kinh tế cao. Ở Oklahoma, hàng năm có khoảng 600 ha rau bị bệnh tấn công. Bệnh làm giảm năng suất và chất lƣợng của một số loại rau ăn lá họ thập tự. Từ 1994 đến 1996 bệnh làm thiệt hại hoàn toàn những cánh đồng trồng cải rổ, cải xanh, củ cải ở bang này (Youfu Zhao và ctv, 2000). Theo CPC (2001), bệnh đốm lá họ thập tự là bệnh quan trọng gây tổn thất đáng kể về năng suất cũng nhƣ chất lƣợng. Bệnh là đối tƣợng nguy hiểm cho cây trồng họ thập tự ở các bang phía bắc nƣớc Mỹ. Trong những năm 1960 và 1970, bệnh gây hại rất nặng rên cánh đồng trồng cải bắp của bang Texas. Năm 1972 và 1973, bệnh đã gây thành dịch cho các khu vực Đông – Bắc, và các bang phía tây nƣớc Mỹ, khoảng 70% cây con lấy từ típ ƣơm cây đều bị nhiễm bệnh, sự thiệt hại này ƣớc tính là khoảng 7 1 triệu USD. Ở Canada, trong vụ Đông 1979 – 1980, bệnh gây tổn thất khoảng 60% sản lƣợng cải bắp. Ở miền nam tỉnh Buenos Aires – Argentina, tỷ lệ bệnh đốm lá cây canola (Brassica napus) trung bình koảng 59%, những năm bệnh nặng, tỷ lệ bệnh khoảng 90% và làm thất thoát khoảng 20% năng suất (S. Geatan, N. Lopez, 2005). Các loài gây bệnh thuộc giống Xanthomonas spp. Là vi khuẩn gây tổn thất kinh tế nặng nề nhất trên các cây trồng họ thập tự nhƣ cải bông, cải bắp, cải xanh (J.G. Vicente và ctv, 2006). 2.1.4. Sinh lý, sinh thái và điều kiện phát triển bệnh. Vi khuẩn Xanthomonas campestris pv. armoraciae tồn tại trong tàn dƣ cây trồng ở trong đất, nhƣng không sống trong đất sau khi tàn dƣ cây trồng bị phân hủy. Vi khuẩn cũng có thể tồn tại trên cây cỏ, hạt giống. Bệnh phát triển mạnh khi có ẩm độ lá cao (trên 85%), khoảng nhiệt độ thích hợp để bệnh phát triển tƣơng đối rộng 20 – 30oC. Trong điều kiện thời tiết có sƣơng hoặc mƣa liên tục kết hợp với nhiệt độ cao là điều kiện rất thuận lợi để bệnh phát triển mạnh mẽ. Vi khuẩn có thể lan từ cây này qua cây khác do mƣa, tƣới và các dụng cụ lao động (Lowell L. Black, 2000). Theo Youfu Zhao (2002), vi khuẩn gây bệnh lan truyền qua hạt giống là chủ yếu. nếu bệnh do Xanthomonas campestris pv. campestris gây nên thì vi khuẩn có thể tồn tại cả ở hạt giống, tàn dƣ thực vật và cỏ dại. Chƣa phát hiện đƣợc sự tồn tại và lan truyền qua đất và tồn dƣ cây trồng của vi khuẩn gây bệnh là Xanthomonas campestris pv. armoraciae. Vi khuẩn Xanthomonas campestris pv. armoraciae và Pseudomonas syringae pv. maculicola gây bệnh đốm lá cây rau ăn lá họ thập tự gần nhƣ không tồn tại trong tàn dƣ cây trồng đƣợc chôn vùi sâu, nhƣng chúng tồn tại lâu hơn trong tàn dƣ cây trồng trên mặt đất. Điều này cũng tƣơng tự nhƣ vi khuẩn gây bệnh Pseudomonas syringae pv. phaseolicola. Chúng có thể tồn tại lâu hơn trong tồn dƣ thực vật trên mặt đất. Vi khuẩn gây bệnh cũng tồn tại trong tồn dƣ thực vật đã bị hoai mục. Cũng nhƣ các vi khuẩn gây bệnh khác, vi khuẩn Xanthomonas campestris pv. armoraciae có quan hệ chặt chẽ với sự xâm nhiễm vào mô lá qua lỗ hở tự nhiên (khí khổng, thủy khổng) và các vết thƣơng tạo nên hiện tƣợng đốm lá (Veronique Hugouvieux, 1998). 8 Theo CPC (2001), Xanthomonas campestris pv. campestris sống sót qua mùa đông trong đất, đặc biệt là các cây kí chủ nhiễm bệnh và các loài cỏ dại mọc gần ruộng trồng cây họ thập tự, vi khuẩn có thể tồn tại tới 3 năm. Vi khuẩn xâm nhập vào hạt, lỗ khí khổng và thủy khổng của cây. Vi khuẩn từ lá mầm ở cây con có thể lan truyền trực tiếp lên các lá thật. Vi khuẩn xâm nhập vào cây qua sự hình thành giọt nƣớc tiết ra từ lỗ thủy khổng trong giai đoạn buổi sáng (Ruisen và Gielink, 1993). Nhiệt độ thích hợp cho sinh trƣởng của vi khuẩn là 25 – 30oC. Trong những điều kiện nhƣ vậy, triệu chứng bệnh sẽ xuất hiện sau 7 – 14 ngày. Nhiệt độ thấp, triệu chứng bệnh xuất hiện chậm. Triệu chứng bệnh không thể hiện rõ khi nhiệt độ dƣới 18 – 20oC. Vi khuẩn có thể sống sót trên bề mặt lá đến 73 ngày sau khi lá đƣợc chủng bệnh bằng phƣơng pháp phun (Schultz và Gabrielson, 1986). Vi khuẩn có thể lây lan từ cây này qua cây khác nhờ gió, mƣa và công cụ lao động. 2.1.5. Hình thái, đặc điểm sinh lý, sinh hóa của vi khuẩn gây bệnh Các loài vi khuẩn gây bệnh thuộc giống Xanthomonas thƣờng có phản ứng Gram âm, háo khí, tế bào hình gậy (0,4 – 0,7 x 0,7 – 1,8 μm), tiêm mao đơn cực, không sản sinh nitrates, phản ứng catalase dƣơng tính, tạo axít yếu từ các nguồn carbonhydrate. Khuẩn lạc có màu vàng, nhầy, lồi và bóng trên môi trƣờng NGA và YDC agar. Đối với các loài Xanthomonas, khuẩn lạc có thể mọc và phát triển ở nhiệt độ 35oC, hóa lỏng gelatin, không tạo urease, sản sinh axit từ arabinose, glucose và manose (N.W. Schaad, 1998). 2.1.6. Phƣơng pháp phân lập tác nhân gây bệnh Theo Youfu Zhao (2000), đối với bệnh đốm lá họ thập tự do vi khuẩn thuộc giống Xanthomonas, việc ly trích vi khuẩn tốt nhất từ các đốm lá mới bị nhiễm bệnh. Sát trùng bề mặt bằng sodium hypochlorite 0,25% trong 30 giây, đốm bệnh đƣợc cắt nhỏ trong giọt nƣớc tiệt trùng và cấy zích zắc dịch khuẩn lên môi trƣờng nutrient agar (NA). Đĩa cấy ủ trong 28oC, sau 3 – 5 ngày đem quan sát khuẩn lạc. Chọn các khuẩn lạc màu vàng, mọc tách rời để nghiên cứu. Theo CPC (2001), vi khuẩn gây bệnh thực vật giống Xanthomonas có thể đƣợc phân lập từ rìa vết bệnh (phần tiếp giáp giữa mô bệnh và mô khỏe ). Vi khuẩn đƣợc cấy trên môi trƣờng Yeast dextrose calcium carbonate (YDC), Beef peptone agar + 5% water soluble starch. 9 Theo Shaad, N.W. (1988), vi khuẩn Xanthomonas campestris pv. campestris có thể đƣợc phát hiện bằng cách nuôi cấy trên môi trƣờng bán chọn lọc (semiselective media). Các loại môi trƣờng bán chọn lọc chuyên biệt đƣợc sử dụng là SX agar, SM agar, NSCAA, BSCAA. Các môi trƣờng này thƣờng dùng phân lập vi khuẩn Xanthomonas campestris pv. Campestris trong đất và hạt giống. 2.1.7. Những nghiên cứu về phát hiện và dịnh danh tác nhân gây bệnh bằng phƣơng pháp sinh học phân tử Để đánh giá sự đa dạng di truyền các dòng vi khuẩn Xanthomonas campestris gây bệnh đốm lá trên cây họ thập tự, Youfu Zhao và ctv (2000) đã sử dụng kỹ thuật rep-PCR với BOX primer BOXAIR [5’ – ca m p estris ca ro ta e T ra n slu cen s p h a seo li p ru n i vesica to ria o ryza e m a lva cea ru m M a n ih o tis B eg o n ia e p ela m g o n ii fra g a ria M ô i trƣ ờ n g + – – V – V – – – – – + – + S X + – – – V – – V – + V + S M + V – + V – + V – V – V – + + + B S C A A V + (+ ) V + V – V + – V + – (+ ) V + M X P – – – V – + V – – – V V V X P S a + + + + V + – + + (+ ) + + X C S V – + V + (+ ) V N D V V + V M D – 5 + V + (+ ) + + N D + V + + + T w een B ả n g 1 .1 S ự p h á t triển củ a m ộ t số lo à i v i k h u ẩ n X a n th o m o n a s trên m ô i trƣ ờ n g b á n ch o n lọ c 10 CTACGGCAAGGCGACGCTGACG – 3’]. Phản ứng rep – PCR trên các mẫu nghiên cứu tạo sản phẩm là các đoạn DNA có kích thƣớc từ 0,3 – 4 kb cho phép đánh giá sự tƣơng quan về mặt kiểu gen giữa các loài. Hình 2.1 Sản phẩm rep – PCR trong nghiên cứu của Youfu Zhao và ctv. Goncalves, E.R., và Rosato, Y.B (2002), trong nghiên cứu của mình về sự phát sinh loài vi khuẩn Xanthomonas campestris đã dùng kỹ thuật PCR sử dụng cặp primer Xan 1330 5’ – GTT CCC GGG CCT TGT ACA CAC – 3’ Xan 322 5’ – GGT TCT TTT CAC CTT TCC CTC – 3’ thiết kế dựa trên vùng rDNA 16S và 23S để khuếch đại vùng 16S – 23S rDNA ITS có kích thƣớc 1,1 kb. 11 Hình 2.2 Cấu trúc vùng 16S – 23S rDNA ITS của vi khuẩn Xanthomonas. Said M.S. Massomo và ctv (2003) đã thực hiện nghiên cứu định danh vi khuẩn Xanthomonas campestris pv. campestris trên cải bắp ở Tanzania bằng phƣơng pháp chủng bệnh, phân tích methyl este acit béo, ELISA gián tiếp và rep – PCR. Vi khuẩn sau khi phân lập đƣợc tiến hành phân tích sinh hóa; chủng bệnh bằng phƣơng pháp châm kim tạo vết thƣơng, lây nhiễm trên lá mầm, phun dịch khuẩn trên cây trƣởng thành. Acit béo đƣợc methyl hóa, ly trích và phân tích bằng máy sắc ký khí. Vi khuẩn đƣợc xác định bằng kỹ thuật ELISA gián tiếp sử dụng kháng thể đơn dòng đặc hiệu. Các dòng vi khuẩn sau khi xác định đƣợc tiến hành phân tích genomic fingerprinting bằng kỹ thuật rep – PCR với primer BOXAIR (5’ – CTACggCAAggCgACgCTgACg – 3’) và REP – PCR dùng cặp primer: REP 1R (5’ – IIIICgICgICATCIggC – 3’) REP 2I (5’ – ICgICTTATggCCTAC – 3’). Young Jin Park và ctv (2004) đã thực hiện nghiên cứu phát hiện vi khuẩn Xanthomonas campestris pv. campestris bằng kỹ thuật PCR dựa trên cặp primer XCF (5’ – CGATTCGGCCATGAATGACT – 3’) và XCR (5’ – CTGTTGATGGTGGTCTGCAA – 3’) đƣợc thiết kế từ gen hrpF của vi khuẩn Xanthomonas campestris pv. campestris để khuếch đại đoạn DNA có 12 kích thƣớc 535 bp. Nhóm nghiên cứu đã tiến hành thực nghiệm chứng minh tính chuyên biệt và đặc hiệu của primer XCR, XCF bằng cách thực hiện phản ứng PCR với nhiều thành phần hóa chất mà máy luân nhiệt khác nhau. Ngoài ra, kỹ thuật DNA dot – blot cũng đƣợc thực hiện nhằm kiểm chứng sự hiện diện của gen hrpF trong vi khuẩn, qua đó rút ra kết luận về sự bảo toàn của gen này. 2.2. Tổng quan nghiên cứu trong nƣớc Cho đến nay, những nghiên cứu về bệnh đốm lá họ thập tự nói chung và cây cải ngọt nói riêng còn khá ít. Theo Lê Lƣơng Tề và Vũ Triệu Mân (1999), bệnh đốm lá súp lơ là do vi khuẩn Pseudomonas syringae pv. maculicola gây nên. Bệnh đƣợc phát hiện lần đầu tiên ở Mỹ vào năm 1911. Triệu chứng bệnh trên các lá thật thƣờng là các đốm nhỏ, tròn, góc cạnh, màu nâu tím hoặc đen. Trên lá mầm xuất hiện các đốm trong giọt dầu, mép lá uốn cong. Đƣờng kính vết bệnh từ 1 – 3 mm. Vi khuẩn gây bệnh hình gậy, hai đầu tròn, kích thƣớc khoảng 1,5 – 3 x 0,5 – 1 μm, chuyển động nhờ vài ba lông roi ở một đầu. Khuẩn lạc trắng kem, tròn nhẵn, rìa gợn sóng. Vi khuẩn có khả năng phát huỳnh quang, tạo NH3, khử nitrate, không phân giải đƣờng thành axít, khí, không làm đông váng sữa, phân giải gelatin rất yếu, khả năng yếu tạo H2S và indol. Nhiệt độ thích hợp cho vi khuẩn sinh trƣởng là 24 – 25oC, nhiệt độ tối đa là 29oC, nhiệt độ gây chết là 47oC, nhạy cảm với tác động của ánh sáng mặt trời và khô hạn. Vi khuẩn xâm nhiễm qua lỗ khí khổng, vết thƣơng. Thời kỳ ủ bệnh là khoảng 4 – 6 ngày. Bệnh phát triển thuận lợi trong điều kiện ẩm độ cao (90%), nhiệt độ 17 – 25oC. Bệnh có thể lan truyền qua bọ nhảy. Ở trên cây cải bông và một số rau ăn lá nhƣ cải thìa, cải xanh, cải ngọt, bệnh đốm lá do vi khuẩn Xanthomonas spp. gây nên thƣờng xuất hiện trong vụ đông xuân. Trên cải bông, bệnh xuất hiện nhiều hơn so với các giống cải khác (Trần Thanh Tùng, 1997). Theo Phạm Văn Biên và Mai Thị Vinh (1998, 2000), bệnh đốm lá cải bông vùng trồng rau thành phố HCM do vi khuẩn Pseudomonas spp. gây nên. Bệnh thƣờng xuất hiện trên cải bông trồng trong vụ đông xuân. Bệnh phát sinh gây hại nặng vào những năm có thời tiết nóng ẩm. Giống Xanthomonas spp. thƣờng gây bệnh cháy lá chữ V 13 trên cải bắp, cải bông vùng Củ Chi, Hóc Môn, Bình Chánh. Bệnh cũng thƣờng xuất hiện trong vụ đông – xuân, khoảng từ tháng 11 – 2. Trong giống Xanthomonas spp. có một loài gây bệnh đốm lá cải bông đƣợc phát hiện trong năm 1998 ở vùng rau Vĩnh Lộc B, Bình Chánh, Tp. HCM. Triệu chứng bệnh ban đầu là các đốm nhỏ vàng sáng ở các lá thấp gần mặt đất, các đốm này trông gần giống với đốm do bọ nhảy gây hại. Bệnh thƣờng nặng hơn vào giai đoạn cuối vụ. Tỷ lệ bệnh giai đoạn phát triển thân lá khoảng 21%, nhƣng ở giai đoạn ra bông , bệnh có thể lên tới 50% (Mai Thị Vinh, 1998). Nhìn chung, số công trình nghiên cứu về tác nhân cũng nhƣ các đặc tính sinh học, sinh lý, sinh hóa, dịch tễ học của bệnh đốm lá cải ngọt nói riêng và bệnh đốm lá cây họ thập tự nói chung ở Việt Nam còn khá ít. 2.3. Vùng 16S – 23S rDNA ITS (rDNA intergenic spacer) và gen hrpF (hypersensitive reaction and pathogenicity) 2.3.1. Gen hrpF (hypersensitive reaction and pathogenicity) Để xâm nhập và gây bệnh trên cây kí chủ, các loài vi khuẩn thƣờng có hệ thống riêng tiết ra các loại enzyme (pectinases, cellulases, proteases) và các chất độc (Beattie và Lindow, 1994). Ngoài ra còn có sự tham gia của hệ thống các gen hrp. Gen này hiện diện trong hầu hết các loài vi khuẩn Gram âm ngoại trừ Agrobacterium (Lindgren, 1986). Gen này tạo cho vi khuẩn khả năng xâm nhập và nhân sinh khối trong cây nhiễm (susceptible plant), đồng thời tạo phản ứng siêu nhạy cảm (hypersensitive reaction) ở cây kháng (resistant plant). Phản ứng siêu nhạy cảm là một đáp ứng phòng vệ của cây kí chủ, thể hiện bằng sự hoại tử ở mô bị nhiễm (Klement, 1982). Tổ hợp gen này bao gồm 21 gen và 2 gen điều tiết là hrpX, hrpG nằm bên ngoài. Các gen hrp mã hóa các protein hrp. Các protein này là thành phần của hệ thống phóng tiết loại III (type III secretion system) cho phép tiết ra các loại protein gây độc (Van Gijsegem, 1993 và Van den Ackerveken, 1996). 2. 3.2. Ribosome DNA (rDNA) rDNA là nhóm gen mã hóa rRNA của ribosom, đóng vai trò quan trọng trong các nghiên cứu quan hệ phát sinh loài. rDNA đƣợc quan tâm nghiên cứu vì nó là một gen có nhiều bản sao và đặc biệt không mã hóa cho protein nào. Các bản sao của gen nằm liên tiếp trên một locus và liên quan mật thiết tới quá trình tiến hóa. Hơn nữa, ribosom 14 hầu nhƣ tồn tại trong mọi sinh vật và có cùng nguồn gốc tiến hóa. Phần lớn phân tử rDNA tƣơng đối bảo tồn nên đƣợc xem là cơ sở để tìm ra sự tƣơng đồng và các khác biệt khi so sánh các sinh vật khác nhau. Các primer thiết kế dựa trên những oligonucleotide có tính bảo tồn cao đƣợc sử dụng cho tất cả sinh vật nhằm khuếch đại các vùng tƣơng đƣơng dùng trong so sánh. Ngoài ra, nhiều primer và probe cũng đƣợc thiết kế dựa trên các vùng không bảo tồn dùng trong phát hiện và định danh vi sinh vật (Van de Peer và ctv, 1996). Theo Goncalves, E.R., và Rosato, Y.B (2002), rDNA 16S và 23S có tính bảo toàn cao. Ngƣợc lại, vùng ITS tiến hóa nhanh hơn và có nhiều biến động. Do đó, các primer đƣợc thiết kế dựa trên trình tự các vùng bảo toàn để khuếch vùng ITS, dùng trong các nghiên cứu về sự đa dạng di truyền, nguồn gốc phát sinh cũng nhƣ quan hệ giữa các loài. Ngoài ra, vùng ITS còn đƣợc sử dụng giải trình tự, đối chiếu với dữ liệu trên ngân hàng gen để định danh sinh vật. 15 Chƣơng 3. VẬT LIỆU VÀ PHƢƠNG PHÁP 3.1. Thời gian và địa điểm 3.1.1.Thời gian Đề tài đƣợc thực hiện trong thời gian từ ngày 06/02/2006 đến 30/07/2006 3.1.2. Địa điểm - Tiến hành lấy mẫu bệnh tại các vùng trồng rau trọng điểm ở Tp HCM: Củ Chi, Hóc Môn, quận 12. - Phân lập vi sinh vật từ mẫu bệnh tại Phòng Nghiên Cứu Bảo Vệ Thực Vật, Viện Khoa Học Kỹ Thuật Nông Nghiệp Miền Nam (IAS). - Chủng bệnh trên cây rau cải ngọt trong nhà lƣới thuộc Bộ môn Bảo Vệ Thực Vật, ĐH Nông Lâm Tp HCM. - Ly trích DNA và tiến hành phản ứng PCR, đọc trình tự tại Trung Tâm Phân Phân Tích Thí Nghiệm Hóa Sinh, ĐH Nông Lâm Tp HCM. 3.2. Vật liệu Mẫu bệnh phẩm thu thập từ các vùng trồng rau trọng điểm ở Tp HCM: Củ Chi, Hóc Môn, quận 12. Đề tài sử dụng dòng vi khuẩn đối chứng Xanthomonas axonopodis pv. citri gây bệnh ung thƣ trên cây bƣởi. 3.3. Hóa chất Các hoá chất đƣợc sử dụng trong đề tài này đƣợc sản xuất bởi Công ty Sigma, Merk, Amersham Biosence và Bio Rad. 3.3.1. Các hoá chất dùng để ly trích DNA từ vi khuẩn Phenol Chloroform Isoamyl Isopropanol Ethanol 100% Ethanol 70% RNAse 1mg/ml Hỗn hợp Phenol: Chloroform: Isoamyl (25:24:1). Dung dịch TE 1X vô trùng: 10mM Tris HCl, 1mM EDTA, pH 8,0 16 – Dung dịch đệm ly trích DNA Tris (trisma bazơ): chất đệm, giữ ổn định pH tránh tổn hại DNA EDTA: tạo phức Mg++, gây bất hoạt enzyme phân hủy DNA trong quá trình tách chiết SDS: 20 % : phá vỡ và tẩy sạch màng tế bào, màng nhân để phóng thích DNA. - Dung dịch CTAB: dùng để kết tủa polysaccharide và tạp chất khác. 10 g CTAB. 100 ml NaCl 0,5 M. 3.3.2. Các hoá chất dùng trong điện di Gel agarose, thƣờng sử dụng gel có nồng độ 1% agarose. Đệm TAE 0,5X dùng để pha gel agarose và làm dung dịch đệm trong chạy điện di với thành phần nhƣ sau: Tris HCl 4,48 g Na2EDTA 0,5M (pH8,0) 2ml Glacial acetic acid 1,14 ml Nƣớc cất vừa đủ 1 lít Dung dịch nhuộm gel là Ethidium bromide 1%. Ladder 1 kp. Ladder 1,5 kb. DNA loading buffer. 3.3.3. Hoá chất cho phản ứng PCR (do công ty Bio - Rad cung cấp) Taq DNA polymerase nồng độ 5UI/µl. Dung dịch đệm 10X: đi kèm với Taq. dNTPs 10 mM. MgCl2 50 mM. Primer: đƣợc tổng hợp bởi công ty IDT (Mỹ). Xan 1330 5’ – GTT CCC GGG CCT TGT ACA CAC – 3’ Xan 322 5’ – GGT TCT TTT CAC CTT TCC CTC – 3’ (nguồn: Young Jin Park và ctv, 2004) XCF 5’ – CGATTCGGCCATGAATGACT – 3’ XCR 5’ – CTGTTGATGGTGGTCTGCAA – 3’ 17 (nguồn: Goncalves, E.R và Rosato, Y.B, 2002) 3.3.4. Môi trƣờng Môi trƣờng PDA. Môi trƣờng YGC. Môi trƣờng lỏng LB. ( thành phần và cách chuẩn bị môi trƣờng: xem phụ lục) 3.4. Dụng cụ, thiết bị Các dụng cụ và thiết bị cần thiết cho một phòng thí nghiệm sinh học phân tử. Kính lúp. Kính hiển vi và kính hiển vi soi nổi. Que cấy, đèn cồn. Tủ mát. Tủ lạnh -20oC. Máy đo pH. Tủ cấy vô trùng. Tủ ủ nhiệt. Máy lắc. Máy ly tâm lạnh. Máy khuấy từ. Bộ điện di. Máy PCR. Máy vortex. Máy chụp hình gel (Bio –Rad). Máy đọc trình tự ABI PRISM 3100. 3.5. Phƣơng pháp 3.5.1. Phƣơng pháp thu thập mẫu bệnh Mẫu bệnh đƣợc thu thập tại các vùng trồng rau ở Củ Chi, Hóc Môn và quận 12. Quan sát trên các ruộng rau cải ngọt, khi phát hiện các lá có triệu chứng bệnh (xuất hiện các đốm nhỏ có kích thƣớc 1 – 2 mm màu nâu đen, phân biệt với vết đốm tròn do bọ nhảy gây nên), tiến hành lấy mẫu lá, rửa kỹ bằng nƣớc sạch, bọc trong giấy thấm, cho vào bao ni lông. Mỗi ruộng lấy từ 3 – 4 lá. Mẫu lá lấy từ các ruộng khác nhau đƣợc kí hiệu riêng và đƣợc coi là một dòng bệnh. Mẫu sau khi thu thập đƣợc ủ ẩm tạo ẩm độ thích hợp cho vi sinh vật phát triển trƣớc khi đem phân lập. 3.5.2. Phƣơng pháp phân lập vi sinh vật từ mẫu bệnh Mẫu lá đƣợc rửa sạch đất cát bằng nƣớc vòi, thấm khô bằng giấy lọc. Các vết bệnh mới xuất hiện, còn nhỏ đƣợc chọn để phân lập. Mỗi mẫu bệnh cắt 1 đốm mới xuất hiện 18 triệu chứng (kích thƣớc nhỏ, vết bệnh có màu xanh giọt dầu). Khử trùng bề mặt bằng NaCLO 0,3% và cồn 70% để loại bỏ các sinh vật biểu sinh, sau đó dùng dao mổ cắt nhỏ vết bệnh ngâm vào nƣớc cất vô trùng. Để 5 – 10 phút sau cho vi khuẩn đi từ mô lá vào trong nƣớc cất. * Cấy vi khuẩn: Hút 1 ml dịch khuẩn ở trên nhỏ vào đĩa petri, cấy trang trên môi trƣờng bằng trang cấy thủy tinh chữ L. Mỗi đốm bệnh đƣợc cấy 3 lần lặp lại (9 đĩa). Đem các đĩa đã cấy đặt vào tủ định ôn ở 28oC trong 24 – 48 giờ. Sau thời gian nuôi cấy, lấy ra quan sát và chọn các khuẩn lạc. Phân loại khuẩn lạc bằng hình dạng, màu sắc và kiểu mọc. Chọn các khuẩn lạc màu vàng, lồi, bóng, nhầy mọc riêng rẽ để cấy ria lên môi trƣờng YGC 3.5.3. Phƣơng pháp chủng bệnh trên rau cải trồng trong nhà lƣới 3.5.3.1. Phƣơng pháp trồng cây kí chủ Để chủng bệnh, phải trồng cải ngọt sạch bệnh trong nhà lƣới. Giống cải ngọt để trồng đƣợc mua từ các công ty giống cây trồng bao gồm 3 giống: Số 4, Hai mũi tên đỏ và H&V. Giá thể trồng: vật liệu làm giá thể trồng bao gồm xơ dừa, rơm rạ hoai mục, tro trấu. Các thành phần trộn theo tỷ lệ 1:1:1, hỗn hợp này sau đó trộn với đất trồng theo tỷ lệ 1:1 tạo giá thể hoàn chỉnh. Toàn bộ giá thể đƣợc hấp khử trùng ở nhiệt độ 121oC. Xử lý hạt giống: trƣớc khi gieo, ngâm hạt trong nƣớc ấm 50oC sau đó đem gieo vào khay gieo sạch. Khay gieo có kích thƣớc 50 cm x 30 cm, chứa khoảng 200 lỗ. Cây con sau khi mọc 10 ngày đem trồng ra khay xốp với kích thƣớc lỗ lớn. Khi cây cải 20 ngày tuổi có khoảng 3 – 4 lá thật thì tiến hành chủng bệnh. 3.5.3.2. Chủng bệnh Để xác định dòng vi khuẩn gây bệnh, chủng bệnh tiến hành theo phƣơng pháp châm kim tạo vết thƣơng trên bề mặt lá. Trên mỗi lá châm thành hàng ở phần thịt lá dọc hai bên gân chính, mỗi bên châm khoảng 5 – 7 vết. Một bên sẽ đƣợc chủng vi khuẩn, bên kia không chủng để làm đối chứng so sánh. Các dòng vi khuẩn chọn chủng đƣợc cấy trên môi trƣờng PDA để thu sinh khối. Dùng tăm bông khử trùng lấy sinh khối vi khuẩn từ khuẩn lạc trên đĩa chấm vào vết thƣơng để lây nhiễm vi khuẩn vào mô lá. 19 Khay cải sau chủng đƣợc ủ ẩm bằng cách bọc trong túi ni lông có miệng để tạo độ ẩm thích hợp cho sự phát triển của vi khuẩn và tránh sự lẫn tạp các dòng với nhau. Sau 3 – 4 ngày, quan sát triệu chứng và ghi nhận kết quả. Lá nhiễm bệnh khi xung quanh vết châm có sự hoại tử mô tế bào (khác biệt với vết châm đối chứng ở đối diện gân lá). Để quan sát triệu chứng, hình thái và phản ứng của tế bào lá sau khi chủng. Chúng tôi tiến hành nhuộm lá bằng dung dịch Alcohollic lactophenol (thành phần và cách pha dung dịch: xem phần phụ lục). Phƣơng pháp nhuộm lá đƣợc mô tả nhƣ sau: - Cho lá cải cần nhuộm vào ống nghiệm, mỗi ống 2 lá. - Rót dung dịch Alcohollic lactophenol vào ống nghiệm đến khi ngập lá. - Đƣa ống nghiệm vào nồi nƣớc đang sôi, đến khi thấy bọt khí nổi lên thì lấy ra. - Để ống nghiệm ở nhiệt độ phòng cho đến khi bọt khí ngừng nổi. - Đổ bỏ dung dịch và rửa lá bằng nƣớc cất. - Mẫu lá sau đó đƣợc để khô tự nhiên. - Lƣu mẫu ở 4oC. Mẫu lá xác định có nhiễm bệnh đƣợc đem phân lập vi khuẩn gây bệnh. Các bƣớc phận lập đƣợc tiến hành nhƣ phƣơng pháp đƣợc trình bày ở mục 3.5.2. 3.5.4. Phƣơng pháp ly trích DNA từ vi khuẩn Vi khuẩn đƣợc nhân sinh khối trong môi trƣờng LB lỏng. Sau 48 giờ nuôi cấy, thu sinh khối và tiến hành ly trích. Ly trích DNA theo phƣơng pháp sử dụng CTAB: 1. Thu sinh khối vi khuẩn bằng cách ly tâm 10 000 vòng/ 5 phút/ 4oC. Rửa sinh khối vi khuẩn đƣợc với 1 ml nƣớc cất 2 lần vô trùng, đánh tan bằng vortex (rửa 2 – 3 lần). Ly tâm 10 000 vòng/ 5 phút/ 4oC. 2. Hòa tan sinh khối vi khuẩn thu đƣợc trong 567 µl dung dịch TE, đánh tan bằng vortex, thêm 30 µl dung dịch SDS 10%, trộn đều bằng vortex. Sau đó ủ ở 37oC khoảng 1 – 2 h. 3. Cho thêm vào 100 µl dung dịch NaCl 5M, hòa tan thật kỹ bằng vortex. 4. Thêm 80 µl dung dịch CTAB/NaCl (1/10 thể tích), pha trộn (đánh tan bằng vortex), ủ 65oC trong 10 phút. 20 5. Chiết xuất dung dịch DNA với 500 µl dung dịch phenol / chloroform / isoamyl alcohol (25:24:1). Trộn đều bằng cách lắc tay, ly tâm 14 000 vòng/ 10 phút/ 4oC. 6. Thu hết dung dịch bên trên cho vào ống ly tâm mới . 7. Thêm 780 µl dung dịch hỗn hợp chloroform / isoamyl alcohol (24:1).Hòa lẫn đều bằng lắc tay, ly tâm 12 000 vòng/10 phút/4 oC. 8. Thu lấy dịch bên trên cho vào

Các file đính kèm theo tài liệu này:

  • pdfTRAN VAN KY - 02131053.pdf
Tài liệu liên quan