Luận án Nghiên cứu biểu hiện microrna - 21, microrna - 122 huyết tương ở bệnh nhân ung thư biểu mô tế bào gan nhiễm vi rút viêm gan B

TRANG PHỤ BÌA

LỜI CAM ĐOAN

LỜI CẢM ƠN

MỤC LỤC

DANH MỤC CHỮ VIẾT TẮT

DANH MỤC BẢNG

DANH MỤC BIỂU ĐỒ

DANH MỤC HÌNH

ĐẶT VẤN ĐỀ. 1

CHƯƠNG 1. TỔNG QUAN. 3

1.1. MỘT SỐ ĐIỂM VỀ DỊCH TỄ UNG THƯ BIỂU MÔ TẾ BÀO GAN. 3

1.1.1. Trên thế giới .3

1.1.2. Tình hình dịch tễ ung thư biểu mô tế bào gan ở Việt Nam.4

1.2. CÁC YẾU TỐ NGUY CƠ CỦA UNG THƯ BIỂU MÔ TẾ BÀO GAN . 5

1.2.1. Vi rút viêm gan B.6

1.2.2. Các yếu tố nguy cơ khác .8

1.3. CƠ CHẾ BỆNH SINH VÀ VAI TRÒ CỦA VI RÚT VIÊM GAN B

TRONG UNG THƯ BIỂU MÔ TẾ BÀO GAN. 9

1.3.1. Cơ chế bệnh sinh.9

1.3.2. Vai trò của vi rút viêm gan B trong ung thư biểu mô tế bào gan.10

1.4. CÁC PHƯƠNG PHÁP CHẨN ĐOÁN UNG THƯ BIỂU MÔ TẾ

BÀO GAN . 14

1.4.1. Các phương pháp chẩn đoán hình ảnh .14

1.4.2. Phương pháp chẩn đoán tế bào học và mô bệnh học .16

1.4.3. Một số dấu ấn sinh học trong chẩn đoán ung thư biểu mô tế bào gan .18

pdf172 trang | Chia sẻ: honganh20 | Ngày: 10/03/2022 | Lượt xem: 90 | Lượt tải: 0download
Bạn đang xem trước 20 trang tài liệu Luận án Nghiên cứu biểu hiện microrna - 21, microrna - 122 huyết tương ở bệnh nhân ung thư biểu mô tế bào gan nhiễm vi rút viêm gan B, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
ccgctagcttatcag actgatg MiR-122 gttggctctggtgcagggtccgaggta ttcgcaccagagccaac caaaca ggtgtggagtgtgacaa tgg Universal reverse primer: gtgcagggtccgaggt - Nội chuẩn sử dụng trong nghiên cứu Để giảm thiểu sự biến thiên về lượng của miRNA giữa các mẫu nghiên cứu, mức độ biểu hiện của miRNA đích cần được chuẩn hóa “normalised” với một miRNA nội chuẩn. Các nghiên cứu đã chứng minh miR-16 là ổn định và tối ưu nhất cho một miRNA nội chuẩn [11], [87], [88]. Chính vì vậy trong nghiên cứu này chúng tôi lựa chọn miR-16 là miRNA nội chuẩn. 49 - Quy trình thực hiện phản ứng Các cDNA đặc hiệu cho từng miRNA trong các mẫu thu được từ bước 2 được định lượng bằng kỹ thuật Realtime PCR trên hệ thống Realtime PCR 7500 hãng Applied Biosystems của Mỹ. Áp dụng nguyên lý Hydrolysis Probe (TaqMan Probe) để phát hiện sản phẩm cDNA đặc hiệu cho từng miRNA. - Nguyên lý Hydrolysis Probe Phản ứng Realtime sử dụng TaqMan Probe được thiết kế gồm: Một bộ mồi đặc hiệu và một chuỗi mẫu dò oligonucleotide (Probe) có trình tự bổ sung với đoạn trình tự khuôn nằm giữa hai mồi. Mẫu dò oligonucleotide được thiết kế với đầu 5’ gắn chất phát tín hiệu huỳnh quang (Reporter) đầu 3’ gắn chất hấp phụ tương ứng để hấp phụ được ánh sáng huỳnh quang được phát ra từ reporter gọi chung là Quencher. Mẫu dò này ở trạng thái nguyên vẹn (không bị phân hủy), ở trạng thái bình thường (không bị kích hoạt) thì toàn bộ năng lượng phát ra từ Reporter được chuyển sang Quencher khiến cho Reporter không phát được tín hiệu huỳnh quang sang mà chỉ có Quencher phát được, trong khi đó máy chủ không nhận được tín hiệu vì hệ thống kính lọc không phù hợp với bước sóng phát ra từ Quencher. Khi phản ứng PCR diễn ra, mẫu dò sẽ bắt cặp bổ sung vào DNA khuôn sau đó bị phân cắt bởi hoạt tính 5’ - 3’ exonucleaza của TaqDNA polymerase trong quá trình tổng hợp chuỗi. Chính nhờ sự phân cắt này làm cho Reporter được giải phóng khỏi Quencher để phát tín hiệu huỳnh quang, đồng thời loại bỏ mẫu dò khỏi khuôn DNA sau mỗi chu kỳ của phản ứng PCR có nghĩa là tín hiệu huỳnh quang thu được sẽ tỷ lệ với sự nhân lên của sản phẩm PCR. Dựa vào nguyên lý trên một cặp mồi trong vùng bảo tồn của đích và mẫu dò oligonucleotide có đầu 5’ (Reporter) mang hợp chất phát mầu FAM và đầu 3’ (Quencher) mang hợp chất TAMRA đã được thiết kế để định lượng nồng độ cDNA đặc hiệu cho miR-21, miR-122 và miR-16 nội chuẩn. Phương pháp này 50 cho phép định lượng chính xác cDNA đặc hiệu cho miR-21, miR-122 và miR- 16 nội chuẩn trong mẫu. Bảng 2.3. Thành phần phản ứng Realtime PCR Thành phần phản ứng Thể tích 1 phản ứng (µl) Mastermix Realtime PCR (Qiagen) 5 Mồi đặc hiệu cho miR-16 nội chuẩn, miR-21, miR-122 1 cDNA tổng hợp được từ bước 2 5 Chu trình nhiệt của phản ứng Realtime PCR - 500C trong 2 phút. - 950C trong 10 phút. - (950C trong 15 giây + 580C trong 1 phút) x 45 lần. * Công thức tính miR-21, miR-122 Đo lường mức độ biểu hiện tương đối của miR-21, miR-122 trong huyết tương so với nội chuẩn được tính theo công thức của Livak K.J. và cộng sự (2001) [89]. miRNA = 2-∆Ct Trong đó: ∆Ct = Ct (miRNA đích) – Ct (miRNA nội chuẩn). 2.2.5. Các chỉ tiêu nghiên cứu 2.2.5.1. Đặc điểm lâm sàng của đối tượng nghiên cứu - Tuổi, giới của các đối tượng nghiên cứu. - Triệu chứng cơ năng nhóm bệnh nhân UTTBG: mệt mỏi, chán ăn, đau tức bụng hạ sườn phải, gầy sút cân. 51 - Triệu chứng toàn thân và thực thể nhóm bệnh nhân UTTBG: Sốt, vàng da và niêm mạc, phù, xuất huyết dưới da, sao mạch, bàn tay son, tuần hoàn bàng hệ cửa chủ, cổ trướng, gan to, lách to. 2.2.5.2. Đặc điểm xét nghiệm của đối tượng nghiên cứu * Xét nghiệm sinh hóa - Hoạt độ enzym AST: giá trị bình thường < 40 (U/L). - Hoạt độ enzym ALT: giá trị bình thường < 40 (U/L). - Bilirubin toàn phần: giá trị bình thường ≤ 17 µmol/L. - Bilirubin trực tiếp: giá trị bình thường ≤ 5 µmol/L. - Protein toàn phần: giá trị bình thường 60-80g/L. - Albumin: giá trị bình thường 35-48g/L. * Xét nghiệm huyết học - Số lượng hồng cầu: giá trị bình thường (nam: 4,5 - 6,5T/L; nữ: 3,8 - 5,8T/L). - Số lượng bạch cầu: giá trị bình thường 4 - 10 G/L. - Số lượng tiểu cầu: giá trị bình thường 150 - 400 G/L. - Tỉ lệ Prothrombin: giá trị bình thường > 70%. * Xét nghiệm miễn dịch và sinh học phân tử - Nồng độ AFP huyết thanh: chúng tôi áp dụng theo cách phân loại của Dominique Franco (1984) [33]. + AFP bình thường ≤ 20ng/ml + AFP tăng khi > 20ng/ml. - Tải lượng HBV - DNA (bản sao/ml), ngưỡng phát hiện 100 bản sao/ml. 52 2.2.5.3. Đặc điểm khối u gan trên siêu âm và chụp cắt lớp vi tính - Số lượng khối u được chia theo phân loại BCLC [14]: 1 khối; 2-3 khối; > 3 khối. - Kích thước khối u được chia thành 2 nhóm theo tiêu chí Milan [90]: Khối u ≤ 5cm và khối u > 5cm. - Tình trạng huyết khối TMC: có huyết khối hoặc không có huyết khối được xác định bằng chụp CLVT. 2.2.5.4. Đặc điểm mô bệnh học * Mức độ biệt hóa tế bào của bệnh nhân ung thư biểu mô tế bào gan - Biệt hóa cao - Biệt hóa vừa - Biệt hóa thấp (kém biệt hóa) - Không xác định độ biệt hóa: bao gồm các trường hợp UTTBG loại tế bào sáng và các trường hợp chọc hút tế bào. * Mức độ viêm trên mô bệnh học ở nhóm viêm gan B mạn Mức độ viêm của nhóm bệnh nhân viêm gan B mạn được chia thành 4 mức độ theo chỉ số hoạt động mô học HAI. Bảng 2.4. Mức độ viêm gan mạn HAI (*) Mức độ 1-3 Viêm gan mạn rất nhẹ 4-8 Viêm gan mạn nhẹ 9-12 Viêm gan mạn vừa 13-18 Viêm gan mạn nặng * HAI: Histologic Activity Index (Chỉ số hoạt động mô học) * Nguồn: dẫn theo Okafor O., Ojo S. (2004) [91] 53 2.2.5.5. Phân loại ung thư biểu mô tế bào gan theo giai đoạn bệnh Phân chia giai đoạn UTTBG theo Hội ung thư gan lâm sàng Barcelona. Bảng 2.5. Phân chia giai đoạn bệnh theo BCLC BCLC Đặc điểm khối u Child-Pugh PS 0 Một khối, kích thước < 2cm A 0 A Một khối ≤ 5cm, hoặc không quá 3 khối, mỗi khối ≤ 3cm A, B 0 B Nhiều khối lớn A, B 0 C Xâm lấn mạch máu hoặc ra ngoài gan A, B 1-2 D Bất kỳ trạng thái nào C 3-4 * PS: Performance Status (chỉ số tổng trạng) * Nguồn: dẫn theo Nguyễn Thị Vân Hồng (2015) [92] Bảng 2.6. Đánh giá chức năng gan theo Child - Pugh Đặc điểm 1 điểm 2 điểm 3 điểm Cổ trướng Không có Ít Vừa, nhiều Hội chứng não gan Không có Tiền hôn mê Hôn mê Tỷ lệ Prothrombin (%) > 54 45- 54 < 45 Albumin huyết thanh (g/l) > 35 28 - 35 < 28 Bilirubin huyết thanh (µmol/l) 50 * Xếp loại Child - Pugh: A: 5 - 6 điểm, B: 7 - 9 điểm, C: 10 - 15 điểm. * Nguồn: dẫn theo Nguyễn Thị Vân Hồng (2015) [92] 54 2.2.5.6. Biểu hiện miR-21, miR-122 huyết tương - Biểu hiện của miR-21 và miR-122 huyết tương tính bằng ∆Ct theo công thức của Livak K.J. và cộng sự [89] (Mục 2.2.4.7). 2.2.6. Phân tích và xử lý số liệu Số liệu được xử lý bằng phương pháp thống kê y học, sử dụng phần mềm SPSS 21.0. - Tính tỉ lệ phần trăm, giá trị trung bình, độ lệch chuẩn, trung vị. - So sánh tìm sự khác biệt giữa các quan sát: + Với các biến định lượng có phân phối chuẩn: so sánh trung bình của 2 nhóm độc lập bằng kiểm định “Independent – samples T test”, độ tin cậy 95%. + Với các biến định lượng có phân phối không chuẩn: so sánh trung vị của hai nhóm độc lập bằng kiểm định “Mann Whitney” với độ tin cậy 95%. + Đánh giá: p > 0,05: sự khác biệt không có ý nghĩa thống kê p < 0,05: sự khác biệt có ý nghĩa thống kê p < 0,001: sự khác biệt rất có ý nghĩa thống kê. - Phân tích mối liên quan giữa các biến định lượng hoặc các biến định danh với một biến phụ thuộc nhị phân: sử dụng hồi quy logistic, tính OR (Odd ratio = OR). - Phân tích tương quan tuyến tính giữa hai biến định lượng, tính hệ số tương quan “r” với các biến có phân phối chuẩn, tính hệ số tương quan Spearman với các biến có phân phối không chuẩn. + Nếu 0 ≤ ǀ r ǀ < 0,3: hai biến không có tương quan tuyến tính. + Nếu 0,3 ≤ ǀ r ǀ ≤ 0,5: hai biến có tương quan tuyến tính không chặt chẽ. + Nếu 0,5 < ǀ r ǀ ≤ 0,75: hai biến có tương quan tuyến tính tương đối chặt chẽ. 55 + Nếu 0,75 < ǀ r ǀ ≤ 1: hai biến có tương quan tuyến tính rất chặt chẽ. + Nếu “r” mang giá trị dương: hai biến có tương quan thuận. + Nếu “r” mang giá trị âm: hai biến có tương quan nghịch. - Xác định giá trị chẩn đoán của các dấu ấn sinh học bằng đường cong ROC, tính diện tích dưới đường cong (AUC), độ nhạy, độ đặc hiệu. Đường cong ROC là đường biểu diễn của các điểm có tọa độ tương ứng với trục tung là độ nhạy, trục hoành là giá trị dương tính giả (1 - độ đặc hiệu) của phương pháp chẩn đoán tính từ thấp đến cao. Diện tích dưới đường cong được dùng để đánh giá độ chính xác của phương pháp chẩn đoán (AUC ≥ 0,7: có độ chính xác khá tốt; AUC ≥ 0,8: có độ chính xác tốt; AUC ≥ 0,9: có độ chính xác rất tốt). Giá trị ngưỡng (cut-off) được chọn tại điểm có chỉ số Youden (J) cao nhất (J = độ nhạy + độ đặc hiệu -1). Từ đó tính ra độ nhạy, độ đặc hiệu, giá trị dự đoán dương và giá trị dự đoán âm. - So sánh giá trị chẩn đoán của hai dấu ấn sinh học bằng cách so sánh diện tích dưới đường cong (AUC) của các dấu ấn sinh học. 2.2.7. Khống chế sai số - Xây dựng quy trình nghiên cứu, mẫu bệnh án nghiên cứu chuẩn mực và chi tiết. - Các cán bộ tham gia nghiên cứu được tập huấn kỹ và thống nhất quy trình nghiên cứu, tuân thủ nghiêm ngặt quy trình từ khi lấy mẫu, bảo quản đến khi phân tích xử lý mẫu nghiên cứu. - Chỉ đưa vào phân tích những trường hợp có đủ tiêu chuẩn nghiên cứu đề ra. 56 2.3. ĐẠO ĐỨC NGHIÊN CỨU - Nghiên cứu thực hiện theo đề cương đã được hội đồng chấm đề cương thông qua và sự cho phép của ban lãnh đạo Bệnh viện TƯQĐ 108. - Tôn trọng bệnh nhân và quyền tự quyết của bệnh nhân. - Đảm bảo giữ bí mật riêng tư cho bệnh nhân và những người khỏe mạnh tham gia nghiên cứu. - Toàn bộ bệnh nhân và người khỏe mạnh tham gia nghiên cứu không phải chi trả bất kì chi phí nào. 57 2.4. SƠ ĐỒ NGHIÊN CỨU SƠ ĐỒ NGHIÊN CỨU 58 CHƯƠNG 3 KẾT QUẢ NGHIÊN CỨU Nghiên cứu được thực hiện tại Bệnh viện Trung ương Quân đội 108 từ tháng 3 năm 2014 đến tháng 3 năm 2017. Bao gồm 101 bệnh nhân ung thư biểu mô tế bào gan, 46 bệnh nhân viêm gan B mạn, 103 người khỏe mạnh đủ tiêu chuẩn được lựa chọn. 3.1. ĐẶC ĐIỂM NHÓM NGHIÊN CỨU 3.1.1. Đặc điểm lâm sàng và xét nghiệm của các đối tượng nghiên cứu Bảng 3.1. Đặc điểm tuổi, giới Đặc điểm Nhóm Nam n (%) Nữ n (%) Tuổi (năm) SDX  Khoảng tuổi UTTBG (n = 101) 94 (93,1) 7 (6,9) 55,6 ± 12,34 23 - 92 VGBM (n = 46) 44 (95,7) 2 (4,3) 41,43 ± 11,54 21 - 63 NKM (n = 103) 79 (76,7) 24 (23,3) 24,0 ± 6,42 19 - 46 - Nhóm UTTBG: tuổi trung bình (55,6 ± 12,34), bệnh nhân ít tuổi nhất 23 tuổi, bệnh nhân lớn nhất là 92 tuổi. Nam chiếm chủ yếu (93,1%), nữ (6,9%), tỷ lệ nam/nữ ~ 13/1. - Nhóm VGBM: tuổi trung bình (41,43 ± 11,54), bệnh nhân ít tuổi nhất 21 tuổi, bệnh nhân lớn nhất là 63 tuổi. Chủ yếu là nam (95,7%). - Nhóm NKM: tuổi trung bình (24,0 ± 6,42), người nhỏ tuổi nhất 19 tuổi, người lớn tuổi nhất là 46 tuổi. Trong đó nam (76,7%), nữ (23,3%). 59 Biểu đồ 3.1. Phân bố tuổi của nhóm bệnh nhân ung thư biểu mô tế bào gan Nhóm tuổi chiếm tỷ lệ cao nhất 50-59 tuổi (35,6%), sau đó là 60-69 tuổi (23,8%), độ tuổi < 30 chỉ có 2,0%. Biểu đồ 3.2. Một số triệu chứng cơ năng của bệnh nhân ung thư biểu mô tế bào gan Các triệu chứng cơ năng thường gặp là mệt mỏi (63,4%), chán ăn (61,4%), đau tức hạ sườn phải (61,4%), sút cân (47,5%). 0 5 10 15 20 25 30 35 40 < 30 30-39 40-49 50-59 60-69 ≥70 2,0% 8,9% 17,8% 35,6% 23,8% 11,9% 0 10 20 30 40 50 60 70 Mệt mỏi Chán ăn Đau, tức HSP Sút cân 63,4% 61,4% 61,4% 47,5% 60 Bảng 3.2. Một số triệu chứng thực thể của bệnh nhân ung thư biểu mô tế bào gan Triệu chứng n Tỉ lệ % Sao mạch 15 14,85 Bàn tay son 12 11,88 Vàng da, củng mạc 11 10,89 Xuất huyết dưới da 2 1,98 Sốt 2 1,98 Phù 2 1,98 Gan to 22 21,78 Lách to 7 6,93 Tuần hoàn bàng hệ cửa chủ 4 3,96 Cổ trướng 0 0,00 - Các triệu chứng toàn thân hay gặp như sao mạch (14,85%), bàn tay son (11,88%), vàng da và củng mạc (10,89%), các triệu chứng ít gặp hơn như sốt, phù, xuất huyết dưới da có tỷ lệ ngang nhau (1,98%). - Triệu chứng thực thể hay gặp nhất là gan to (21,78%), các triệu chứng ít gặp hơn như lách to (6,93%), tuần hoàn bàng hệ cửa chủ (3,96%). Không bệnh nhân nào có cổ trướng được phát hiện trên lâm sàng. 61 Bảng 3.3. Xét nghiệm huyết học nhóm ung thư biểu mô tế bào gan và viêm gan B mạn Nhóm Chỉ số UTTBG (n = 101) SDX  (Trung vị) VGBM (n = 46) SDX  (Trung vị) Bạch cầu (G/l) 7,37 ± 2,32 (7,09) 6,63 ± 2,12 (6,2) Hồng cầu (T/l) 4,72 ± 0,67 (4,59) 4,83 ± 0,48 (4,8) Tiểu cầu (G/l) 195,19 ± 82,45 (187,0) 174,22 ± 51,96 (172,0) Prothrombin (%) 93,88 ± 15,08 (95,0) 87,95 ± 18,67 (83,0) Giá trị trung bình các chỉ số xét nghiệm huyết học của cả hai nhóm UTTBG và VGBM đều ở trong giới hạn bình thường. Bảng 3.4. Xét nghiệm sinh hóa, miễn dịch ở nhóm ung thư biểu mô tế bào gan và viêm gan B mạn Nhóm Chỉ số UTTBG (n=101) SDX  (Trung vị) VGBM (n = 46) SDX  (Trung vị) p AST (U/L) 97,67 ± 83,51 (68,0) 260,00 ± 325,00 (148,0) < 0,05 ALT (U/L) 63,55 ± 57,18 (45,0) 314,65 ± 463,74 (166,5) < 0,05 Bli TP (µmol/l) 18,67 ± 13,85 (14,5) 24,72 ± 23,86 (15,85) < 0,05 Protein TP (g/l) 77,11 ± 6,59 (77,0) 73,68 ± 6,15 (73,0) > 0,05 Albumin (g/l) 38,88 ± 5,08 (39,5) 39,67 ± 4,49 (40,0) > 0,05 AFP (ng/ml) 339,29 ± 574,02 (40,29) 43,81 ± 142,97 (2,63) < 0,05 HBV-DNA (log) 5,01 ± 1,52 (4,91) 6,63 ± 1,97 (6,99) < 0,05 Hoạt độ enzym gan AST, ALT, nồng độ bilirubin toàn phần và tải lượng HBV ở nhóm UTTBG thấp hơn ở nhóm VGBM (p < 0,05). Nồng độ AFP huyết thanh ở nhóm UTTBG cao hơn nhóm VGBM (p < 0,05). 62 Biểu đồ 3.3. AFP huyết thanh của nhóm ung thư biểu mô tế bào gan Bệnh nhân UTTBG có AFP huyết thanh ≤ 20ng/ml (35,6%), những BN UTTBG có AFP trên 20 ng/ml chiếm (64,4 %). Bảng 3.5. Liên quan giữa AFP huyết thanh với đặc điểm khối u gan và giai đoạn bệnh theo phân loại BCLC Chỉ số AFP (ng/ml) OR p (95% CI) Số lượng khối u 1,331 0,603 0,454 - 3,899 Kích thước khối u 4,364 0,063 0,924 - 20,597 Huyết khối TMC 2,455 0,115 0,805 - 7,486 Độ biệt hóa tế bào 0,167 0,005 0,048 - 0.583 BCLC 3,413 0,007 1,396 - 8,345 Chưa thấy mối liên quan giữa nồng độ AFP với số lượng, kích thước khối u, tình trạng huyết khối TMC. Có liên quan giữa AFP huyết thanh với độ biệt hóa tế bào và mức độ bệnh theo BCLC (p < 0,05). 35,6 % 64,4 % AFP ≤ 20ng/ml AFP > 20ng/ml 63 Bảng 3.6. Phân loại mức độ viêm ở nhóm viêm gan B mạn theo điểm Knodell HAI Mức độ HAI n % Viêm gan mạn rất nhẹ 1-3 14 30,44 Viêm gan mạn nhẹ 4-8 23 50,00 Viêm gan mạn vừa 9-12 6 13,04 Viêm gan mạn nặng 13-18 3 6,52 Tổng 46 100 - Nhóm bệnh nhân viêm gan B mạn đa phần ở mức độ viêm nhẹ (50%), rất nhẹ (30,44%). - Viêm gan mạn mức độ nặng có 3 bệnh nhân chiếm 6,52%. Bảng 3.7. Phân loại Child - Pugh ở nhóm bệnh nhân ung thư biểu mô tế bào gan Phân loại Child – Pugh n % A 93 92,07 B 8 7,93 C 0 0,00 Tổng 101 100 - Phần lớn các BN UTTBG có phân loại Child-Pugh A (92,07%). - Child-Pugh B (7,93%). - Không có bệnh nhân Child-Pugh C. 64 3.1.2. Đặc điểm khối u gan Bảng 3.8. Số lượng khối u gan Số lượng khối u n % 1 65 64,36 2 - 3 14 13,86 > 3 22 21,78 Tổng 101 100 Đa phần bệnh nhân UTTBG có một khối u (64,36%), 2-3 khối (13,86%), trên 3 khối (21,78%). Bảng 3.9. Kích thước khối u gan Kích thước khối u (cm) n % ≤ 5 29 28,71 > 5 72 71,29 Đường kính lớn khối u SDX  7,78 ± 3,41 - Kích thước trung bình khối u (7,78 ± 3,41)cm. - Bệnh nhân có khối u gan kích thước dưới 5cm (28,71%). - Bệnh nhân có khối u gan trên 5cm (71,29%). 65 Bảng 3.10. Huyết khối tĩnh mạch cửa Huyết khối TMC n % Có 23 22,77 Không 78 77,23 Tổng 101 100 - Bệnh nhân UTTBG có huyết khối tĩnh mạch cửa (22,77%). - Bệnh nhân UTTBG không có huyết khối tĩnh mạch cửa (77,23%). Bảng 3.11. Độ biệt hóa tế bào khối u gan Độ biệt hóa tế bào n % Cao 25 24,75 Vừa 46 45,55 Thấp 10 9,90 Không xác định 20 19,80 Tổng 101 100 - Bệnh nhân UTTBG có độ biệt hóa tế bào ở mức độ vừa chiếm đa số (45,55%). - Biệt hóa cao (24,75%) - Biệt hóa thấp (9,90%) - Không xác định độ biệt hóa (19,80%), đây là những trường hợp UTTBG được chẩn đoán bằng chọc hút tế bào bằng kim nhỏ. 66 Bảng 3.12. Phân loại giai đoạn bệnh ung thư biểu mô tế bào gan theo BCLC Phân loại BCLC n % A 16 15,84 B 50 49,51 C 35 34,65 D 0 0,00 Tổng 101 100 - Giai đoạn sớm (15,84%) - Giai đoạn trung gian (49,51%) - Giai đoạn tiến triển (34,65%) 67 3.2. BIỂU HIỆN MIR-21, MIR-122 Ở CÁC ĐỐI TƯỢNG NGHIÊN CỨU 3.2.1. Biểu hiện miR-21, miR-122 ở bệnh nhân ung thư biểu mô tế bào gan, viêm gan B mạn và người khỏe mạnh Bảng 3.13. Biểu hiện miR-21 huyết tương bệnh nhân ung thư biểu mô tế bào gan, viêm gan B mạn và người khỏe mạnh miR-21 (2-ΔCt) Trung vị SDX  Khoảng giá trị UTTBG (n=101) 10,78 194,05 ± 564,16 0,10 – 3743,05 VGBM (n=46) 2,02 3,79 ± 7,46 0,12 – 50,91 NKM (n=103) 0,73 0,83 ± 0,55 0,10 – 2,42 Giá trị miR-21 huyết tương dao động trong khoảng lớn ở các nhóm nghiên cứu. MiR-21 nhóm UTTBG có biểu hiện lớn hơn nhóm VGBM và NKM. Bảng 3.14. Biểu hiện miR-122 huyết tương bệnh nhân ung thư biểu mô tế bào gan, viêm gan B mạn và người khỏe mạnh miR-122 (2-ΔCt) Trung vị SDX  Khoảng giá trị UTTBG (n=101) 436,54 3158,58 ± 7707,36 0,14 – 47975,16 VGBM (n=46) 3,61 31,63 ± 84,27 0,002 – 508,46 NKM (n=103) 0,10 1,07 ± 2,09 0,00002 – 13,17 Giá trị miR-122 huyết tương dao động trong khoảng lớn ở các nhóm nghiên cứu. MiR-122 nhóm UTTBG có biểu hiện lớn hơn nhóm VGBM và NKM. 68 Hình 3.1. Kết quả Realtime PCR bệnh nhân ung thư biểu mô tế bào gan (miR-21; miR-122; miR-16 nội chuẩn của bệnh nhân: Lê Tiến S., 58 tuổi. Số hồ sơ: 14434234) Hình 3.2. Kết quả Realtime PCR bệnh nhân ung thư biểu mô tế bào gan (miR-21; miR-122; miR-16 nội chuẩn của bệnh nhân: Phạm Văn Kh., 36 tuổi. Số hồ sơ: 15000313) 69 Hình 3.3. Kết quả Realtime PCR bệnh nhân viêm gan B mạn (miR-21; miR-122; miR-16 nội chuẩn của bệnh nhân: Nguyễn Văn H., 53 tuổi. Số hồ sơ: 14355036) Hình 3.4. Kết quả Realtime PCR của người khỏe mạnh (miR-21; miR-122; miR-16 nội chuẩn của người khỏe mạnh hiến máu tình nguyện: Phạm Hùng M., 30 tuổi. Mã số: 8161) 70 Biểu đồ 3.4.a. Biểu hiện miR-21 ở bệnh nhân ung thư biểu mô tế bào gan và viêm gan B mạn Biểu đồ 3.4.b. Biểu hiện miR-122 ở bệnh nhân ung thư biểu mô tế bào gan và viêm gan B mạn Biểu hiện miR-21, miR-122 tăng cao trong huyết tương ở bệnh nhân UTTBG so với bệnh nhân VGBM (p < 0,001). 71 Bảng 3.15. Độ nhạy, độ đặc hiệu của miR-21, miR-122 trong chẩn đoán ung thư biểu mô tế bào gan và viêm gan B mạn UTTBG (n = 101) VGBM (n = 46) AUC Điểm cắt Độ nhạy (%) Độ đặc hiệu (%) miR-21 (2-∆Ct) 0,763 3,62 68,3 78,3 miR-122 (2-∆Ct) 0,907 55,33 79,2 89,1 Trong chẩn đoán giữa nhóm bệnh nhân UTTBG và VGBM - Tại điểm cắt (3,62) miR-21 có độ nhạy (68,3%) độ đặc hiệu (78,3%). - Tại điểm cắt (55,33) miR-122 có độ nhạy (79,2%), độ đặc hiệu (89,1%). - Diện tích dưới đường cong, độ nhạy, độ đặc hiệu của miR-122 đều cao hơn diện tích dưới đường cong, độ nhạy, độ đặc hiệu của miR-21 trong chẩn đoán giữa nhóm UTTBG với VGBM. Biểu đồ 3.5. Đường cong ROC của miR-21, miR-122 ở nhóm bệnh nhân ung thư biểu mô tế bào gan và viêm gan B mạn 72 Bảng 3.16. Diện tích dưới đường cong khi phối hợp miR-21, miR-122 trong chẩn đoán ung thư biểu mô tế bào gan và viêm gan B mạn UTTBG (n = 101) VGBM (n = 46) Diện tích dưới đường cong (AUC) p miR-21 (1) 0,763 p1,3 < 0,05 p2,3 > 0,05 miR-122 (2) 0,907 miR-21 + miR-122 (3) 0,903 Diện tích dưới đường cong khi phối hợp miR-21 với miR-122 lớn hơn diện tích dưới đường cong của miR-21 (p<0,05), nhưng không khác biệt so với diện tích dưới đường cong của miR-122 (p > 0,05). * Logit (miR-21+miR-122) = - 0,581 + 0,007(miR-21) + 0,01(miR-122) Biểu đồ 3.6. Đường cong ROC khi phối hợp miR-21, miR-122 ở nhóm bệnh nhân ung thư biểu mô tế bào gan và viêm gan B mạn 73 Bảng 3.17. So sánh diện tích dưới đường cong của AFP, miR-21, miR-122 trong chẩn đoán ung thư biểu mô tế bào gan và viêm gan B mạn UTTBG (n = 86) VGBM (n = 45) Diện tích dưới đường cong (AUC) p AFP (1) 0,758 p1,2 > 0,05 p2,3 < 0,05 p1,3 < 0,05 miR-21 (2) 0,782 miR-122 (3) 0,910 Diện tích dưới đường cong của miR-21 lớn hơn diện tích dưới đường cong của AFP nhưng chưa có ý nghĩa thống kê (p > 0,05). Diện tích dưới đường cong của miR-122 lớn hơn diện tích dưới đường cong của AFP và miR-21 có ý nghĩa với (p < 0,05). Biểu đồ 3.7. Đường cong ROC của AFP, miR-21, miR-122 ở nhóm bệnh nhân ung thư biểu mô tế bào gan và viêm gan B mạn 74 Bảng 3.18. Diện tích dưới đường cong khi phối hợp miR-21 với AFP trong chẩn đoán ung thư biểu mô tế bào gan và viêm gan B mạn UTTBG (n = 86) VGBM (n = 45) Diện tích dưới đường cong (AUC) p AFP (1) 0,758 p1,3 < 0,05 p2,3 < 0,05 miR-21 (2) 0,782 miR-21 + AFP (3) 0,868 Khi phối hợp miR-21 với AFP cho diện tích dưới đường cong tăng lên có ý nghĩa so với miR-21 và AFP đơn độc (p < 0,05). * Logit (miR-21+AFP) = - 0,782 + 0,108(miR-21) + 0,003(AFP) Biểu đồ 3.8. Đường cong ROC khi phối hợp miR-21 với AFP ở nhóm bệnh nhân ung thư biểu mô tế bào gan và viêm gan B mạn 75 Bảng 3.19. Diện tích dưới đường cong khi phối hợp miR-122 với AFP trong chẩn đoán ung thư biểu mô tế bào gan và viêm gan B mạn UTTBG (n = 86) VGBM (n = 45) Diện tích dưới đường cong (AUC) p AFP (1) 0,758 p1,3 < 0,05 p2,3 > 0,05 miR-122 (2) 0,910 miR-122 + AFP (3) 0,914 Khi phối hợp miR-122 và AFP cho điện tích dưới đường cong tăng cao hơn so với AFP (p < 0,05), nhưng chưa tăng có ý nghĩa thống kê so với miR- 122 (p > 0,05). * Logit (miR-122+AFP) = -1,248 + 0,01(miR-122) + 0.003(AFP) Biểu đồ 3.9. Đường cong ROC khi phối hợp miR-122 với AFP ở nhóm bệnh nhân ung thư biểu mô tế bào gan và viêm gan B mạn 76 Bảng 3.20. Diện tích dưới đường cong khi phối hợp miR-21, miR-122 với AFP trong chẩn đoán ung thư biểu mô tế bào gan và viêm gan B mạn UTTBG (n = 86) VGBM (n = 45) Diện tích dưới đường cong (AUC) p miR-21 + AFP (1) 0,868 p1,2 < 0,05 p1,3 < 0,05 p2,3 > 0,05 miR-122 + AFP (2) 0,914 miR-21 + miR-122 + AFP (3) 0,934 Diện tích dưới đường cong của miR-21 phối hợp với AFP nhỏ hơn diện tích dưới đường cong của miR-122 phối hợp với AFP (p < 0,05). Khi phối hợp miR-21, miR-122 với AFP cho điện tích dưới đường cong tăng lên so với miR-21 phối hợp với AFP (p < 0,05). * Logit (miR-21+miR-122+AFP) = - 1,396 + 0,043(miR-21) + 0,008(miR-122) + 0,003(AFP) Biểu đồ 3.10. Đường cong ROC khi phối hợp miR-21, miR-122, AFP ở nhóm bệnh nhân ung thư biểu mô tế bào gan và viêm gan B mạn 77 Biểu đồ 3.11.a. Biểu hiện miR-21 ở bệnh nhân ung thư biểu mô tế bào gan và người khỏe mạnh Biểu đồ 3.11.b. Biểu hiện miR-122 ở bệnh nhân ung thư biểu mô tế bào gan và người khỏe mạnh Biểu hiện của miR-21, miR-122 trong huyết tương bệnh nhân UTTBG cao hơn so với người khỏe mạnh (p < 0,001). 78 Bảng 3.21. Độ nhạy, độ đặc hiệu của miR-21, miR-122 trong chẩn đoán ung thư biểu mô tế bào gan và người khỏe mạnh UTTBG (n = 101) NKM (n = 103) AUC Điểm cắt Độ nhạy (%) Độ đặc hiệu (%) miR-21 (2-∆Ct) 0,920 1,74 81,2 94,2 miR-122 (2-∆Ct) 0,989 7,26 94,1 99,0 Trong chẩn đoán giữa nhóm bệnh nhân UTTBG và NKM - Tại điểm cắt (1,74) miR-21 có độ nhạy (81,2%) độ đặc hiệu (94,2%). - Tại điểm cắt (7,26) miR-122 có độ nhạy (94,1%), độ đặc hiệu (99,0%). - Diện tích dưới đường cong, độ nhạy độ đặc hiệu của miR-122 đều cao hơn diện tích dưới đường cong, độ nhạy độ đặc hiệu của miR-21 trong chẩn đoán giữa nhóm UTTBG với nhóm NKM. Biểu đồ 3.12. Đường cong ROC của miR-21, miR-122 ở nhóm bệnh nhân ung thư biểu mô tế bào gan và người khỏe mạnh 79 Bảng 3.22. Diện tích dưới đường cong của miR-21 phối hợp với miR-122 trong chẩn đoán ung thư biểu mô tế bào gan và người khỏe mạnh UTTBG (n = 101) NKM (n = 103) Diện tích dưới đường cong (AUC) p miR-21 (1) 0,920 p1,2 < 0,05 p1,3 < 0,05 p2,3 > 0,05 miR-122 (2) 0,989 miR-21 + miR-122 (3) 0,987 MiR-21, miR-122 có giá trị cao trong chẩn đoán UTTBG và NKM. Khi phối hợp miR-21 với miR-122 cho diện tích dưới đường cong tăng lên so với miR-21 (p < 0,05). Tuy nhiên, khi phối hợp miR-21 với miR-122 diện tích dưới đường cong không tăng lên so với miR-122 (p > 0,05). * Logit (miR-21 + miR-122) = - 0,4557

Các file đính kèm theo tài liệu này:

  • pdfluan_an_nghien_cuu_bieu_hien_microrna_21_microrna_122_huyet.pdf
Tài liệu liên quan