Luận án Nghiên cứu đột biến và đa hình di truyền trên gen mã hóa yếu tố IX ở bệnh nhân Hemophilia B

MỤC LỤC

LỜI CAM ĐOAN . ii

LỜI CẢM ƠN . iii

MỤC LỤC . v

DANH MỤC KÝ HIỆU, CHỮ VIẾT TẮT . viii

DANH MỤC BẢNG . ix

DANH MỤC HÌNH . x

DANH MỤC BẢNG . ix

MỞ ĐẦU . 1

CHƯƠNG 1. TỔNG QUAN TÀI LIỆU . 4

1.1. Tổng quan về bệnh hemophilia B . 4

1.1.1. Một số dấu mốc về lịch sử phát hiện và nghiên cứu bệnh hemophilia B. 4

1.1.2. Khái quát về bệnh hemophilia B . 6

1.2. Cấu trúc và chức năng của yếu tố IX trong quá trình đông máu. 10

1.2.1. Các yếu tố đông máu . 10

1.2.2. Vai trò của yếu tố IX trong quá trình đông máu . 11

1.2.3. Cấu trúc yếu tố IX và quá trình hoạt hóa yếu tố IX . 13

1.2.4. Mối tương tác giữa yếu tố IX với các nhân tố hoạt hóa và đồng yếu tố . 15

1.3. Phân tích di truyền bệnh hemophilia B. 18

1.3.1. Vai trò của phân tích di truyền trong bệnh hemophilia B . 18

1.3.2. Đặc điểm đột biến trên gen F9 . 19

1.3.3. Đặc điểm các đa hình nucleotide liên kết với gen F9. 27

1.4. Các kỹ thuật phân tích di truyền trong bệnh hemophilia B. 30

1.4.1. Kỹ thuật phân tích đột biến . 31

1.4.2. Kỹ thuật phân tích liên kết . 36

1.5. Tình hình nghiên cứu về các biến đổi di truyền trên gen F9. 38

1.5.1. Tình hình nghiên cứu trên thế giới . 38

1.5.2. Tình hình nghiên cứu trong nước . 42

CHƯƠNG 2. ĐỐI TƯỢNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU . 45

2.1. Đối tượng nghiên cứu . 45

2.2. Phương pháp nghiên cứu. 46

2.2.1. Thiết kế nghiên cứu . 46vi

2.2.2. Công thức tính cỡ mẫu trong nghiên cứu đa hình nucleotide . 46

2.2.3. Các bước nghiên cứu . 46

2.3. Hóa chất và thiết bị nghiên cứu. 50

2.3.1. Hóa chất. 50

2.3.2. Vật tư – Trang thiết bị . 51

2.4.1. Thu thập mẫu nghiên cứu. 52

2.4.2. Tách chiết ADN. 52

2.4.3. Thiết kế các trình tự mồi để khuếch đại gen tổng hợp yếu tố IX. 52

2.4.4. Khuếch đại các phân đoạn a1-a8 bằng kỹ thuật Longrange PCR . 53

2.4.5. Tinh sạch sản phẩm Longrange PCR khuếch đại các vùng gen F9 . 54

2.4.7. Khẳng định kết quả giải trình tự gen F9 trên NGS . 55

2.4.8. Khẳng định các mất đoạn/lặp đoạn gen F9 bằng kỹ thuật MLPA . 56

2.4.9. Phân tích đột biến gen từ dữ liệu giải trình tự. 56

2.4.10. Phân tích đa hình nucleotide trên gen F9 từ dữ liệu giải trình tự. 58

 

pdf154 trang | Chia sẻ: thinhloan | Ngày: 13/01/2023 | Lượt xem: 24 | Lượt tải: 1download
Bạn đang xem trước 20 trang tài liệu Luận án Nghiên cứu đột biến và đa hình di truyền trên gen mã hóa yếu tố IX ở bệnh nhân Hemophilia B, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
ủa kỹ thuật MLPA dựa trên phản ứng khuếch đại của một hỗn hợp probe, trong đó mỗi probe phát hiện một trình tự ADN cụ thể. Trong nghiên cứu này, chúng tôi sử dụng bộ kit SALSA MLPA P207 F9 với thiết kế chứa 9 probe MLPA đặc hiệu cho 9 vùng gen bao phủ toàn bộ gen F9. Đầu tiên, mẫu ADN của bệnh nhân sẽ được biến tính để tách thành các sợi đơn, sau đó chúng được lai với hỗn hợp probe. Mỗi probe gồm 2 oligonucleotide sẽ gắn đặc hiệu vào mỗi trình tự đích trên chuỗi ADN. Tiếp đến chúng được nối với nhau để tạo thành một probe riêng biệt thông qua phản ứng nối sử dụng enzyme ligase. Cuối cùng tất cả các cặp probe đã nối được khuếch đại thông qua phản ứng PCR với cùng một trình tự primer PCR giống nhau. Sau phản ứng PCR, một tập hợp các đoạn ADN duy nhất sẽ được tạo ra. Do một primer PCR được gắn huỳnh quang, nên sản phẩm khuếch đại được quan sát khi thực hiện phân tích đoạn trên hệ thống điện di mao quản AB3500. Dữ liệu điện di mao quan sẽ được phân tích trên phần mềm Coffalyser, theo đó chiều cao của mỗi đỉnh probe ở mỗi bệnh nhân được so sánh tương đối với chiều cao của đỉnh probe tương ứng ở mẫu tham chiếu (là người bình thường), từ đó sẽ cho phép phát hiện các biến đổi về số lượng bản sao (mất/thêm đoạn gen) [82]. 2.4.9. Phân tích đột biến gen từ dữ liệu giải trình tự Bước 1: Xử lý dữ liệu Sử dụng các phần mềm tin sinh chuyên dụng cho NGS gồm Miseq Reporter và CLC Genomics Workbench 9.5.2. Miseq Reporter để kiểm tra chất lượng của xét 57 nghiệm giải trình tự và phân tích dữ liệu ở mức cơ bản. CLC Genomics Workbench cho phép loại bỏ những đoạn đọc ngắn, không đảm bảo chất lượng, loại bỏ các adapter dư thừa, các biến đổi nucleotide có độ tin cậy thấp. Bước 2: Phân tích các biến đổi di truyền Sử dụng phần mềm CLC Genomic Workbench ghép nối (alignment) dữ liệu thu được với gen tham chiếu (NG_007994.1 và NM_000133.3) để xác định những biến đổi đơn nucleotide (SNV), các chèn đoạn, mất đoạn ngắn (indels). Các biến đổi nucleotide được chú giải theo danh pháp của Hiệp hội các biến đổi di truyền người (Human Genome Variation Society, HGVS). Đối chiếu với cơ sở dữ liệu quốc tế (cơ sở dữ liệu của EAHAD ( CDC (https://www.cdc.gov/ncbddd/hemophilia), cơ sở dữ liệu SNP quốc tế (https://www.ncbi.nlm.nih.gov/snp) để nhận định các biến đổi nucleotide đã biết và biến đổi mới. Bước 3: Dự đoán chức năng in silico của các biến đổi di truyền mới Thực hiện theo hướng dẫn của UKHCDO [51]. - Các mất đoạn/chèn đoạn gen, các đột biến dẫn đến kết thúc chuỗi: là các biến đổi gây ảnh hưởng lớn đến cấu trúc gen, được khẳng định là đột biến gây bệnh. - Các biến đổi sai nghĩa: sử dụng công cụ online PolyPhen-2 và SIFT để kiểm tra mức độ ảnh hưởng tới cấu trúc và chức năng của protein thông qua điểm đánh giá thu được. Diễn giải kết quả dự đoán theo bảng dưới đây: Biến đổi Chỉ số polyphen-2 Chỉ số SIFT Không gây bệnh 0 – 0,15 0,05 - 1 Có khả năng gây bệnh 0,15 – 0,85 0 – 0,05 (Giá trị càng gần 0 càng chắc chắn khả năng gây bệnh) Gây bệnh 0,85 – 1 (Giá trị càng gần 1 càng chắc chắn khả năng gây bệnh) 58 Bước 4: Khẳng định đột biến gây bệnh Kết hợp các thông tin về chẩn đoán lâm sàng, nồng độ yếu tố FIX cơ sở của bệnh nhân, điểm đánh giá trên phần mềm PolyPhen-2, SIFT và các biến đổi di truyền đi kèm (nếu có) để khẳng định đột biến gây bệnh. 2.4.10. Phân tích đa hình nucleotide trên gen F9 từ dữ liệu giải trình tự Bước 1: Xử lý dữ liệu (thực hiện như bước xử lý dữ liệu phân tích đột biến gen) Bước 2: Phân tích các biến đổi nucleotide trên gen F9 Sử dụng phần mềm CLC Genomic Workbench ghép nối (alignment) dữ liệu thu được với gen tham chiếu (F9_NC000023.11) để xác định những biến đổi nucleotide. Các biến đổi nucleotide được chú giải theo danh pháp của Hiệp hội các biến đổi di truyền người (Human Genome Variation Society, HGVS). Đối chiếu với cơ sở dữ liệu SNP quốc tế (https://www.ncbi.nlm.nih.gov/snp) để nhận định các biến đổi nucleotide đã biết và biến đổi mới. Xác đinh đa hình dị hợp tử: khi tần suất alen đa hình < 70% Tính toán chỉ số đa hình - Tần số alen: được tính toán bằng cách đếm trực tiếp từ dữ liệu phân tích của 301 NST X (từ 100 mẫu người phụ nữ khỏe mạnh và 100 bệnh nhân). - Tần số dị hợp tử quan sát được (Observed Heteoygosity, Ho): Ho = - Phân tích mối liên kết giữa các SNP: Phân tích mối liên kết giữa các SNP: kết hợp quan sát sự xuất hiện của các đa hình dị hợp tử trong các mẫu nghiên cứu và kết quả phân tích trên phần mềm Haploview 4.2 sử dụng giá trị D’. Giá trị D’ thể hiện trong các ô vuông (Hình 2.2). Mức độ liên kết của các SNP tăng dần theo mầu sắc của ô vuông, màu càng đỏ đậm thể hiện mối liên kết càng chặt chẽ. Ô vuông đỏ đậm không chứa con số thể hiện mối liên kết hoàn toàn (D’ = 1). Số cá thể dị hợp tử Tổng số cá thể quan sát 59 Hình 2.2: Xác định giá trị D’ trên phần mềm Haploview + Nếu D’ = 0: hai SNP cân bằng liên kết hoàn toàn (di truyền độc lập với nhau) + D’ = 1: hai SNP mất cân bằng liên kết hoàn toàn (luôn di truyền cùng nhau) + 0 < D’ <1: hai SNP mất cân bằng liên kết không hoàn toàn (di truyền cùng nhau nhưng không hoàn toàn). - Tiêu chuẩn lựa chọn các đa hình có giá trị thông tin: + Các đa hình có tỷ lệ dị hợp tử cao + Đa hình cân bằng liên kết hoàn toàn hoặc mất cân bằng liên kết không hoàn toàn với các đa hình khác. - Khảo sát khả năng ứng dụng của bộ đa hình: Áp dụng bộ chỉ thị đa hình phân tích trên 23 người phụ nữ mang gen. Hiệu quả chẩn đoán của mỗi SNP được tính bằng số lượng SNP dị hợp tử trong số 23 mẫu. Hiệu quả của bộ SNP được tính bằng tổng số trường hợp mẫu dị hợp tử khi phối hợp bộ đa hình. 2.4.11. Xử lý số liệu Số liệu được xử lý, phân tích trên phần mềm SPSS 16.0 và Microsoft Office Excel 365. 2.4.12. Vấn đề đạo đức nghiên cứu Nghiên cứu được tiến hành dưới sự đồng ý của Ban Lãnh đạo Viện, khoa Di truyền & Sinh học phân tử và Hội đồng Khoa học của Viện. Nghiên cứu nhằm thiết lập bộ công cụ chẩn đoán phân tử trong bệnh hemophilia B, góp phần kiểm soát gen bệnh. Các thông tin về bệnh nhân trong nghiên cứu hoàn toàn được giữ bí mật. D’ = 1 (100% ) D’ = 0.75 (75%) 60 CHƯƠNG 3. KẾT QUẢ NGHIÊN CỨU 3.1. Chuẩn bị mẫu nghiên cứu 3.1.1. Thu thập mẫu nghiên cứu Trong nghiên cứu này, để phục vụ mục tiêu phân tích đột biến trên người bệnh hemophilia B và khảo sát các đa hình nucleotide trên quần thể người bình thường, chúng tôi đã thu thập mẫu từ các đối tượng là 100 bệnh nhân hemophilia B và 100 phụ nữ khỏe mạnh. Trong đó, 100 người phụ nữ khỏe mạnh lựa chọn cho nghiên cứu là những người đang tham gia hiến máu tại Viện Huyết học – Truyền máu TW, có độ tuổi trung bình là 24 ± 14, không có quan hệ huyết thống, không có tiền sử chảy máu lâu cầm. 100 bệnh nhân trong nghiên cứu thuộc Trung tâm hemophilia, Viện Huyết học – Truyền máu TW. Một số đặc điểm của các bệnh nhân nghiên cứu được trình bày ở Bảng 3.1. Bảng 3.1. Đặc điểm của các bệnh nhân nghiên cứu Bệnh nhân hemophilia B (n=100) Đặc điểm N Tỷ lệ (%) Giới tính Nam 99 99 Nữ 1 1 Mức độ bệnh Nặng 79 79 Trung bình 17 17 Nhẹ 4 4 Tình trạng xuất hiện ức chế Có 0 0 Không 100 100 Độ tuổi trung bình (x ± SD) 22 ±16 Bảng 1 cho thấy, bệnh nhân trong nghiên cứu chủ yếu là nam giới (99 bệnh nhân), chỉ có 01 trường hợp là nữ giới. Trong số đó, 79% bệnh nhân có bệnh mức độ bệnh nặng (nồng độ FIX <1%), 17% bệnh nhân có mức độ bệnh trung bình (nồng độ FIX từ 1 – 5%), 4% bệnh nhân có mức độ nhẹ (nồng độ FIX từ 5 – 40%). Tất cả các bệnh nhân tham gia nghiên cứu không xuất hiện ức chế FIX trong quá trình điều trị. 61 3.1.2. Chuẩn bị vật liệu nghiên cứu Các mẫu sau khi thu thập được tiến hành tách chiết ADN để phục vụ cho nghiên cứu. Quá trình tách chiết ADN sử dụng bộ kít QIAamp DNA Blood Mini Kit). Sau khi tách, các mẫu ADN được kiểm tra chất lượng đồng thời bằng phương pháp đo quang trên máy nanodrop 2000 và điện di trên gel agarose. Kết quả kiểm tra chất lượng các mẫu ADN sau tách được trình bày ở phụ lục 01. Hình ảnh điện di ADN và kết quả đo nồng độ của một số mẫu nghiên cứu được trình bày ở Hình 3.1 và Bảng 3.2. Hình 3.1. Kết quả tách chiết ADN tổng số HB1-HB6: 6 mẫu bệnh nhân (từ 1 đến 6) NK1-NK6:6 phụ nữ khỏe mạnh (từ 1 đến 6) M: thang ADN 1kb (Thermo Fisher) Bảng 3.2. Kết quả nồng độ và độ tinh sạch của một số mẫu ADN STT Tên mẫu Nồng độ (ng/µl) A260 /A280 1 HB1 108.8 1.9 2 HB2 94 1.91 3 HB3 150.1 1.91 4 HB4 108.1 1.9 5 HB5 93 1.91 6 HB6 225.6 1.88 7 NK1 90 1.95 8 NK2 93.6 1.94 9 NK3 111.7 1.9 10 NK4 119 1.88 11 NK5 207.5 1.9 12 NK6 207.5 1.91 Kết quả tách chiết ADN thể hiện ở Hình 3.1 và Bảng 3.2 cho thấy các mẫu ADN thu được đều đạt chất lượng để thực hiện các bước nghiên cứu tiếp theo với nồng độ cao (>100 ng/µl), băng ADN nguyên vẹn; độ tinh sạch thông qua chỉ số A260 /A280 nằm trong khoảng từ 1,7 – 2,2. 62 3.2. Xây dựng quy trình giải trình tự gen mã hóa yếu tố IX trên hệ thống NGS 3.2.1. Thiết kế bộ mồi khuếch đại toàn bộ gen F9 Để khuếch đại được toàn bộ gen F9 bằng phản ứng LR-PCR cần phải phân đoạn gen F9 thành những vùng gen nhỏ hơn. Gen F9 có kích thước xấp xỉ 35 kb, cấu trúc gồm 8 exon và 7 intron. Sau khi nghiên cứu trình tự gen F9, chúng tôi quyết định chia gen F9 thành 8 phân đoạn, mỗi phân đoạn có kích thước từ khoảng 4000 bp - 6000 bp. Tiếp đó, sử dụng phần mềm Primer3 để thiết kế các trình tự mồi cho 8 phân đoạn này. Các trình tự mồi sau thiết kế (Bảng 3.3) được kiểm tra độ bao phủ gen F9 bằng phần mềm CLC Genomic Workbench (Hình 3.2). Bảng 3.3. Phân đoạn ADN và các trình tự mồi thiết kế Đoạn Tên mồi Trình tự (5'-3') Vùng gen F9 khuếch đại Kích thước (bp) Đoạn gối đầu (bp) a1 F9-1F CCACAAGAGAAAGCAGGACG Đầu 5’ 4056 F9-1R TGAAGAGAATGGGCAGTGGT a2 F9-2F AAGAGGACAAAAGACAAGCTAGG exon 1 intron 1 4560 375 F9-2R TGCCTGCATCCATTTACAGTCG a3 F9-3F CACAGGTCTAGAGGAGGCAGAT Từ exon 2 đến intron 3 5572 446 F9-3R TGCCTATTCTCCCTCTTCTCTGTC a4 F9-4F TGCCTGAACCCAAAGTACACAC exon 4 intron 4 5594 436 F9-4R GGTGATTAGCTCTGGGTGGATGT a5 F9-5F TGCTTAACTTCCTGGGACTGTCTC exon 5 intron 5 5724 314 F9-5R CACAGCCATATTCACCAGGACC a6 F9-6F CTGCCTGGTTCTTCACATACACTG exon 6 4765 589 F9-6R TGCCTTAGTCACAGCAGGTTTG a7 F9-7F CACCACCTCCATCCAGTTCCTTAT Intron 6 5723 229 F9-7R GCAGGGCTCATTCATTCTTTCCAC a8 F9-8F TCAGCTTTGTAGGTCTCCAGGTAG Từ exon 7 đến vùng poly A 5305 582 F9-8R GCCACAGAGAAGACCAATACAGG 63 Kết quả thiết kế mồi ở Bảng 3.3 cho thấy các phân đoạn a1-a8 được thiết kế gối đầu nhau, vùng trình tự gối đầu của mỗi đoạn dài từ 229 bp đến 589 bp. Phân đoạn lớn nhất (a5) có chiều dài 5724 bp, phân đoạn nhỏ nhất (a1) có chiều dài 4056 bp. Hình 3.2. Kết quả kiểm tra độ bao phủ gen F9 của các trình tự mồi Hình ảnh lắp ráp các trình tự mồi trên gen tham chiếu trên phần mềm CLC cho thấy, 8 cặp mồi thiết kế đã bao phủ toàn bộ gen F9, đảm bảo quá trình khuếch đại sẽ thu được gen F9 hoàn chỉnh. 3.2.2. Tối ưu quy trình LR- PCR khuếch đại 8 vùng gen F9 Sau khi thiết kế các trình tự primer, bước tiếp theo cần thực hiện là tối ưu quy trình LR-PCR để khuếch đại 8 phân đoạn của gen F9. Với công cụ NEB Tm Calculator (https://tmcalculator.neb.com), chúng tôi đã xác định được nhiệt độ nóng chảy (Tm) của từng cặp mồi riêng biệt khi sử dụng Q5 High-Fidelity 2x Master Mix và tính toán được nhiệt độ gắn mồi trung bình theo lý thuyết của cả 8 cặp mồi là 68,6oC. Dựa vào đây, chúng tôi sử dụng dải nhiệt độ với biên độ ±2-3oC so với Tm trung bình để tối ưu phản ứng LR-PCR cho từng cặp mồi riêng biệt. Các nhiệt độ được lựa chọn cho bước gắn mồi trong phản ứng LR-PCRlà 65oC,66oC, 67oC, 68oC, 69oC,70oC.Kết quả phản ứng LR-PCR được kiểm tra bằng điện di trên gel agarose 1%, sử dụng 1kb DNA ladder (Thermo Fisher) (Hình 3.3- 3.6). Hình 3.3. Kết quả phản ứng LR-PCR tối ưu đoạn a1 và a2 Giếng M: Thang ADN chuẩn 1 kb (Thermo Fisher); a1: phân đoạn a1(4056 bp); a2: phân đoạn a2 (4560 bp) 64 Hình 3.4. Kết quả phản ứng LR-PCR tối ưu đoạn a3 và a4 Giếng M: Thang ADN chuẩn 1 kb (Thermo Fisher); a3: phân đoạn a3 (5572 bp); a4: phân đoạn a4 (5594 bp) Hình 3.5. Kết quả phản ứng LR-PCR tối ưu đoạn a5 và a6 Giếng M: Thang ADN chuẩn 1 kb (Thermo Fisher); a5: phân đoạn a5 (5724 bp); a6: phân đoạn a6 (4765 bp) Hình 3.6. Kết quả phản ứng LR-PCR tối ưu đoạn a7 và a 8 ở các điều kiện nhiệt độ bắt cặp mồi khác nhau (từ 65-70oC). Giếng M: Thang ADN chuẩn 1 kb (Thermo Fisher); a7: phân đoạn a7(5723 bp); a8: phân đoạn a8 (5305 bp) Từ hình ảnh các kết quả điện di cho thấy nhiệt độ bắt cặp của các cặp mồi có sự khác biệt tương đối rõ. Các cặp mồi khuếch đại đoạn a1, a2,a5, a6, a7 cho sản phẩm tương đối đặc hiệu, rõ nét ở nhiệt độ gắn mồi là 66oC (Hình 3.3, 3.5, 3.6), trong khi đó mồi cho đoạn a3, a4 có sản phẩm đặc hiệu, rõ nét ở nhiệt độ gắn mồi là 68oC (Hình 65 3.4), riêng mồi để nhân đoạn a8 ở tất cả các dải nhiệt độ đều không có sản phẩm (Hình 3.6). Lặp lại thử nghiệm tối ưu đoạn a8 ở cùng điều kiện, ở điều kiện giảm Tm xuống 60oC, 62oC, 64oC, phản ứng LR-PCR vẫn không có sản phẩm. Để loại trừ nguyên nhân do bộ kit Q5 High-Fidelity 2x Master Mix không phù hợp để khuếch đại đoạn a8, chúng tôi đã thử nghiệm với bộ hóa chất Qiagen Longrange PCR Kit, phản ứng PCR khuếch đại đoạn a8 vẫn không thành công (Hình 3.7). Hình 3.7. Kết quả phản ứng LR-PCR tối ưu đoạn a8 (kit Qiagen Longrange PCR) Khả năng phản ứng LR-PCR khuếch đại đoạn a8 không thành công được là do các trình tự primer không gắn được vào mạch khuôn, chúng tôi thiết kế lại cặp mồi nhân đoạn a8. Ở lần thiết kế này mồi F9-8F được giữ nguyên, mồi F9-8R được thiết kế dịch vào trong gen so với vị trí lần đầu 1274 nucleotide (F9-8R’: 5’- AGAACTAAAGGAACTAGCAAG-3’). Kết quả tối ưu đoạn a8 sử dụng Q5 High- Fidelity 2x Master Mix với cặp mồi F9-8F và F9-8R’ được thể hiện trên hình 3.8. Kết quả điện di hình 3.8 cho thấy, với cặp mồi F9-8F và F9-8R’, ở nhiệt độ 69oC phản ứng LR-PCR khuếch đại đoạn a8 đã cho sản phẩm tương đối đặc hiệu, đúng kích thước 4031 bp. Như vậy, phản ứng LR-PCR khuếch đại các phân đoạn a1- a8 của gen F9 đã được tối ưu thành công với bộ kit Q5 High-Fidelity 2x Master. Bằng 8 phản ứng LR-PCR ở 3 điều kiện Tm khác nhau chúng tôi đã khuếch đại được toàn bộ gen F9 dài 35kb thông qua các phân đoạn a1-a8 (Hình 3.9). 3000 bp 66 Hình 3.8. Kết quả phản ứng LR-PCR tối ưu đoạn a8 (với cặp mồi F9-8F và F9-8R’) Giếng M: Thang ADN chuẩn 1 kb (Thermo Fisher); a8: phân đoạn a8 (5305 bp) Hình 3.9. Hình ảnh khuếch đại các phân đoạn a1-a8 ở điều kiện Tm tối ưu. Giếng M: Thang ADN chuẩn 1 kb (Thermo Fisher); a1- a8: các phân đoạn a1 -a8 của gen F9 Để khảo sát tính ổn định của phản ứng LR-PCR với các điều kiện Tm tối ưu, chúng tôi thực hiện khuếch đại gen F9 của 10 bệnh nhân lựa chọn ngẫu nhiên. Kết quả cho thấy sản phẩm phản ứng LR- PCR ở tất cả các mẫu đều có băng ADN đặc hiệu, rõ nét, đúng kích thước theo thiết kế (kết quả không nêu tại đây). Từ các kết quả trên, chúng tôi nhận thấy điều kiện tối ưu về thành phần phản ứng và chu trình nhiệt cho phản ứng LR-PCR khuếch đại các phân đoạn đoạn từ a1-a8 của gen F9 như sau: Bảng 3.4. Thành phần phản ứng LR-PCR khuếch đại các đoạn a1-a8 Thành phần Nồng độ Thể tích (µl) Q5 High-Fidelity 2x Mastermix 1X 12,5 Primer F 10 pM 1 Primer R 10 pM 1 ADN khuôn 100 ng 1 H20 9,5 Tổng thể tích 25 67 Bảng 3.5. Chu trình nhiệt của phản ứng LR-PCR cho đoạn a1, a2, a5, a6, a7 Nhiệt độ Thời gian Số chu kỳ 97oC 3 phút 1 97oC 30 giây 35 66oC 45 giây 72oC 5 phút 72oC 10 phút 1 15oC ∞ 1 Bảng 3.6. Chu trình nhiệt của phản ứng LR-PCR cho đoạn a3 và a4 Nhiệt độ Thời gian Số chu kỳ 97oC 3 phút 1 97oC 30 giây 35 68oC 45 giây 72oC 5 phút 72oC 10 phút 1 15oC ∞ 1 Bảng 3.7. Chu trình nhiệt độ của phản ứng LR-PCR cho đoạn a8 Nhiệt độ Thời gian Số chu kỳ 97oC 3 phút 1 97oC 30 giây 35 69oC 45 giây 72oC 5 phút 72oC 10 phút 1 15oC ∞ 1 Quy trình LR-PCR với thành phần và các điều kiện đã tối ưu được sử dụng để khuếch đại các đoạn a1-a8 cho tất cả các mẫu nghiên cứu trong đề tài. Sản phẩm của phản ứng LR-PCR sau đó được tinh sạch và chuẩn bị thư viện ADN phục vụ bước giải trình tự gen F9 bằng kỹ thuật NGS. 3.2.3. Chuẩn bị thư viện ADN Sản phẩm PCR khuếch đại gen F9 được sử dụng để chuẩn bị thư viện ADN phục vụ bước giải trình tự NGS. Chúng tôi sử dụng bộ kit Nextera XT DNA Library preparation để chuẩn bị thư viện với mục tiêu thu được các đoạn ADN có kích thước nằm trong khoảng 300 bp đến 500 bp. Quy trình cắt sản phẩm PCR được thực hiện theo hướng dẫn đi kèm của bộ kit. Kết quả được thể hiện trên Hình 3.10. 68 Hình 3.10. Kết quả kiểm tra thư viện ADN trên hệ thống điện di mao quản BiOptic Kết quả kiểm tra tư viện ở Hình 3.10 cho thấy các đoạn ADN trong thư viện chủ yếu tập trung ở khoảng kích thước 462 bp, nằm trong vùng tiêu chuẩn là từ 300 bp đến 500 bp. 3.2.4. Giải trình tự với quy trình NGS đã tối ưu Thư viện ADN được tinh sạch bằng Agencourt Ampure XP, sau đó thực hiện giải trình tự sử dụng bộ kit Miseq Reagent. Kết quả giải trình tự cho thấy các chỉ số đánh giá chất lượng đáp ứng các tiêu chí kỹ thuật với Q30 = 90,5%; density = 1153 K/mm2; Cluster passing filter = 88,2% (Hình 3.11 a). Dữ liệu giải trình tự thu được bao phủ hoàn toàn gen F9 (35kb) (Hình 3.11 b). Độ bao phủ (coverage) tối thiểu cho mỗi nucleotide là 100X. (a) Q30 = 93,8%; density = 896 K/mm2; Cluster passing filter = 91,7%. 69 (b) Hình 3.11. Các chỉ số chất lượng và hình ảnh kết quả giải trình tự (a) Các chỉ số chất lượng giải trình tự thu được (b) Một số hình ảnh kết quả giải trình tự NGS 70 3.2.5. Khẳng định kết quả giải trình tự NGS Để khẳng định độ tin cậy của quy trình giải trình tự gen NGS đã xây dựng, chúng tôi thực hiện giải trình tự gen F9 của 10 bệnh nhân (lựa chọn ngẫu nhiên) với đồng thời cả hai quy trình là quy trình NGS và quy trình Sanger đã chuẩn hóa. Kết quả phân tích dữ liệu thu được từ hai quy trình cho thấy, tất cả 10/10 (100%) bệnh nhân khảo sát đều thu được các thông tin đột biến gen giống nhau (Hình 3.12). Kết quả giải trình tự NGS Kết quả giải trình tự Sanger (1) Mẫu HB04 Bất thường c.128G>A Bất thường c.128G>A (2) Mẫu HB05 Bất thường c.382T>C Bất thường c.382T>C 71 (3) Mẫu HB06 Bất thường c.676C>T Bất thường c.676C>T (4) Mẫu HB08 Bất thường c.689G>T Bất thường c.689G>T (5) Mẫu HB12 Bất thường c.127C>T Bất thường c.127C>T 72 (6) Mẫu HB15 Bất thường c.677G>A Bất thường c.677G>A (7) Mẫu HB18 Bất thường c.470G>T Bất thường c.470G>T (8) Mẫu HB19 Bất thường c.1135C>T Bất thường c.1135C>T 73 (9) Mẫu HB22 Bất thường c.874C>T và c.933G>C Bất thường c.874C>T và c.933G>C (10) Mẫu HB25 Đột biến c.956T>C Đột biến c.956T>C Hình 3.12. Kết quả phân tích đột biến với quy trình NGS và Sanger 3.3. Giải trình tự gen F9 ở các mẫu nghiên cứu Áp dụng quy trình giải trình tự bằng NGS xây dựng ở trên, chúng tôi đã giải trình tự gen F9 cho tất cả các mẫu nghiên cứu (100 bệnh nhân và 100 phụ nữ khỏe mạnh). Ngoại trừ dữ liệu của 3 bệnh nhân có mã số H14, H94, H97 thì dữ liệu giải trình tự thu được của 197 mẫu còn lại (97 bệnh nhân và 100 người khỏe mạnh) đều bao phủ hoàn toàn gen F9 (35 kb), đạt yêu cầu để phân tích các biến đổi di truyền (bao gồm đột biến và đa hình nucleotide) trên gen F9. Mẫu H14, H94, H97 là các mẫu bị khuyết sản phẩm Longrange PCR ở các phân đoạn a5 (H14), a2-a8 (H94), a4-a6 (H97) do có mất đoạn gen (Hình 3.13), nên chỉ thu được dữ liệu giải trình tự của các vùng 74 gen còn lại (Hình 3.14). Lý do của hiện tượng khuyết các phân đoạn gen ở 3 mẫu H14, H94, H97 đã được khẳng định (bằng kỹ thuật MLPA) là do có mất đoạn gen (Hình.3.15). Mẫu H14: không khuếch đại được đoạn a5 Mẫu H94: không khuếch đại được đoạn a2-a8 Mẫu H97: không khuếch đại được đoạn a4-a6 Hình 3.13. Kết quả Longrange PCR của các mẫu H14, H94, H97 Mẫu H14: Thiếu exon 5 6000 bp 3000 bp 6000 bp 3000 bp 6000 bp 3000 bp 75 Mẫu H94:Thiếu exon 1 - 8 Mẫu H97: Thiếu exon 4 -6 Hình 3.14. Kết quả giải trình tự gen NGS của các mẫu H14, H94, H97 Mẫu H14: Đột biến mất exon 5 76 Mẫu H94: Đột biến mất đoạn gen từ exon 1 đến exon 8 Mẫu H97: Đột biến mất đoạn gen từ exon 4 đến exon 6 Hình 3.15. Kết quả phân tích MLPA của các mẫu H14, H94, H97 3.4. Phân tích đột biến gen ở 100 bệnh nhân nghiên cứu Với mục tiêu lập bản đồ đột biến gen của 100 bệnh nhân hemophilia B (99 bệnh nhân nam và 01 bệnh nhân nữ) tham gia nghiên cứu, chúng tôi đã phối hợp phân tích dữ liệu NGS và MLPA thu được của 100 bệnh nhân này. Kết quả phân tích cho thấy, tỷ lệ phát hiện đột biến trong nghiên cứu là 100%. Trong đó, tất cả các bệnh nhân là nam giới đều mang một đột biến gen gây bệnh. Bệnh nhân là nữ giới mang đột biến c.881A>G đồng hợp tử trên cả hai nhiễm sắc thể X. Kết quả giải trình tự gen F9 của 100 bệnh nhân được trình bày ở phụ lục 02. Từ dữ liệu giải tình tự gen chúng tôi nhận thấy trong số các đột biến gen phát hiện được ở 100 bệnh nhân có 58 biến đổi di truyền khác nhau. Trong đó, có 42 đột biến gây bệnh đã được công bố và 16 đột biến mới chưa được công bố trong cơ sở dữ liệu cơ sở dữ liệu của EAHAD ( và CDC (https://www.cdc.gov/ncbddd/hemophilia/champs.html). Tỷ lệ đột biến mới gặp trong nghiên cứu là 27,59%. 77 Trong số 16 đột biến mới, có 5 đột biến mất đoạn, 2 đột biến dẫn đến dừng dịch mã, 1 đột biến chèn đoạn, 1 đột biến vùng promoter và 7 đột biến điểm dẫn tới thay thế axit amin. Chúng tôi đã sử dụng song song hai phần mềm Polyphen-2 và SIFT để khảo sát tác động của 7 đột biến thay thế tới cấu trúc và chức năng của phân tử yếu tố IX. Kết quả dược trình bày ở bảng 3.8 Bảng 3.8: : Danh sách 16 đột biến mới phát hiện trong nghiên cứu STT Đột biến Thay đổi axit amin Loại đột biến Vị trí Nồng độ FIX ở bệnh nhân Polyphen2- score SIFT score 1 c.88G>T p.Val30Phe Đột biến thay thế exon 1 0,9 0,844 0,21 2 c.192T>G p.Cys64Trp Đột biến thay thế exon 2 0,1 1 0 0,2 0,2 4 c.689G>T p.Gly230Val Đột biến thay thế exon 6 0,1 0,995 0 5 c.942T>A p.His314Gln Đột biến thay thế exon 8 5,7 0,778 0,1 6 c.1069G>C p.Gly357Arg Đột biến thay thế exon 8 0,1 1 0 7 c.1220G>C p.Cys407Ser Đột biến điểm exon 8 0,5 0,997 0 8 del_exon 4-6* - Mất 3 exon - 0,1 - 9 c.-21C>T - Đột biến điểm promoter 4,5 - 10 c348-349insGA pGlu116Glufs*15 Chèn đoạn exon 5 0,3 - 11 del_exon 5* - Mất exon 5 exon 5 0,4 - 12 c.874C>T p.Gln292* Đột biến dừng dịch mã exon 8 0,4 - 13 c.952delC p.Leu318Phefs*8 Mất 1 nucleotide exon 8 0,1 - 14 c.1060del A p.Ser354Valfs*14 Mất 1 nucleotide exon 8 0,3 - 15 c.1084A>T P.Lys362* Đột biến dừng dịch mã exon 8 0,1 - 16 c.1159-1161del p.Lys387del Mất 3 nucleotide exon 8 0,2 - 0Đột biến thay thế3 c.470G>T p.Cys157Phe exon 5 0,999 Bảng 3.9. Danh sách 58 đột biến phát hiện trong nghiên cứu STT Biến đổi nucleotide (HGVS cDNA) Biến đổi axit amin (HGVS protein) Vị trí Domain Tình trạng Số trường hợp 1 c.-21C>T - promoter - Mới 1 2 c.88G>T p.Val30Phe exon 1 PRO Mới 1 3 c.128G>A p.Arg43Gln exon 2 PRO Đã công bố [97] 3 4 c.127C>T p.Arg43Trp exon 2 PRO Đã công bố [97] 6 5 c.137G>T p.Arg46Met exon 2 PRO Đã công bố [98] 1 78 STT Biến đổi nucleotide (HGVS cDNA) Biến đổi axit amin (HGVS protein) Vị trí Domain Tình trạng Số trường hợp 6 c.149G>A p.Gly50Asp exon 2 GLA Đã công bố [77] 3 7 c.192T>G p.Cys64Trp exon 2 GLA Mới 1 8 c.206G>A p.Cys69Tyr exon 2 GLA Đã công bố [99] 3 9 c.215A>G p.Glu72Gly exon 2 GLA Đã công bố [100] 1 10 c.223C>T p.Arg75* exon 2 GLA Đã công bố [97] 2 11 c.253-1G>C splice site intron 2 - Đã công bố [101] 1 12 c.277+4A>G - intron 3 - Đã công bố [98] 1 13 c.278-3A>G Splice site intron 3 - Đã công bố [101] 2 14 c.344A>G p.Tyr115Cys exon 4 EGF1 Đã công bố [102] 1 15 c.349T>A p.Cys117Ser exon 4 EGF1 Đã công bố [103] 2 16 c.382T>C p.Cys128Arg exon 4 EGF1 Đã công bố [104] 1 17 c.383G>A p.Cys128Tyr exon 4 EGF1 Đã công bố [98] 1 18 c348- 349insGA pGlu116Glufs*15 exon 5 EGF1 Mới 1 19 c.422G>A p.Cys141Tyr exon 5 EGF2 Đã công bố [105] 1 20 c.433T>C p.Cys145Arg exon 5 EGF2 Đã công bố [106] 1 21 c.470G>T p.Cys157Phe exon 5 EGF2 Mới 2 22 del_exon 5* - exon 5 EGF2 Mới 1 23 c.520+13A>G - intron 5 - Đã công bố [106] 1 24 c.676C>T p.Arg226Trp exon 6 Activation Đã công bố [107] 2 25 c.677G>A p.Arg226Gln exon 6 Activation Đã công bố [108] 2 26 c.689G>T p.Gly23

Các file đính kèm theo tài liệu này:

  • pdfluan_an_nghien_cuu_dot_bien_va_da_hinh_di_truyen_tren_gen_ma.pdf
  • docĐóng góp mới.doc
  • pdfĐóng góp mới.pdf
  • pdfQĐ.pdf
  • pdfTóm tắt TA.pdf
  • pdfTóm tắt TV.pdf
  • docTrích yếu luận án.doc
  • pdfTrích yếu luận án.pdf
Tài liệu liên quan