Luận án Nghiên cứu một số đặc tính của vi khuẩn Escherichia coli (nhóm VTEC) phân lập từ bò, lợn được giết mổ tại Hà Nộ


Lời cam đoan i

Lời cảm ơn ii

Mục lục iii

Danh mục các chữ viết tắt vii

Danh mục các bảng ix

Danh mục hình xi


1 Tính cấp thiết của đề tài 1

2 Mục tiêu của đề tài 3

3 Ý nghĩa khoa học và thực tiễn của đề tài 3

4 Những đóng góp mới của luận án 4

 Chương 1

1.1 Vi khuẩn E. coli 5

1.1.1 Phân loại E. coli 8

1.1.2 Đặc tính của vi khuẩn E. coli 9

1.2 Verotoxigenic Escherichia coli (VTEC) 14

1.2.1 Danh pháp 14

1.2.2 Một số yếu tố độc lực của vi khuẩn nhóm VTEC 15

1.2.3 Vai trò của VTEC không thuộc nhóm O157 22

1.2.4 VTEC ở động vật 24

1.2.5 VTEC trong thực phẩm 28

1.2.6 Nhiễm VTEC ở người 29

1.3 Tình hình nghiên cứu về vi khuẩn E. coli và bệnh do chúng gây

ra tại Việt Nam 31

1.4 Phương pháp phát hiện VTEC trong mẫu bệnh phẩm và thực phẩm 32iv

1.4.1 Phương pháp vi sinh vật 33

1.4.2 Phương pháp miễn dịch học 33

1.4.3 Phương pháp sinh học phân tử 34

1.5 Một số kỹ thuật sinh học phân tử dùng để phân loại vi sinh vật 40

1.5.1 Nguyên tắc 41

1.5.2. Kỹ thuật 42

1.5.3 Ứng dụng của kỹ thuật phân tích PFGE 44

Chương 2

2.1 Nội dung nghiên cứu 45

2.1.1 Thực trạng công tác kiểm soát giết mổ, vệ sinh thú y trên địa

bàn Hà Nội 45

2.1.2 Thiết lập và chuẩn hóa phương pháp PCR dùng để xác định vi

khuẩn VTEC 45

2.1.3 Tỷ lệ nhiễm và một số đặc tính cơ bản của những chủng

VTEC phân lập được 45

2.2 Địa điểm và thời gian nghiên cứu 46

2.3 Đối tượng nghiên cứu 46

2.4 Nguyên liệu nghiên cứu 46

2.4.1 Môi trường, hóa chất, dụng cụ thí nghiệm 46

2.4.2 Các chủng vi khuẩn đối chứng dương và âm 47

2.5 Phương pháp nghiên cứu 47

2.5.1 Phương pháp lấy mẫu 47

2.5.2 Phương pháp xác định số lượng vi khuẩn trong canh khuẩnnuôi cấy 48

2.5.3 Phương pháp tiến hành phản ứng PCR 48

2.5.4 Phương pháp xác định độ đặc hiệu của phản ứng PCR 51v

2.5.5 Phương pháp xác định độ nhạy của phản ứng PCR 52

2.5.6 Phương pháp phân lập và giám định vi khuẩn VTEC 52

2.5.7 Phương pháp xác định serotyp kháng nguyên O của các chủng

vi khuẩn phân lập được 54

2.5.8 Xác định sự đa dạng di truyền của các chủng VTEC có nguồn

gốc khác nhau bằng phản ứng PFGE (Pulsed-field gel

electrophoresis) 55

2.5.9 Xử lý số liệu 56

 Chương 3

3.1 Thực trạng công tác kiểm soát giết mổ, vệ sinh thú y trên địa bànHà Nội 57

3.1.1 Thực trạng công tác kiểm soát giết mổ tại các điểm giết mổ

gia súc, gia cầm trên địa bàn Hà Nội 57

3.1.2 Kết quả điều tra điều kiện giết mổ và phương tiện vận chuyển

của các điểm giết mổ trên địa bàn Hà Nội 60

3.1.3 Thực trạng vệ sinh tại khu giết mổ gia súc, gia cầm trên địa

bàn Hà Nội 64

3.1.4 Thực trạng điều kiện vệ sinh thú y tại cơ sở kinh doanh, chợ,

tiêu thụ sản phẩm thịt gia súc, gia cầm 69

3.2 Thiết lập và chuẩn hóa phương pháp PCR dùng để xác định vikhuẩn VTEC 70

3.2.1 Lựa chọn giữa PCR đơn mồi và Multiplex - PCR 70

3.2.2 Lựa chọn môi trường nuôi cấy thích hợp để tách chiết DNA mẫu 73

3.2.3 Kết quả thực hiện phản ứng PCR với các chủng vi khuẩn

E. coli tham chiếu 75

3.2.4 Kết quả xác định độ nhạy và độ đặc hiệu của phản ứng PCR

dùng để xác định VTEC trong môi trường nhân tạo 77vi

3.2.5 Kết quả xác định độ nhạy và độ đặc hiệu của phương pháp

PCR dùng để xác định VTEC trong mẫu thịt sạch 83

3.2.6 Quy trình xác định sự có mặt của vi khuẩn VTEC trong cácmẫu thịt 85

3.3 Kết quả xác định tỷ lệ nhiễm VTEC trên bò, lợn tại các điểm giết

mổ và chợ thuộc địa bàn Hà Nội 87

3.3.1 Thu thập mẫu 87

3.3.2 Phân lập và giám định đặc tính sinh vật hóa học của các chủngE. coli 89

3.3.3 Kết quả phân lập VTEC trong thịt 93

3.3.4 Kết quả phân lập VTEC từ mẫu lau thân thịt và mẫu phân tạilò mổ 96

3.3.5 Kết quả xác định các loại độc tố của các chủng VTEC phânlập được 98

3.3.6 Kết quả xác định serotyp O của các chủng VTEC phân lập được 100

3.3.7 Kết quả phân tích quan hệ di truyền của một số chủng vi

khuẩn VTEC phân lập được có nguồn gốc khác nhau 103

KẾ LUẬ V Ề Ị 107

Kết luận 107

Đề nghị 108

Danh mục các công trình đã công bố có liên quan đến luận án 109

Tài liệu tham khảo 110

Phụ lục 125

pdf145 trang | Chia sẻ: lavie11 | Lượt xem: 546 | Lượt tải: 2download
Bạn đang xem trước 20 trang tài liệu Luận án Nghiên cứu một số đặc tính của vi khuẩn Escherichia coli (nhóm VTEC) phân lập từ bò, lợn được giết mổ tại Hà Nộ, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
uất. - Các loại dụng cụ, trang thiết bị máy móc phòng thí nghiệm bao gồm: Đĩa petri, lam kính, ống nghiệm, bình tam giác, micropipet, ống hút, que cấy, đèn cồn, nồi hấp khử trùng, tủ lạnh, lò vi sóng, kính hiển vi, máy PCR,... 2.4.2 Các chủng vi khuẩn đối chứng dương và âm Các chủng vi khuẩn E. coli làm đối chứng dương và âm do Viện nghiên cứu thú y (NVRI), Ba Lan; Phòng thí nghiệm tham chiếu E. coli, Tây Ban Nha (Laboratorio de Referencia de E. coli - LREC); Phòng thí nghiệm tham chiếu vi khuẩn E. coli của OIE, Canada (OIE Reference Laboratory for Escherichia coli) cung cấp. 2.5 Ph ơn pháp n hiên cứu 2.5.1 Phương pháp lấy mẫu - Dun l ợn m u Theo TCVN 4833-2002, tham khảo một số tài liệu của các nước trong khu vực và quốc tế. Để xác định được dung lượng mẫu cần thiết của đề tài nghiên cứu, trước hết khảo sát xét nghiệm khoảng 30 - 50 mẫu để tính toán tỷ lệ lưu hành sơ bộ của E. coli. Căn cứ tỷ lệ nhiễm E. coli khảo sát, áp dụng công thức tính dịch tễ học phần mềm máy tính WinEpiscope 2.0 sẽ tính được dung lượng mẫu cần thiết 48 cho nghiên cứu của đề tài đảm bảo độ chính xác 95%. - h ơn pháp lấy m u thịt t ơi từ chợ Mẫu thịt lợn, bò được mua ngẫu nhiên tại một số chợ và siêu thị trên địa bàn Hà Nội. Mẫu được lấy vào buổi sáng (6 - 7 giờ). Mỗi mẫu được đựng riêng rẽ vào 1 túi nilon sạch, có ghi rõ ký hiệu. Các mẫu được bảo quản trong nhiệt độ lạnh (4 - 80C) và chuyển về phòng thí nghiệm để xử lý mẫu trong cùng ngày. - h ơn pháp lấy m u l u thân thịt Dùng gạc tiệt trùng lau trên thân thịt sau khi đã được giết mổ, tách toàn bộ nội tạng, mỗi thân thịt lau tại 3 vị trí, 100 cm2/vị trí. Sau khi lau, gạc được đặt vào lọ có chứa 20ml môi trường mTSB. 2.5.2 Phương pháp xác định số lượng vi khuẩn trong canh khuẩn nuôi cấy Canh khuẩn sau khi nuôi cấy được pha loãng trong dung dịch PBS thành các nồng độ 10-1, 10-2, , 10-8. Lấy 0,1ml dung dịch ở các nồng độ pha loãng 10 -6 , 10 -7 , 10 -8 nhỏ và dàn đều trên bề mặt thạch máu, bồi dưỡng ở 370C trong 24 giờ. Mỗi nồng độ pha loãng dùng 03 đĩa thạch. Đếm số khuẩn lạc mọc trên đĩa thạch, rồi tính trung bình cho mỗi nồng độ. Số lượng vi khuẩn được tính theo công thức: X = 10  a  b Trong đó: X: là số lượng vi khuẩn có trong 1ml canh khuẩn ban đầu a: là số lượng vi khuẩn trung bình của 1 nồng độ pha loãng b: là hệ số pha loãng mẫu Hệ số 10 vì nhỏ 0,1ml canh khuẩn trên đĩa thạch. 2.5.3 Phương pháp tiến hành phản ứng PCR - PCR đơn mồi: mỗi phản ứng PCR sẽ được thực hiện với sự tham gia của một cặp mồi đặc hiệu để phát hiện một gen nhất định (VT1, VT2 hoặc eae). 49 - Multiplex - PCR: sử dụng nhiều cặp mồi trong một phản ứng PCR để phát hiện một số gen cần thiết. Trường hợp này là các gen VT1, VT2 và eae. Các thành phần khác của phản ứng giống như ở phản ứng PCR đơn mồi. Việc làm này nhằm mục đích xác định đồng thời nhiều gen thay vì chỉ xác định được 1 gen. - Xử lý DNA mẫu + Đối với canh khuẩn: DNA mẫu được tách chiết bằng phương pháp sốc nhiệt như sau: 1 ml canh khuẩn được đun ở 1000C/30 phút, đông lạnh ở âm 20 0C/qua đêm và sử dụng làm DNA mẫu (2,0 µl/phản ứng). + Đối với môi trường thạch: một lượng nhỏ khuẩn lạc được lấy trực tiếp và dùng làm DNA mẫu cho phản ứng PCR. - Các cặp mồi Mồi của phản ứng được thiết kế dựa vào chuỗi gen mã hóa sinh tổng hợp protein của độc tố VT1, VT2 và protein intimin quy định đặc tính xâm nhập và bám dính của VTEC. Trình tự các mồi và các sản phẩm tương ứng của chúng tạo ra được trình bày ở bảng 2.1. Bản 2.1. rình tự mồi ùn để xác định các en V 1, V 2 và eae Gen đích Ký hiệu primers huỗi primers (5 ’- 3 ’) Kích cỡ sản phẩm (bp) VT1 VT1-F 5’ - CAGTTAATGTGGTGGCGAAG - 3’ 894 VT1-R 5’ - CTGCTAATAGTTCTGCGCATG - 3’ VT2 VT2-F 5’ - CTTCGGTATCCTATTCCCGG - 3’ 481 VT2-R 5’ - GGATGCATCTCTGGTCATTG - 3’ eae eae-F 5’ - ACGTTGCAGCATGGGTAACTC - 3’ 816 eae-R 5’ - GATCGGCAACAGTTTCACCTG - 3’ - Phản ứng PCR được thực hiện với tổng thể tích là 25µl, được trình bày bảng 2.2. 50 Bản 2.2. hành phần các chất tr n phản ứn ùn để xác định các gen VT1, VT2 và eae hành phần hể tích (l) ồn độ Mồi xuôi 3 3,2 M /l Mồi ngược 3 3,2 M /l Dung dịch đệm AMP x 5 (Fermentas) gồm: + 750 mM Tris - HCl (pH=8) + 200 mM (NH4)2SO4 + 0,1% (v/v) Tween 20 + dNTPs + 2 mM MgCl2 5 - Taq - polymerase (Fermentas) 0,62 l 500 UI (1 U/1 l) DNA mẫu thích hợp Nước khử ion vừa đủ 25 l - Tổng cộng 25 l - - Các chu kỳ nhiệt của phản ứng PCR được trình bày ở bảng 2.3. Bản 2.3. ác chu ỳ nhiệt củ phản ứn ùn để xác định en VT1, VT2 và eae ác i i đ ạn củ phản ứn hiệt độ (oC) h i i n (phút) Số chu ỳ Giai đoạn tiền biến tính 94 5 1 Giai đoạn biến tính Giai đoạn bắt cặp Giai đoạn tổng hợp 94 50 72 1 1 1 30 Giai đoạn kéo dài 72 7 1 Giữ ở 40C - Phân tích sản phẩm: Các sản phẩm của phản ứng PCR được tiến hành chạy điện di trên thạch agarose 2% trong dung dịch 1 x TAE với hiệu điện thế 50V trong 30 phút. Đọc kết quả và chụp ảnh bằng hệ thống Gel Doc 2000. Ảnh được lưu giữ lại và được tiến hành xử lý kết quả khi cần thiết. 51 2.5.4 Phương pháp xác định độ đặc hiệu của phản ứng PCR Độ đặc hiệu của phản ứng PCR được xác định bằng cách kiểm tra với 10 chủng VTEC đối chứng dương và 10 chủng đối chứng âm với các thông tin về đặc tính của một số yếu tố gây bệnh đã được công bố ở bảng 2.4 và 2.5. Bản 2.4: Một số yếu tố ây bệnh chủ yếu củ các chủn vi huẩn E. coli đối chứn ơn Ký hiệu chủng Đặc tính về một số yếu tố gây bệnh Ghi chú (Nguồn gốc) Đối chứng dương E. coli FD523 VT1/VT2 Viện nghiên cứu thú y (NVRI), Ba Lan E. coli FD526 VT1 E. coli FD528 VT2 E. coli FD635 VT1/VT2/eae/Hly Phòng thí nghiệm tham chiếu E. coli, Tây Ban Nha (Laboratorio de Referencia de E. coli - LREC) E. coli FD636 VT1/VT2/eae/Hly E. coli BDL9.1 VT2 Phòng thí nghiệm tham chiếu vi khuẩn E. coli của OIE, Canada (OIE Reference Laboratory for Escherichia coli) E. coli BKT29.1 VT2 E. coli E4 VT1/VT2 E. coli E7 VT1/VT2 E. coli E41 VT1/VT2 Bản 2.5: Một số yếu tố ây bệnh chủ yếu củ các chủn vi huẩn đối chứn âm Ký hiệu chủng Đặc tính về một số yếu tố gây bệnh Ghi chú (Nguồn gốc) Đối chứng âm E. coli (C-600) (K-12) - Bộ môn Vi trùng, Viện Thú y E. coli FV847a F4/STa/STb/LT E. coli FV2289 F18/STa/STb/VT2v E. coli FV2586 F4/STb/LT E. coli FV2593 F18/STa/STb/VT2v S. typhumirium (FD675) - P. multocida (PM-VT3) - S. suis (HN-25) - S. aureus (FD231) - C. perfringens (BCD6) - 52 2.5.5 Phương pháp xác định độ nhạy của phản ứng PCR Phương pháp xác định độ nhạy của phản ứng PCR dùng để xác định VTEC trong môi trường nhân tạo Tiến hành cấy 1 khuẩn lạc của mỗi chủng vi khuẩn vào lọ đựng 20 ml môi trường (LB, m-TSB và BHI). Sau 20 giờ ủ ở 37oC, tiến hành pha loãng canh khuẩn theo cơ số 10 để được các nồng độ pha loãng thích hợp (10-1, 10-2, ....,10 -8), đếm số trên môi trường thạch máu, đồng thời tiến hành các bước tách DNA mẫu từ tất cả các nồng độ pha loãng (kể cả canh khuẩn ban đầu) để dùng cho phản ứng PCR. Lưu ý khi nuôi cấy E. coli không lắc, vì ảnh hưởng lớn đến sinh trưởng vi khuẩn và độ nhạy phản ứng. Phương pháp xác định độ nhạy của phương pháp PCR dùng để xác định VTEC trong các mẫu thịt sạch - Chọn 2 mẫu thịt (bò, lợn) đã được xác định là âm tính trong phản ứng PCR để tiến hành gây nhiễm với mỗi một chủng vi khuẩn đối chứng dương. - 25 g thịt đã được cắt nhỏ và cho vào 225 ml môi trường m-TSB. - Môi trường (m-TSB) đã nuôi cấy chủng vi khuẩn ở 37oC/24 giờ. Pha loãng thành các nồng độ từ 10-1 đến 10-8. - Cho 0,4 ml canh khuẩn ở mỗi nồng độ pha loãng vào lọ môi trường m-TSB đã có 25g thịt. - Tách DNA mẫu và tiến hành phản ứng PCR với tất cả các nồng độ pha loãng (kể cả canh khuẩn ban đầu). 2.5.6 Phương pháp phân lập và giám định vi khuẩn VTEC Từ các mẫu thu thập được, chúng tôi tiến hành phân lập và giám định vi khuẩn VTEC theo quy trình tham khảo của FDA (US Food and Drug Administration) và Phòng Thí nghiệm tham chiếu vi khuẩn E. coli của OIE, Canada (Universite ’ de Montre ’ al, Canada). 53 Quy trình này được thể hiện bằng hình 2.1 như sau: ình 2.1: Quy trình phân lập và iám định vi huẩn 37 0C/ qua đêm Mẫu (thịt tươi, lau thân thịt, phân) Tăng sinh - 25 g thịt + 225 ml m-TSB - Gạc lau thân thịt đặt trong lọ có 20 ml m-TSB - 0,5 g phân + 10 ml m-TSB 100 µl canh khuẩn cấy lên thạch MacConkey Chọn 2-3 khuẩn lạc điển hình /mẫu (khuẩn lạc màu hồng cánh sen) Kiểm tra các đặc tính sinh hóa PCR Âm tính PCR cho từng khuẩn lạc Âm tính Định typ Giữ giống 37 0C/ qua đêm Dương tính Dương tính 54 2.5.7 Phương pháp xác định serotyp kháng nguyên O của các chủng vi khuẩn phân lập được Phương pháp xác định serotyp kháng nguyên O của vi khuẩn E. coli bằng phản ứng ngưng kết nhanh trên phiến kính. Các chủng vi khuẩn được tiến hành xác định nhóm với huyết thanh đa giá trước, sau đó đến các huyết thanh đơn giá trong nhóm. * Chuẩn bị - Các chủng vi khuẩn VTEC cần định serotyp được cấy trên thạch máu cừu, ủ ở tủ ấm 370C trong 18 - 24 giờ. - Các kháng huyết thanh O chuẩn (đa giá và đơn giá). - Nước muối sinh lý 0,9%; phiến kính sạch, que cấy nhựa. * Phương pháp tiến hành phản ứng ngưng kết nhanh trên phiến kính Nhỏ lên phiến kính sạch, mỗi đầu một giọt nước muối sinh lý, dùng que cấy vô trùng lấy khuẩn lạc VTEC cần xác định trộn đều với 2 giọt nước muối sinh lý để tạo thành huyễn dịch vi khuẩn. Nhỏ một giọt kháng huyết thanh chuẩn vào một bên huyễn dịch và một giọt nước muối sinh lý vào bên huyễn dịch còn lại (đối chứng). Hiện tượng ngưng kết (nếu có) sẽ xuất hiện trong vòng 30 giây, hỗn dịch xuất hiện những hạt nhỏ trắng lấm tấm, tách ra làm hai phần gồm các hạt ngưng kết và phần nước trong. Với phản ứng ngưng kết xảy ra nhanh, rõ rệt thì được đánh giá ở mức ++++. Tùy theo khả năng ngưng kết, có thể đánh giá ngưng kết ở các mức độ khác nhau (+, ++, +++). Phản ứng là âm tính khi hỗn dịch vi khuẩn với kháng huyết thanh đục đều như bên đối chứng. Với những chủng có ngưng kết với kháng huyết thanh đa giá, thực hiện tiếp với các kháng huyết thanh đơn giá thuộc nhóm để xác định rõ từng serotyp. Trong trường hợp chủng có hiện tượng ngưng kết chéo với nhiều nhóm hoặc với nhiều đơn giá khác nhau hoặc chủng không ngưng kết với tất cả các 55 nhóm kháng huyết thanh đa giá, khuẩn lạc của chủng vi khuẩn đó được lấy vào 1 ống eppendorf đã có 200 µl nước muối sinh lý, đun ở 1000C trong 30 phút, ly tâm 10000 vòng/phút trong 10 phút, lấy cặn và tiến hành lại phản ứng ngưng kết. Những chủng cho kết quả âm tính với tất cả các nhóm kháng huyết thanh đa giá (kể cả sau khi đã tiến hành đun và ly tâm như trên) được kết luận là “không xác định”. 2.5.8 Xác định sự đa dạng di truyền của các chủng VTEC có nguồn gốc khác nhau bằng phản ứng PFGE (Pulsed-field gel electrophoresis) Sự tương đồng hệ gen của một số chủng vi khuẩn E. coli phân lập được xác định bằng phương pháp PFGE tại phòng thí nghiệm Vi khuẩn, Viện Vệ sinh dịch tễ Trung ương. Quy trình chuẩn bị mẫu DNA và thực hiện phản ứng dựa theo Hopkins và cs. (2000) [40], Helgerson và cs. (2006) [39], Sambrook và Russell (2001) [80]. Chủng vi khuẩn E. coli được cấy trên môi trường TSB và ủ qua đêm ở 37 0C. Vi khuẩn được thu hoạch và gắn vào thạch agarose. Phức hợp này được xử lý bằng Lysozyme (1 mg/ml) trong dung dịch phá vỡ tế bào vi khuẩn bacterial cell lysis solution ở 370C trong 2 giờ. Sau đó, hỗn dịch được xử lý tiếp bằng dung dịch Proteinase K (0,5 mg/ml - Bacterial cell proteinase K solution) ở 550C qua đêm. Hỗn dịch được rửa bằng Phenylmethylsulfonyl fluoride 1 mM và dung dịch đệm Tris 10 mM / EDTA 1 mM. Mẫu DNA được phân cắt bằng enzyme XbaI (10 đơn vị/µl, Promega) ở 370C trong 16 giờ. Sản phẩm sau phân cắt được điện di trên thạch Seakem Gold 1% bằng hệ thống điện di trường xung (CHEF-DR II, Bio-Rad, Hercules, Canada) trong dung môi điện di là TE 0,5X, chế độ cài đặt là: (1) Thời gian chuyển đổi ban đầu: 2,16 giây (2) Thời gian chuyển đổi kết thúc: 54,17 giây 56 (3)Thời gian điện di: 22 giờ (4) Hiệu điện thế: 150V (5) Nhiệt độ: 140C Sau khi điện di kết thúc, thạch agarose được nhuộm bằng Ethidium bromide (1µg/ml). Đọc và phân tích kết quả bằng phần mềm GelCompare (Bio-Rad). Đánh giá mức độ tương đồng hệ gen dựa trên tiêu chuẩn của Tenover và cs. (1995) [87]. 2.5.9 Xử lý số liệu Số liệu thu thập được xử lý bằng phần mềm MS Excel 2003 để tính. Sự sai khác giữa các giá trị được xem là có ý nghĩa thống kê khi P < 0,05. 57 h ơn 3 KẾ QUẢ V ẢO LUẬ 3.1 hực trạn côn tác iểm s át iết mổ, vệ sinh thú y trên đị bàn à ội Hà Nội có vị trí tự nhiên ở trung tâm đồng bằng Bắc Bộ, có địa giới hành chính giáp với 08 tỉnh (Thái nguyên, Bắc Ninh, Bắc Giang, Hưng Yên, Phú Thọ, Vĩnh Phúc, Hà Nam, Hòa Bình) với nhiều tuyến quốc lộ, tỉnh lộ, có đường sắt quốc gia nối liền với nhiều tỉnh trong cả nước. Theo số liệu thống kê, Hà Nội có khoảng 245.000 con trâu bò, 1.670.000 con lợn và gần 16 triệu con gia cầm. Trung bình mỗi ngày Hà Nội tiêu thụ khoảng 500 - 600 tấn thịt gia súc, gia cầm (20% là thịt gia cầm). Trong đó Hà Nội tự sản xuất khoảng 60%, phần còn lại do các địa phương khác cung cấp hoặc nhập khẩu từ nước ngoài. Bao gồm: gia súc, gia cầm sống, thân thịt gia súc, gia cầm sau khi giết mổ và thịt mảnh các loại. Vì vậy, thị trường thực phẩm tươi sống có nguồn gốc động vật ở Hà Nội rất phong phú đa dạng. 3.1.1 Thực trạng công tác kiểm soát giết mổ tại các điểm giết mổ gia súc, gia cầm trên địa bàn Hà Nội Thành phố Hà Nội đã xây dựng được 14 cơ sở giết mổ gia súc, gia cầm tập trung. Tuy nhiên cho đến nay đã có nhiều cơ sở giết mổ không còn hoạt động, một số chỉ hoạt động cầm chừng, hoặc có cơ sở giết mổ lợn công nghiệp nhưng lại tổ chức giết mổ thủ công khoảng 10 con lợn/ngày để cung cấp cho các siêu thị, bếp ăn tập thể. Hiện nay, thành phố Hà Nội có 04 cơ sở giết mổ gia súc tập trung công suất 50 - 700 con/ngày: cơ sở giết mổ lợn lớn nhất là cơ sở giết mổ gia súc Minh Hiền - Thanh Oai, cơ sở giết mổ thủ công 58 Trung Văn - Từ Liêm, cơ sở giết mổ thủ công Thụy Phương - Từ Liêm và cơ sở giết mổ Foodex - Đan Phượng. Các cơ sở giết mổ này về cơ bản đảm bảo các điều kiện vệ sinh thú y, được bố trí sắp xếp thành các khu riêng biệt, có khu xử lý thịt và phụ phẩm không đạt tiêu chuẩn vệ sinh thú y, có hệ thống xử lý chất thải và đều có cán bộ thú y thực hiện kiểm tra, kiểm dịch. Ngoài ra có 3.725 điểm, hộ giết mổ gia súc, gia cầm (theo thống kê của Sở Công thương Hà Nội) hầu hết phân tán rải rác ở các huyện ngoại thành, chủ yếu phục vụ nhu cầu tiêu thụ tại chỗ. Các điểm, hộ giết mổ nhỏ lẻ hoạt động giết mổ rất đa dạng, một số chủ giết mổ hoạt động theo mùa vụ nên việc kiểm tra, kiểm soát gặp nhiều khó khăn, không đảm bảo các điều kiện vệ sinh theo quy định. Do địa bàn quản lý rộng, các điểm, hộ giết mổ gia súc, gia cầm nhỏ lẻ ở các huyện ngoại thành chiếm 50% số lượng sản phẩm gia súc, gia cầm trên địa bàn Hà Nội. Vì vậy, việc quản lý giết mổ gặp nhiều khó khăn, không kiểm soát được. Nguồn thực phẩm này không đảm bảo các điều kiện vệ sinh thú y, an toàn thực phẩm, không được cơ quan thú y kiểm soát theo quy định nhưng lại là nguồn cung cấp chính thực phẩm cho thành phố Hà Nội. Số lượng các điểm giết mổ gia súc, gia cầm trên địa bàn Hà Nội được trình bày ở bảng 3.1. Tổng số điểm giết mổ gia súc, gia cầm của 22 quận, huyện trên địa bàn thành phố Hà Nội mà cơ quan thú y kiểm soát được là 467 điểm. Trong đó 89 điểm giết mổ trâu bò, 199 điểm giết mổ lợn và 179 điểm giết mổ gia cầm. Huyện Thường Tín có số điểm giết mổ nhiều nhất 111 điểm, chủ yếu là điểm giết mổ gia cầm 102 điểm, 2 điểm giết mổ trâu, bò và 7 điểm giết mổ lợn. Tiếp theo là huyện Mỹ Đức có 65 điểm, trong đó 41 điểm giết mổ lợn, 12 điểm giết mổ trâu, bò và 12 điểm giết mổ gia cầm. Quận Tây Hồ có số điểm giết mổ ít nhất, chỉ có 2 điểm giết mổ lợn. Huyện Thạch Thất có số 59 Bản 3.1. Số l ợn các điểm iết mổ i súc, i cầm trên đị bàn à ội TT Quận, uyện ối t ợn iết mổ ổn số điểm iết mổ Lợn Trâu, bò i cầm 1 Ba Vì 2 4 6 2 Chương Mỹ 5 1 3 9 3 Đan Phượng 4 4 4 Đông Anh 4 9 2 15 5 Gia lâm 2 3 3 8 6 Hà Đông 3 1 4 7 Hoàng Mai 4 4 8 Hoài Đức 1 4 1 6 9 Mê Linh 21 5 3 29 10 Mỹ Đức 41 12 12 65 11 Phú Xuyên 33 1 34 12 Phúc Thọ 23 3 8 34 13 Quốc Oai 3 3 14 Sóc Sơn 3 1 4 15 Sơn Tây 6 6 16 Tây Hồ 2 2 17 Thanh Oai 2 24 26 18 Thạch Thất 59 1 3 63 19 Thanh Trì 10 10 20 Thường Tín 7 2 102 111 21 Từ Liêm 9 9 22 Ứng Hòa 15 15 ổn số 199 89 179 467 (Nguồn: Chi cục Thú y Hà Nội) 60 điểm giết mổ lợn nhiều nhất là 59 điểm. Các huyện Phú Xuyên, Quốc Oai, Sóc Sơn, Thanh Oai, Ứng Hòa và quận Hoàng Mai không có điểm giết mổ lợn. Huyện Phú Xuyên có số điểm giết mổ trâu, bò nhiều nhất là 33 điểm. Các huyện Đan Phượng, thị trấn Sơn Tây, Thanh Trì, Từ Liêm, Ứng Hòa, quận Hà Đông và Tây Hồ không có điểm giết mổ trâu bò. Huyện Thường Tín có số điểm giết mổ gia cầm nhiều nhất là 102 điểm. Các huyện Ba Vì, Đan Phượng, Quốc Oai, Sơn Tây, Thanh Trì, Từ Liêm, Ứng Hòa, quận Hoàng Mai, quận Tây Hồ không có điểm giết mổ gia cầm. 3.1.2 Kết quả điều tra điều kiện giết mổ và phương tiện vận chuyển của các điểm giết mổ trên địa bàn Hà Nội - Về điều kiện giết mổ Hầu hết các điểm giết mổ gia súc, gia cầm này đều không được phân thành từng khu riêng biệt. Đa số các điểm giết mổ là của tư nhân nên việc xây dựng rất đơn giản. Có nhiều điểm cải tạo phần bếp hay nhà ở của gia đình làm nơi giết mổ hoặc lợi dụng phần sân giếng, sàn nhà, làm bàn giết mổ. Với các điểm giết mổ gia cầm còn được thực hiện ngay trên nền chợ hoặc vỉa hè, vì thế không tuân thủ đầy đủ các quy định về điều kiện vệ sinh thú y đối với điểm giết mổ. Nền, sàn nơi giết mổ không được cọ rửa vệ sinh thường xuyên, nếu có chỉ làm qua loa. Đây là nơi trú ẩn, lưu cữu nhiều loại vi sinh vật gây bệnh cho con người, vật nuôi làm cho thân thịt bị nhiễm bẩn. Khả năng thoát nước không đạt yêu cầu, không có hệ thống bể lắng và xử lý nước thải trước khi đưa vào hệ thống thoát nước công cộng. Tường bao không có hoặc nếu có lại không được ốp lát mà chỉ trát bằng vôi vữa thông thường. Các khâu giết mổ: tháo tiết, cạo lông, làm lòng, pha lóc và phân loại thịt đều tiến hành chung trên cùng diện tích, giết mổ trên sàn nền xi măng. Các công đoạn giết mổ chồng chéo lên nhau. Do hầu hết tại các điểm giết mổ 61 không phân thành khu riêng nên thân thịt, phủ tạng và chất thải đều để chung lẫn nhau. Giết mổ trong một môi trường không vệ sinh là điều kiện thuận lợi cho các vi khuẩn có ở môi trường hay trong đường tiêu hoá gia súc, gia cầm xâm nhập vào thịt gây ô nhiễm thịt, từ đó gây ngộ độc thực phẩm cho người tiêu dùng. Một số điểm giết mổ gia súc, gia cầm khi nhập gia cầm, gia súc về không kiểm tra xem chúng có bị mắc hoặc nghi mắc bệnh truyền nhiễm, đem giết mổ ngay. Đây là nguyên nhân làm mầm bệnh có điều kiện phân tán, lây lan sang vật nuôi và có thể lây sang con người. Kết quả cụ thể được trình bày bảng 3.2 Trong 467 điểm giết mổ chỉ có 02 điểm giết mổ lợn và 02 điểm giết mổ gia cầm được phân thành khu riêng biệt, chiếm tỷ lệ 0,9%. Có 04 điểm giết mổ lợn và 05 điểm giết mổ gia cầm được giết mổ trên bàn hoặc bệ xi măng, chiếm tỷ lệ 1,9%. 02 điểm giết mổ lợn có khu khám thân thịt và phủ tạng riêng biệt chiếm tỷ lệ 0,4%. Các điểm giết mổ gia súc, gia cầm chủ yếu là giết mổ trên sàn nhà, 191 điểm giết mổ lợn, 89 điểm giết mổ trâu, bò và 172 điểm giết mổ gia cầm, chiếm tỷ lệ 96,8%. Về vệ sinh tiêu độc nhà xưởng, trang thiết bị, dụng cụ giết mổ trước và sau khi giết mổ cũng như việc vệ sinh tiêu độc định kỳ có ý nghĩa rất quan trọng trong khâu vệ sinh giết mổ nhằm tiêu diệt các vi sinh vật gây ô nhiễm lưu trú trên nền, sàn, bàn bệ và các vật dụng khác. Thực trạng hiện nay hầu hết các điểm giết mổ trên địa bàn Hà Nội đều không quan tâm đến vệ sinh tiêu độc. 62 Bảng 3.2: Kết quả điều tr điều iện điểm iết mổ và ph ơn tiện vận chuyển củ các điểm iết mổ trên đị bàn à ội TT ối t ợn iết mổ Số l ợn các điểm iết mổ iều iện điểm iết mổ h ơn tiện vận chuyển ợc phân thành khu riên biệt iết mổ trên bàn, bệ iết mổ trên sàn nhà Có khu khám thân thịt, phủ tạn Ôtô Xe máy Bao gói hi vận chuyển 1 Lợn 199 02 04 191 02 20 179 0 2 Trâu, bò 89 0 0 89 0 05 84 0 3 Gia cầm 179 02 05 172 0 15 164 0 ổn 467 04 09 452 02 40 427 0 ỷ lệ % 0,9 1,9 96,8 0,4 8,6 91,4 0 63 - Về phương tiện vận chuyển Điều tra 467 điểm giết mổ gia súc, gia cầm. Chúng tôi thấy vận chuyển bằng ô tô có 40 điểm, chiếm tỷ lệ 8,6%; trong đó có 20 điểm giết mổ lợn, 05 điểm giết mổ trâu, bò và 15 điểm giết mổ gia cầm. Phương tiện vận chuyển chủ yếu bằng xe máy, có 427 điểm, chiếm tỷ lệ 91,4%; trong đó 179 điểm giết mổ lợn, 84 điểm giết mổ trâu, bò và 164 điểm giết mổ gia cầm. Tất cả các điểm giết mổ đều không bao gói thân thịt khi vận chuyển tới nơi tiêu thụ. Đối với các cơ sở giết mổ gia cầm: gia cầm sống được nhốt trong các lồng sắt hoặc lồng tre chật chội và vận chuyển đến nơi giết mổ bằng xe máy. Sau khi giết mổ, tất cả các điểm giết mổ đều sử dụng xe máy để vận chuyển thân thịt, phủ tạng đến nơi bày bán. Các thân thịt này đều không được bao gói trong khi vận chuyển, chúng thường được đựng trong các lồng sắt, làn mây, làn tre, bao tải dứa,... Riêng đối với thân thịt lợn sau khi giết mổ xong thường không được đựng trong dụng cụ chuyên biệt mà được để trực tiếp lên khung xe hoặc yên xe để vận chuyển đến nơi bày bán. Các phương tiện vận chuyển thịt, gia súc và gia cầm sống ở các điểm giết mổ trên thường không phải là các phương tiện vận chuyển chuyên dụng, chúng có thể được sử dụng với nhiều mục đích khác nhau không đảm bảo vệ sinh theo quy định của Pháp lệnh thú y. Vì thế thịt và các sản phẩm từ thịt có thể bị ô nhiễm trong quá trình vận chuyển hoặc ô nhiễm từ các phương tiện này. Việc vận chuyển gia súc, gia cầm sống như trên cũng là nguyên nhân làm lây lan dịch bệnh, gieo rắc mầm bệnh ra môi trường xung quanh và gây ô nhiễm môi trường. Trang thiết bị phục vụ trong quá trình giết mổ: tại 467 điểm giết mổ chúng tôi điều tra đều giết mổ theo lối thủ công với các dụng cụ đơn giản như dao, xô, chậu, cân, móc, rổ, rá, bao tải dứa, túi nilon,... Các dụng cụ này có 64 thể được sử dụng từ ngày này sang ngày khác, việc đánh rửa, vệ sinh ít được quan tâm. Không đảm bảo yêu cầu vệ sinh cũng là nguồn gây ô nhiễm vào thân thịt. 3.1.3 Thực trạng vệ sinh tại khu giết mổ gia súc, gia cầm trên địa bàn Hà Nội Qua điều tra hoạt động giết mổ trên địa bàn Hà Nội cho thấy thực trạng vệ sinh tại khu giết mổ gia súc, gia cầm như sau: - Đối với nước sử dụng trong quá trình giết mổ Như đã biết nước sử dụng trong giết mổ là một trong những yếu tố quan trọng ảnh hưởng lớn đến chất lượng vệ sinh của thịt. Số liệu trong bảng 3.3 cho thấy nguồn nước sử dụng trong giết mổ ở các điểm giết mổ lợn, trâu, bò, gia cầm chủ yếu là nước giếng khoan chưa qua xử lý. Có tới 309 điểm trong tổng số 467 điểm giết mổ sử dụng nước giếng khoan, chiếm tỷ lệ 66,2%. Cụ thể 141 điểm giết mổ lợn, 62 điểm giết mổ trâu, bò và 106 điểm giết mổ gia cầm sử dụng nước giếng khoan. Chỉ có 158 điểm có sử dụng nước máy (đạt tiêu chuẩn vệ sinh), chiếm tỷ lệ 33,8%. Trong đó, có 58 điểm giết mổ lợn, 27 điểm giết mổ trâu, bò và 73 điểm giết mổ gia cầm. Không có điểm giết mổ nào dùng nguồn nước giếng khơi. Trong quá trình điều tra chúng tôi thấy hầu hết các hộ đều sử dụng bể chứa nước nằm trong khu giết mổ. Nước được đựng trong các thùng, xô, chậu,... tận dụng, có thể sử dụng vào nhiều mục đích khác nhau trong sinh hoạt gia đình. Sau đó những dụng cụ này lại được dùng để đựng nước phục vụ cho các công đoạn của quá trình giết mổ như dội rửa khi cạo lông (vặt lông), mổ thịt hay làm lòng,... Chính việc làm này đã tạo điều kiện cho các loại vi khuẩn từ môi trường, lông, da, phân của gia súc xâm nhập vào thân thịt qua nguồn nước gây nhiễm vi khuẩn vào thân thịt, ảnh hưởng lớn đến sức khoẻ người tiêu dùng. 65 - Về việc xử lý chất thải tại các điểm giết mổ Các chất thải rắn ở các điểm giết mổ thường là phân, lông, các chất chứa trong dạ dày, diều, bạc nhạc, xương, gân, thịt vụn, một số phần bỏ đi của cơ quan nội tạng,... Các chất thải lỏng ở các điểm giết mổ thường là cặn hữu cơ, mỡ, máu, nước bọt, dịch tiết các tuyến,... Đi kèm với các chất thải rắn và chất thải lỏng ở các điểm giết mổ này bao gồm rất nhiều tập đoàn vi khuẩn yếm khí, hiếu khí, trứng giun sán các loại và thậm chí còn có rất nhiều loại vi khuẩn có khả năng gây bệnh cho người và gia súc. Nếu không qua xử lý thì nó là nguồn gây

Các file đính kèm theo tài liệu này:

  • pdfvsvhty_la_nguyen_thi_thanh_thuy_4464_2005318.pdf
Tài liệu liên quan