Luận văn Nghiên cứu biểu hiện peptit kháng nguyên từ protein vỏ của virut viêm não nhật bản làm tiền đề để sản xuất văcxin dùng qua đường miệng

MỤC LỤC

LỜI CAM ĐOAN

LỜI CẢM ƠN

DANH MỤC CHỮ VIẾT TẮT

DANH MỤC CÁC BẢNG

DANH MỤC CÁC HÌNH

MỞ ĐẦU . .

Chương 1 TỔNG QUAN TÀI LIỆU . .

1.1 Bệnh viêm não Nhật Bản . .

1.1.1 Nguồn gốc bệnh viêm não Nhật Bản.

1.1.2 Nguồn lây truyền bệnh . .

1.1.3 Đặc điểm biểu hiện của bệnh: . .

1.2 Virut viêm não Nhật Bản (virut VNNB) .

1.2.1. Đặc điểm hình thái và tính chất lý hoá của virut VNNB

1.2.2. Sự nhân bản của virut . .

1.2.3. Cấu trúc của virut VNNB . .

1.2.4. Khả năng gây đáp ứng miễn dịch của đoạn peptit kháng

nguyên 27 axit amin của virut VNNB . .

1.3 Các loại văcxin phòng bệnh VNNB . .

1.3.1 Văcxin bất hoạt sản xuất từ não chuột.

1.3.2 Văcxin VNNB bất hoạt sản xuất từ tế bào.

1.3.3 Văcxin sống giảm độc lực . .

1.3.4 Nghiên cứu phát triển văcxin mới.

Chương 2 VẬT LIỆU VÀ PHưƠNG PHÁP NGHIÊN CỨU.

2.1 Vật liệu . .

2.1.1. Vật liệu thực vật . .

2.1.2. Vật liệu sinh học phân tử . .

2.1.2.1. Mồi. .

2.1.2.2. Plasmid . .

2.1.2.3 Các chủng vi sinh vật và các nguyên liệu dùng trong thí nghiệm. .

2.1.2.4 Các loại máy móc . .

2.1.3 Hoá chất . .

2.1.4 Các môi trường nuôi cấy và các dung dịch.

2.2 Phương pháp nghiên cứu . .

2.2.1. Nhân đoạn 27 aa và LTB bằng PCR.

2.2.2 Phương pháp PCR từ khuẩn lạc (colony PCR).

2.2.3 Thiết kế vector pET21_27aa_LTB biểu hiện đoạn peptit kháng nguyên trong E.coli . .

2.2.4. Biểu hiện đoạn peptit kháng nguyên trong E.coli

2.2.5. Thiết kế vector pCB_27aa_LTB biểu hiện đoạn peptit kháng

nguyên trong tế bào thực vật . .

2.2.6. Biểu hiện đoạn peptit kháng nguyên trong tế bào thực vật

2.2.7. Kiểm tra biểu hiện của protein tái tổ hợp.

Chương 3 KẾT QUẢ VÀ THẢO LUẬN . .

3.1 Nhân đoạn gen 27 aa . .

3.2 Nhân gen LTB và nối với gen 27 aa . .

3.3 Thiết kế vector biểu hiện gen 27 aa_LTB trong E.coli.

3.4 Biểu hiện protein tái tổ hợp trong E.coli BL21.

3.4.1 Biến nạp vector tái tổ hợp vào chủng vi khuẩn E.coli BL21

3.4.2 Biểu hiện gen 27aa_LTB trong E.coli BL21.

3.5. Biểu hiện tạm thời gen 27aa_LTB trong thực vật.

3.5.1 Thiết kế vector biểu hiện gen 27aa_LTB trong thực vật

3.5.2 Lai đoạn 27aa_LTB_cmyc_KDEL với vector chuyển gen pCB301 . .

3.5.3 Biến nạp vào A. tumefaciens. .

3.5.4 Biểu hiện tạm thời gen 27aa_LTB trong cây thuốc lá

KẾT LUẬN . .

KIẾN NGHỊ . .

TÀI LIỆU THAM KHẢO . .

PHỤ LỤC

pdf62 trang | Chia sẻ: maiphuongdc | Lượt xem: 1959 | Lượt tải: 2download
Bạn đang xem trước 20 trang tài liệu Luận văn Nghiên cứu biểu hiện peptit kháng nguyên từ protein vỏ của virut viêm não nhật bản làm tiền đề để sản xuất văcxin dùng qua đường miệng, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
n (từ axit amin 373 đến 399). Theo những nghiên cứu cho thấy đoạn 27 axit amin này có thể kéo dài và tăng cường khả năng tạo ra kháng thể trung hoà chống lại virut VNNB. Hình 1.2: Sơ đồ vị trí đoạn 27 axit amin trên protein E Một nghiên cứu gần đây của một nhóm tác giả người Trung Quốc đã tiến hành khi gắn nối đoạn gen mã hoá cho đoạn 27 axit amin này với protein sốc nhiệt Hsp70. Sau đó biểu hiện trong E.Coli đoạn 27 axit amin riêng lẻ và đoạn 27 axit amin đã gắn với Hsp70, protein biểu hiện được thu lại và tiêm vào chuột. Kết quả cho thấy khả năng sinh kháng thể của đoạn 27 axit amin khi gắn với Hsp70 cao hơn so với đoạn peptit 27 axit amin riêng rẽ [10]. Hình 1.3 so sánh về khả năng sản sinh ra các tế bào lympho từ chuột được gây miễn dịch bởi các peptit 27 aa có hoặc không có dầu khoáng, peptit 27 aa dung hợp với hsp70 và JEV SA14-14-2. 27aa Protein E Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 11 Peptit 27 aa dung hợp với hsp70 tổng hợp có giá trị OD 570 cao nhất, trong khi sự có mặt của dầu khoáng không có hiệu quả đặc biệt. Không có sự khác biệt lớn giữa xử lý văcxin JEV SA 14-14-2 với kiểm soát không miễn dịch [10]. Mặt khác tính miễn dịch của chuột bởi đoạn 27 aa với hsp70 cũng được thể hiện bằng khả năng sản sinh ra lượng IFN-γ (hình 1.4) Nồng độ IFN-γ được tạo ra cao hơn hẳn so với ở các đối tượng kháng nguyên khác cho thấy việc gắn kết giữa đoạn peptit 27 aa với hsp70 đã làm gia tăng khả năng gây đáp ứng miễn dịch [10]. Điều này suy ra rằng cũng có Hình 1.4. Khả năng sản sinh ra IFN-γ và IL-4 1: Peptit 27 aa riêng lẻ 2: Peptit 27 aa có dầu khoáng 3: Peptit 27 aa dung hợp với hsp70 4: JEV SA14-14-2 5: Không miễn dịch 1 2 3 4 5 1: Peptit 27 aa riêng lẻ 2: Peptit 27 aa có dầu khoáng 3: Peptit 27 aa dung hợp với hsp70 4: JEV SA14-14-2 5: Không miễn dịch Hình 1.3. Khả năng sinh ra tế bào lympho từ các kháng nguyên khác nhau Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 12 thể gắn kết đoạn peptit 27 aa này với một gen nào đó có ưu điểm như hsp70 cũng sẽ hứa hẹn mang lại hiệu quả đáp ứng miễn dịch cao. 1.3 Các loại văcxin phòng bệnh VNNB Từ những năm 1935 cho đến nay đã có rất nhiều công trình nghiên cứu sản xuất văcxin VNNB. Theo thời gian thì công nghệ sản xuất văcxin cũng dần nâng cao và đảm bảo sản xuất ra những loại văcxin tốt nhất. Tuy nhiên không thể nói rằng những văcxin đó không có những nhược điểm. Với mỗi loại văcxin khác nhau thì có những ưu nhược điểm khác nhau. Hiện tại có 3 loại văcxin đang được lưu hành là: Văcxin bất hoạt sản xuất từ não chuột, văcxin bất hoạt trên nuôi cấy tế bào, văcxin sống giảm độc lực trên nuôi cấy tế bào 1.3.1 Văcxin bất hoạt sản xuất từ não chuột Những năm 1940 khi bắt đầu nghiên cứu sản xuất văcxin này ở dạng thô, văcxin này chứa toàn bộ protein não chuột và hàm lượng Myelin rất cao do đó tỷ lệ gây viêm não dị ứng cũng cao. Ngày nay công nghệ tinh chế hiện đại hơn đã làm giảm tối đa protein Myelin (<2ng/ml) và 2 chủng virut VNNB dùng để sử dụng sản xuất văcxin này là Nakayama và Beijing-1. Loại văcxin bất hoạt này được sản xuất ở một số nước Châu Á và được lưu hành rộng dãi trên thế giới [11]. 1.3.2 Văcxin VNNB bất hoạt sản xuất từ tế bào Chủng virut VNNB P3 có khả năng đáp ứng kháng thể với nhiều chủng virut viêm não khác trên chuột và nhân lên rất tốt trên tế bào thận tiên phát ở chuột. Văcxin được bất hoạt bằng formalin và hiệu quả gây miễn dịch cho trẻ em đạt 80% đáp ứng kháng thể. 1.3.3 Văcxin sống giảm độc lực Chủng SA14-14-2 là chủng giảm độc lực và không gây ảnh hưởng thần kinh. Qua thử nghiệm tại 1 vùng không lưu hành dịch ở Trung Quốc cho thấy Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 13 có tới hơn 83% đáp ứng kháng thể ở trẻ em 6-7 tuổi. Trẻ lớn hơn tiêm 2 liều cách nhau 1-3 tháng đạt 94-100% có đáp ứng miễn dịch. Phản ứng phụ của văcxin là rất ít gặp phải [19] [51]. 1.3.4 Nghiên cứu phát triển văcxin mới Hiện nay có nhiều nghiên cứu và phát triển theo hướng công nghệ văcxin tái tổ hợp. Dựa trên những hiểu biết chi tiết về vai trò và cấu trúc của glycoprotein E và preM/M nên nhiều nhà khoa học đã nghiên cứu và tìm ra nhiều loại văcxin thế hệ mới như: văcxin protein, văcxin dựa trên virut tái tổ hợp, văcxin DNA… Và gần đây văcxin thực vật là một hướng đi mới mang nhiều hứa hẹn cho một loại văcxin với nhiều ưu điểm nổi bật: a) Có tính ổn định cao: Vì các kháng nguyên biểu hiện được sản xuất và bao bọc bởi các mô thực vật nên chúng có thể ổn định ngay ở nhiệt độ phòng. Những kháng nguyên này được định vị ở trong lưới nội chất, thể golgi hay bề mặt tế bào, đây là những vị trí lý tưởng cho các việc biểu hiện kháng nguyên. b) Có thể dễ dàng tăng quy mô sản xuất và dễ thu sinh khối, chẳng hạn ta có thể mở rộng diện tích trồng cây chuyển gen để tăng sản lượng. c) Dễ dàng sử dụng và bảo quản: Văcxin thực vật không cẩn giữ lạnh như các văcxin tiêm khác. Thông thường, ngay sau khi tinh sạch, văcxin tiêm được đông khô và vận chuyển từ nơi sản xuất đến nơi tiêu thụ thông qua một hệ thống bảo quản lạnh ở quy mô quốc tế, quốc gia và khu vực hết sức phức tạp và tốn kém. Nhưng nếu sản xuất văcxin ăn được, người ta chỉ cần vận chuyển và sử dụng ngay bộ phận thực vật chứa văcxin đó. c) Ăn được: Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 14 Vì văcxin thực vật nằm trong những bộ phận của thực vật như lá, quả…Do vậy ta có thể ăn được một cách dễ dàng. Nếu văcxin dùng qua đường miệng mà ở dạng được bao gói nó sẽ dễ dàng bị dịch tiêu hoá của đường ruột phân huỷ. Văcxin này có thể ăn tươi (quả, lá) hoặc nấu chín (hạt, củ). Xử lý nhiệt có tính khả thi khi kháng nguyên không biến tính ở nhiệt độ cao, ví dụ nấu chín khoai tây chứa văcxin trong 3 phút làm giảm 50% thành phần văcxin đó d) An toàn cho người và động vật: Văcxin dưới đơn vị sử dụng gen mã hoá cho một phần protein vỏ virut mà không cần đến virut sống như văcxin giảm độc lực hay virut chết như văcxin bất hoạt. Do đó, văcxin này không trở lại thành virut gây bệnh cho người và động vật, đồng thời nó cũng tránh được nguy cơ nhiễm mầm bệnh tiềm tàng từ văcxin như hệ thống động vật có vú. Nhiều sinh vật gây bệnh chưa biết ở động vật không thể phát hiện được trong dịch nuôi cấy dễ dàng truyền cho người và động vật, trong khi các bệnh thực vật không lây nhiễm được như vậy. Do đó, không cần phải tách chiết và tinh sạch kháng nguyên văcxin. e) Kích thích sản xuất kháng thể của hệ thống thể dịch hiệu quả hơn văcxin tiêm. Các vi sinh vật gây bệnh đều xâm nhập vào cơ thể qua bề mặt nhầy trong đường tiêu hoá, hô hấp và đường tiết niệu. Những con đường này đều thuộc hệ thống miễn dịch thể dịch, nơi tập trung những mô có khả năng đáp ứng miễn dịch lớn nhất của cơ thể và là hàng rào bảo vệ đầu tiên chống lại những vi sinh vật đó. Đây cũng chính là vị trí tác động hiệu quả nhất của các văcxin ăn được từ thực vật. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 15 Hình 1.5: Khả năng gây đáp ứng miễn dịch của văcxin thực vật Khi văcxin này vào cơ thể qua đường miệng sẽ cảm ứng hệ thống miễn dịch thể dịch sản xuất các kháng thể chống lại sinh vật gây bệnh, tiếp đó hệ thống thể dịch lại tác động vào hệ thống miễn dịch tế bào, tạo ra các globulin miễn dịch, tăng cường khả năng bảo vệ sớm và hiệu quả cho cơ thể. Khi tiêu hoá văcxin ăn được, kháng nguyên được giải phóng trong ruột non [1]. Việc sản xuất văcxin ăn được xem là hệ thống sản xuất văcxin lý tưởng đơn giản và giá thành thấp. Nhiều thành công khác về văcxin thực vật cũng đựoc công bố trên nhiều loài cây khác nhau như thuốc lá, rau diếp, cà chua, khoai tây…Số lượng nghiên cứu về văcxin ăn được đựơc gia tăng đã chứng tỏ tính ưu việt của thực vật như một hệ thống biểu hiện hiệu quả cao, chi phí sản xuất thấp, an toàn về mặt sinh học, sử dụng và bảo quản dể dàng không cần giữ lạnh. 1.4 Gen LTB (labile enterotoxin-B) Nói tới văcxin thực vật thì không thể không nói tới một gen quan trọng thích hợp với việc biểu hiện protein và có khả năng kích thích sinh miễn dịch Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 16 trong thực vật, đó là gen LTB. Gen LTB là tiểu đơn vị liên kết nội độc tố không bền nhiệt của E.Coli một loại vi khuẩn gây bệnh tiêu chảy ở nhiều quốc gia đang phát triển do hệ thống y tế cộng đồng còn thô sơ, điều kiện vệ sinh kém, nguồn nước uống chưa đảm bảo. Cấu trúc của LT bao gồm 1 tiểu đơn vị A (LTA) và 5 tiểu đơn vị B (LTB) tạo thành một pentamer dạng vòng. LTB là một chất có khả năng sinh miễn dịch ở niêm mạc ruột và một số nghiên cứu trên động vật mô hình và một thử nghiệm trên người cho thấy LTB tái tổ hợp có thể kích thích các đáp ứng miễn dịch niêm mạc. Vì thế, LTB là một ứng viên kháng nguyên đầy hứa hẹn trong sản xuất văcxin thực vật. Bên cạnh đó, LTB còn đề kháng tốt với sự thủy phân protein ở dạ dày và duy trì được một cấu trúc bậc 4 pentamer của nó trong môi trường pH thấp bằng 2.0. Đây là bằng chứng bổ sung cho LTB như là một ứng viên kháng nguyên được dùng cho văcxin sản xuất trong thực vật [22] [23] [24]. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 17 Chƣơng 2 VẬT LIỆU VÀ PHƢƠNG PHÁP NGHIÊN CỨU 2.1 Vật liệu 2.1.1. Vật liệu thực vật Giống thuốc lá SNN (Nicotiana tabaccum L.) do Viện Nghiên cứu Di truyền thực vật IPK, Gatersleben (CHLB Đức) cung cấp, được trồng trong điều kiện tự nhiên. 2.1.2. Vật liệu sinh học phân tử 2.1.2.1. Mồi Tên mồi Trình tự mồi Chức năng Hãng sản xuất 5’_27aa AGCTTTGTGCCAATGGTGATTAATCT GTTTATCTCCTCTTCCAACAACAATA Dùng để tổng hợp đoạn gen 27aa Bioneer 3’_27aa GATATGGAACCACCATTCGGAGATTC ATATATTGTTGTTGGAAGAGGAGAT 5’_LTB GGATCCGATATGGAACCACCA Dùng để tổng hợp gen LTB Bioneer 3’_LTB GCGGCCGCGTTCTCCATGCTGATG Bảng 1: Mồi nhân gen 27 aa và gen LTB 2.1.2.2. Plasmid Vector Kháng sinh chọn lọc Vai trò Nguồn gốc pBT Amp, Carbe Tách dòng và đọc trình tự Phòng CNTBTV, Viện CNSH, Việt Nam pTRA Amp Cung cấp đoạn biểu hiện cmyc và KDEL trong cây Gatersleben, Đức Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 18 pCB301 Kana Cung cấp promoter 35S và terminator thích hợp cho chuyển gen thực vật Gatersleben, Đức pET 21a(+) Amp Biểu hiện protein trong E.Coli Novagen, Mỹ pBT_LTB Kana Mang đoạn LTB Phòng CNTBTV, Viện CNSH, Việt Nam pPNT289_Gus Spec Mang gen Gus Phòng CNTBTV, Viện CNSH, Việt Nam Bảng 2: Các loại plasmid dùng trong thí nghiệm 2.1.2.3 Các chủng vi sinh vật và các nguyên liệu dùng trong thí nghiệm - E.Coli DH5α [end A1 recA1 hsdR17 supE44gypA96 thi-1relA1lac U169(Ø80 lacZM15)] được sử dụng trong các thí nghiệm nhân dòng các plasmid. - E.Coli BL21 [E omp hsd SB(rBmB)gal dcm (DE3) plysS(Caml)] sử dụng cho nghiên cứu biểu hiện protein tái tổ hợp. - Chủng A. Tumefaciens CV58C1 mang plasmid pGV 2260 được sử dụng làm trung gian truyền các cấu trúc chuyển gen vào thực vật . 2.1.2.4 Các loại máy móc Các loại máy sử dụng tại phòng Công nghệ tế bào Thực vật và Phòng Thí nghiệm trọng điểm Công nghệ gen (Viện Công nghệ Sinh học) bao gồm: Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 19 Tên máy Hãng sản xuất Máy ly tâm eppendorf Mikro Máy ly tâm lượng lớn Sorwall LEGENND LT (Mỹ) Máy điện di ADN Hoefl (Mỹ) Máy điện di protein Bio Rad (Mỹ) Máy đo pH Memmerl (Đức) Máy lắc Metler (Thuỵ Sĩ) Máy ổn nhiệt OSI (Pháp) Máy PCR MJ Reasach (Mỹ) Bảng 3: Máy móc dùng trong thí nghiệm 2.1.3 Hoá chất Tên hoá chất Hãng sản xuất Bộ hoá chất dùng cho phản ứng PCR BioLabs, Fermentas (Mỹ) Các enzyme cắt hạn chế, enzyme T4ligase, RNase, Marker 1Kb, Marker 100bp, Prestained protein ladder BioLabs, Fermentas (Mỹ) EDTA, SDS, MgCl2, TEMED, APS, BSA, HEPES, MES, X-Gluc Sigma (Mỹ) Bộ kit thôi gel và tinh sạch DNA Bioneer Comassie Blue stainning solution Fermentas Các loại kháng sinh Amp, Kana, Carbe, Rifa Duchefa (Hà Lan) Bảng 4: Hóa chất dùng trong thí nghiệm Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 20 2.1.4 Các môi trƣờng nuôi cấy và các dung dịch Môi truờng nuôi cấy vi khuẩn LB, YEB được chuẩn bị dựa theo phương pháp Sambrook (1989). Một số loại môi trường đặc biệt khác được chuẩn bị theo công thức ở phần phụ lục. 2.2 Phƣơng pháp nghiên cứu 2.2.1. Nhân đoạn 27 aa và LTB bằng PCR Hình 2.1. Sơ đồ quá trình gắn nối đoạn gen 27 aa với gen LTB Phương pháp PCR được sử dụng để nhân những đoạn gen mong muốn với cặp mồi đặc hiệu. Mồi đặc hiệu được thiết kế dựa trên trình tự protein vỏ của JEV đã công bố trên ngân hàng gen và trình tự đoạn LTB do TS. Lê Văn Sơn (Viện Công nghệ Sinh học, Việt Nam) cung cấp. Mồi 3’_27aa được gắn thêm 10 nucleotide đầu 5’ thuộc trình tự đoạn LTB và mồi 5’_LTB gắn thêm 10 nucleotide đầu 3’ thuộc trình tự đoạn 27aa. Việc bổ sung thêm này tạo vị trí kéo dài cho phản ứng PCR ghép nối hai đoạn 27aa và LTB. Các sản phẩm Mồi 5’_27aa và 3’_27aa PCR 27aa PCR LTB Plasmid chứa LTB PCR nối 27aa và LTB pBT Lai Cắt bằng enzyme BamHI và NotI 27aa_LTB 27aa_LTB/BamHI/NotI pBT_27aa_LTB Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 21 PCR tạo thành được điện di trên gel agarose 1% trong đệm 1X TAE, nhuộm gel trong dung dịch Ethidium bromide và thôi gel bằng bộ Kit của Qiagen. Thành phần PCR (thể tích 50µl) và chu trình nhiệt nhân đoạn 27aa với 35 chu kỳ như sau: 10X buffer: 5µl dNTP (10mM): 4µl MgCl2 (15mM): 3µl 5’_27aa(10pM): 2µl 3’_27aa(10pM): 2µl Taq polymerase (5unit/µl): 0,5µl H2O: 33,5 µl Thành phần PCR (thể tích 50µl) và chu trình nhiệt nhân đoạn LTB với 35 chu kỳ như sau: pBT_LTB (1:10): 1 µl 10X buffer: 5µl dNTP (10mM): 4µl MgCl2 (15mM): 3µl 5’_LTB(10pM): 2µl 3’_LTB(10pM): 2µl Taq polymerase (5unit/µl): 0,5µl H2O: 33,5 µl Thành phần PCR (thể tích 50µl) ghép nối đoạn 27aa và LTB gồm: Sản phẩm PCR 27aa: 1 µl Sản phẩm PCR LTB: 1 µl 10X buffer: 5µl dNTP (10mM): 4µl MgCl2 (15mM): 3µl Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 22 5’_27aa(10pM): 2µl 3’_LTB(10pM): 2µl Taq polymerase (5unit/µl): 0,5µl H2O: 33,5 µl Phản ứng ghép nối được tiến hành với chu trình nhiệt tương tự như phản ứng nhân đoạn gen LTB. 2.2.2 Phƣơng pháp PCR từ khuẩn lạc (colony PCR) Phương pháp colony PCR cho phép phát hiện nhanh khuẩn lạc mang plasmid tái tổ hợp mong muốn. Phương pháp này dựa trên nguyên tắc PCR, chỉ khác là mẫu DNA được thay bằng plasmid giải phóng từ khuẩn lạc. Ở nhiệt độ cao (94oC-95oC), màng tế bào bị phá vỡ, giải phóng plasmid tái tổ hợp. Plasmid này sẽ làm khuôn tổng hợp cho phản ứng PCR. Tuy nhiên phương pháp này có đôi chút hạn chế là có trường hợp sản phẩm biến nạp còn dính một lượng nhỏ plasmid tái tổ hợp, sẽ làm cho kết quả không còn chính xác như mong đợi. 2.2.3 Thiết kế vector pET21_27aa_LTB biểu hiện đoạn peptit kháng nguyên trong E.coli Hình 2.2. Sơ đồ thí nghiệm thiết kế vector pET21_27aa_LTB biểu hiện đoạn peptit kháng nguyên trong E.coli pET21(a+) Lai Biến nạp 27aa_LTB/BamHI/NotI BamHI NotI pET21(a+)_ 27aa_LTB Chủng E.coli DH5α Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 23 Sản phẩm PCR nối 2 đoạn 27aa và LTB là 27aa_LTB được dòng hóa trong vector pBT. Các dòng plasmid tái tổ hợp pBT_27aa_LTB được cắt kiểm tra bằng enzyme giới hạn BamHI. Dòng dương tính được xác định trình tự DNA và so sánh với trình tự đã có bằng phương pháp MegAlign ClusterW (DNAStar). Tiếp đó, vector tách dòng pBT mang đoạn 27aa_LTB được cắt bằng enzyme BamHI và NotI để thu lấy đoạn gen mong muốn, sau đó gắn vào vector pET21a (+) đã được xử lí cùng enzyme. Sản phẩm gắn kết được biến nạp vào chủng E.coli DH5α, chọn các khuẩn lạc mang vector tái tổ hợp pET21_27aa_LTB bằng phương pháp cắt enzyme giới hạn BamHI và NotI. 2.2.4. Biểu hiện đoạn peptit kháng nguyên trong E.coli Vector pET21_27aa_LTB được biến nạp vào tế bào biểu hiện E.Coli BL21 để tiến hành kiểm tra khả năng biểu hiện protein tái tổ hợp. Sau khi nuôi cấy một khuẩn lạc E.coli BL21 mang vector tái tổ hợp qua đêm trong môi trường LB lỏng có bổ sung 50mg/l Amp tại nhiệt độ 37oC, dịch huyền phù được chuyển sang môi trường mới với tỉ lệ 1/20. Nuôi cấy tế bào biểu hiện ở nhiệt độ 37oC cho tới khi dịch huyền phù có OD600nm ~0,4-0,5 thì tiến hành cảm ứng. Nhiệt độ biểu hiện protein tái tổ hợp vẫn tương tự như nhiệt độ nuôi cấy. Chất cảm ứng với hệ biểu hiện pET21a (+) là IPTG với nồng độ cuối cùng là 1mM. Sản phẩm biểu hiện được thu mỗi giờ từ trong vòng 4h. Kết quả của sản phẩm được kiểm tra bằng điện di trên gel SDS- polyacrylamide 12,5%. 2.2.5. Thiết kế vector pCB_27aa_LTB biểu hiện đoạn peptit kháng nguyên trong tế bào thực vật Sản phẩm vector pBT tái tổ hợp chứa đoạn 27aa_LTB được cắt bằng enzyme BamHI và NotI để thu lấy đoạn gen mong muốn, sau đó gắn vào vector pTRA đã được xử lí cùng enzyme. Sản phẩm gắn kết được biến nạp vào chủng E.coli DH5α, chọn các khuẩn lạc mang vector tái tổ hợp Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 24 pTRA_27aa_LTB bằng phương pháp cắt enzyme giới hạn BamHI/NotI. Đoạn gen này được gắn vào vector pTRA với mục đích là để gắn thêm vào đoạn gen 27aa_LTB đoạn cmyc và KDEL có trong vector pTRA. Sau đó các dòng vector tái tổ hợp pTRA_27aa_LTB dương tính được cắt bằng HindIII và lai với vector pCB301 cũng đã được xử lí HindIII. Sản phẩm tạo thành cũng được nhân lên trong tế bào E.coli DH5α và kiểm tra bằng cắt enzyme HindIII. Hình 2.3. Sơ đồ thí nghiệm biểu hiện tạm thời gen 27aa_LTB trong cây thuốc lá Sản phẩm cuối cùng là vector chuyển gen thực vật pCB_27aa_LTB, dưới sự điều khiển của promoter biểu hiện ở tất cả các mô thực vật CaMV 35S. 2.2.6. Biểu hiện đoạn peptit kháng nguyên trong tế bào thực vật Vector tái tổ hợp pCB_27aa_LTB được biến nạp vào A. Tumefaciens bằng phương pháp xung điện. Phương pháp này dựa trên cơ sở là sự tạo ra các pTRA Lai Cắt bằng enzyme HindIII 27aa_LTB/BamHI/NotI BamHI NotI pTRA_ 27aa_LTB_cmyc_KDEL 27aa_LTB_cmyc_KDEL/HindIII HindIII HindIII pCB pCB_35S_27aa_LTB_cmyc_KDEL Lai Chủng DH5α mang cấu trúc biểu hiện (35S_27aa_LTB_cmyc_KDEL) Biến nạp Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 25 lỗ trên màng tế bào khi có tác dụng của các điện cực lớn, làm cho các phân tử DNA đi vào tế bào theo điện trường. Tế bào khả biến A. tumefaciens CV58C1 sau khi tan đá thêm 1µl plasmid pCB_27aa_LTB và để trong đá 10 phút. Sau đó tiến hành xung điện ở mức 2,5µF, 400Ω, 25kV. Dịch khuẩn được nuôi phục hồi trong 300µl môi trường LB lỏng ở 28oC trong 2 ngày, sau đó cấy trải trên môi trường LB đặc có bổ sung Rifa (50mg/l) và Kana (50mg/l). Phản ứng PCR với cặp mồi đặc hiệu 5’_27aa và 3’_LTB được sử dụng để kiểm tra sự có mặt của plasmid tái tổ hợp trong các dòng tế bào A. tumefaciens sống sót trên môi trường chọn lọc. Đoạn peptit kháng nguyên của virut VNNB được biểu hiện tạm thời trên tế bào thực vật bằng phương pháp Agro-inflitration. Đầu tiên lấy một khuẩn lạc mang vector tái tổ hợp pCB_27aa_LTB nuôi trong 5ml LB lỏng có bổ sung Rifa (50mg/l) và Kana (50mg/l) ở 28oC. Sau đó dòng tế bào được cấy chuyển với tỉ lệ 1/50 sang môi trường LB lỏng mới có bổ sung kháng sinh tương tự trên và 10µl AS (100mM) và 1ml MES(1M), tiếp tục nuôi lắc qua đêm ở 28oC. Ly tâm 3000 rpm/ 30 phút tại 4oC thu dịch tế bào, sau đó rửa lại tế bào với nước cất vô trùng. Tế bào A. tumefaciens cuối cùng được hòa tan trong dung dịch có chứa: AS, MgCl2, MES với nồng độ cuối cùng tương ứng là 100µM, 10Mm và 10mM. Dịch huyền phù được giữ khoảng 2h ở nhiệt độ phòng trước khi tiêm vào mặt dưới các lá cây thuốc lá 5 tuần tuổi. Mẫu thí nghiệm được thu sau khi tiêm 2 và 4 ngày. Mẫu thu được bảo quản ở tủ - 84 oC. Song song, chúng tôi cũng tiến hành biểu hiện tạm thời gen Gus nhằm làm đối chứng cho quá trình Agro-infiltration. 2.2.7. Kiểm tra biểu hiện của protein tái tổ hợp Biểu hiện của đoạn peptit kháng nguyên trong E.coli được kiểm tra bằng điện di trên gel SDS-polyacrylamide 12,5%. 1ml của dịch tế bào cảm ứng thu được được ly tâm thu cặn rồi hoà tan trong 50µl 2X Lamli buffer và biến tính Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 26 ở nhiệt độ khoảng 95oC trong 10 phút. Sản phẩm điện di trên gel SDS-PAGE 12,5% (Sambrock,1989) trong vòng 2h ở hiệu điện thế 120V, nhuộm bản gel bằng cách lắc nhẹ 40 vòng trong dung dịch Coomassie Blue (Fermentas) trong 30 phút. Rửa bản gel trong dung dịch rửa khoảng 1 giờ và quan sát biểu hiện các băng protein. Biểu hiện của gen Gus được kiểm tra bằng nhuộm trong dung dịch X- gluc. Hai ngày sau khi tiêm cấu trúc pPTN289_Gus, lá thuốc lá (đường kính 2cm) được ngâm qua đêm trong 500 µl dịch X-Gluc (1mM) ở 37oC. Rửa cồn 70% nhằm loại diệp lục và quan sát màu sắc của các mẫu lá. Biểu hiện của đoạn peptit kháng nguyên trong tế bào thực vật được kiểm tra bằng phương pháp lai miễn dịch Western blot (Sambrock,1989). Mẫu lá được nghiền trong 100 µl dung dịch 2X Lameli buffer, ly tâm 13000rpm/5phút thu dịch protein và biến tính ở nhiệt độ khoảng 95oC trong 10 phút. Sản phẩm điện di trên gel SDS-PAGE 12,5% (Sambrock,1989) trong vòng 2h ở hiệu điện thế 120V. Protein được chuyển sang màng Nitrocellulose nhờ hệ thống chuyển màng của Bio-Rad. Màng được ủ trong dung dịch blocking buffer là 5% sữa tách bơ trong dung dịch đệm PBST (0.1% Tween) trong 2h ở nhiệt độ phòng. Sau khi rửa màng 3 lần bằng PBST, màng được ủ với kháng thể đặc hiệu kháng cmyc (1:50, trong blocking buffer) trong 3h ở nhiệt độ phòng. Kháng thể này được cung cấp bởi Viện Di truyền Thực vật, IPK Gatersleben (Đức). Sau khi rửa, màng được ủ tiếp với kháng thể cộng hợp enzyme peroxidase kháng IgG chuột (1:2000, GE Healtheare) trong 1h. Màng được bổ sung dung dịch chứa cơ chất cho peroxidase ECL (GE Healtheare) sau khi đã được rửa lại ba lần bằng PBST trong 3 phút. Kết quả được hiện trên phim X-ray. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 27 Chƣơng 3 KẾT QUẢ VÀ THẢO LUẬN 3.1 Nhân đoạn gen 27 aa Để nghiên cứu khả năng biểu hiện của đoạn gen 27 aa trước hết chúng tôi tiến hành phản ứng nhân đoạn gen này. Đoạn gen 27 aa được nhân lên trong phản ứng PCR với thành phần và chu trình nhiệt được mô tả ở phần phương pháp nghiên cứu. Một điều đặc biệt là để tăng cường biểu hiện của đoạn peptide kháng nguyên nằm trên protein vỏ của virus viêm não Nhật Bản, chúng tôi đã tiến hành thay đổi thành phần một vài bộ ba mã hóa cho đoạn peptide 27 aa này nhằm mục đích biểu hiện tốt hơn ở trên thực vật. Cặp mồi đặc hiệu nhân đoạn gen 27aa bao gồm toàn bộ 81 nucleotide của đoạn peptide kháng nguyên. Kết quả PCR đoạn gen 27 aa được thể hiện trên hình 3.1. Hình 3.1: Điện di sản phẩm PCR nhân đoạn gen 27aa 27aa: đoạn gen 27aa M: Marker 100bp Trên hình 3.1 cho thấy sản phẩm PCR gen 27 aa xuất hiện duy nhất một băng với kích thước ~ 90bp, đây cũng chính là kích thước của đoạn gen 27 aa trên lý thuyết. Điều này chứng tỏ chúng tôi đã tiến hành phản ứng nhân đoạn gen 27 aa thành công. 200 100 bp 27aa M ~ 90bp Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 28 3.2 Nhân gen LTB và nối với gen 27 aa Để kết hợp với đoạn gen 27 aa trong quá trình nghiên cứu biểu hiện, đoạn gen LTB cũng được nhân lên bằng phản ứng PCR. Trên khuôn là plasmid chứa đoạn LTB, đoạn gen LTB được nhân lên bằng phản ứng PCR với cặp mồi 5’_LTB và 3’_LTB. Kết quả PCR gen LTB được thể hiện trên hình 3.2. Kết quả PCR gen LTB ở giếng số 1 cho thấy một băng rõ nét duy nhất. So sánh với kích thước Marker 1Kb thì đoạn gen được nhân lên có kích thước ~ 300bp, trên lý thuyết đoạn gen LTB cũng có kích thước tương ứng với đoạn gen này. Điều này thể hiện đã nhân bản thành công đoạn gen LTB từ plasmid chứa gen LTB. Với đoạn gen 27 aa và gen LTB đã nhân bản thành công, chúng tôi tiếp tục nối hai đoạn gen này bằng phản ứng PCR. Với việc gắn thêm 10 nucleotide của trình tự đoạn LTB vào mồi 3’_27aa và 10 nucleotide của trình tự đoạn gen 27 aa vào mồi 5’_LTB chúng tôi hy vọng sẽ nối được hai đoạn gen này với nhau. Phản ứng PCR này thực hiện theo chu trình nhiệt giống phản ứng nhân đoạn gen LTB và thành phần được mô tả ở phần phương pháp nhiên cứu. Kết quả được thể hiện trên hình 3.2. Hình 3.2. Điện di sản phẩm PCR nhân đoạn LTB và ghép nối 27aa_LTB M: Marker 1kb 1: đoạn LTB 2: ghép nối 27aa và LTB Giếng số 2 là sản phẩm ghép nối đoạn gen 27 aa với gen LTB. So sánh kích thước này với kích thước của đoạn LTB và với Marker 1kb cho thấy rằng 1 M 2 ~300 bp ~390 bp 250 500 bp Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 29 sản phẩm PCR nối này có kích thước ~ 390bp. Và đây cũng chính là kích thước được tính theo lý thuyết của đoạn gen nối. Như vậy phản ứng nối đoạn gen 27 aa và đoạn g

Các file đính kèm theo tài liệu này:

  • pdfdoc332.pdf
Tài liệu liên quan