Luận văn Nghiên cứu phát triển thiết bị pin nhiên liệu vi sinh vật (microbial fuel cell) sử dụng làm cảm biến sinh học đánh giá chất lượng nước thải

MỤC LỤC

LỜI CẢM ƠN .

MỤC LỤC.

DANH MỤC CÁC TỪ VIẾT TẮT .

DANH MỤC HÌNH ẢNH .

MỞ ĐẦU.1

Chương 1 – TỔNG QUAN .3

1.1 Ô NHIỄM NưỚC TẠI VIỆT NAM .3

1.2 PHưƠNG PHÁP ĐÁNH GIÁ CHẤT LưỢNG NưỚC THẢI SAU XỬ LÝ .5

1.3 CẢM BIẾN SINH HỌC ĐÁNH GIÁ CHẤT LưỢNG NưỚC THẢI SAU

XỬ LÝ.7

1.3.1 Cảm biến sinh học dựa trên hành vi của sinh vật.7

1.3.2 Cảm biến sinh học vi sinh vật .9

1.4 PIN NHIÊN LIỆU VI SINH VẬT.12

1.4.1 Các loại Thiết kế MFC.15

1.4.2 Vật liệu cấu tạo MFC .17

1.4.2.1 Vật liệu cho điện cực.17

1.4.2.2 Màng trao đổi ion.19

1.4.3 Vật liệu tạo khung cho MFC.22

1.4.4 Ứng dụng của MFC.23

1.5 HỆ VI SINH VẬT TRONG MFC .24

1.6 CÁC PHưƠNG PHÁP NGHIÊN CỨU VI SINH VẬT TRONG MFC .27

Chương 2 – VẬT LIỆU VÀ PHưƠNG PHÁP NGHIÊN CỨU .29

pdf111 trang | Chia sẻ: mimhthuy20 | Lượt xem: 487 | Lượt tải: 0download
Bạn đang xem trước 20 trang tài liệu Luận văn Nghiên cứu phát triển thiết bị pin nhiên liệu vi sinh vật (microbial fuel cell) sử dụng làm cảm biến sinh học đánh giá chất lượng nước thải, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
ện các trình tự DNA không tƣơng đồng.[46-48, 64]. DGGE tỏ ra đặc biệt hiệu quả khi sử dụng để phân tích so sánh trình tự gen 16s rRNA của vi khuẩn. Trình tự 16s rRNA đƣợc sử dụng rộng rãi trong phân loại vi khuẩn. Vùng 16s rRNA có 9 vùng biến động (ký hiệu từ V1-V9), đã đƣợc chứng minh là có mức độ đa dạng trình tự cao giữa các vi khuẩn khác nhau và có thể sử dụng cho phân loại các loài. Ví dụ, vùng V2 và V3 có kích thƣớc khoảng 200 bp có khả năng phân biệt đƣợc 110 loại vi khuẩn khác nhau tới mức độ chi. Tuy nhiên, các vùng này thƣờng ngắn và không thể chỉ sử dụng một vùng biến động mà có thể phân biệt đƣợc tất cả các loại vi khuẩn [12, 47]. 29 Chƣơng 2 – VẬT LIỆU VÀ PHƢƠNG PHÁP NGHIÊN CỨU 2.1 VẬT LIỆU NGHIÊN CỨU 2.1.1 Hóa chất, thiết bị và dụng cụ Nghiên cứu này đƣợc thực hiện tại Phòng thí nghiệm bộ môn Vi sinh vật học - Khoa Sinh học, Trƣờng ĐH Khoa học Tự nhiên, sử dụng các máy móc, thiết bị chuyên môn dùng trong nghiên cứu vi sinh vật học, Sinh học phân tử đạt tiêu chuẩn: - Máy PCR 9700 (Applied Biosystems, Mỹ). - Máy ly tâm 5417R (Eppendorf, Đức) - Máy điện di ngang (BioRad, Mỹ) - Máy DGGE K-2401 (C.B.S Scientific, Mỹ) - Bàn soi gel LMW-20 UVP (UK). - Kính hiển vi quang học (Zeiss, Đức) Hóa chất sử dụng cho nuôi cấy vi sinh vật: Pepton, các muối (NaCl, MgSO4, (NH4)2SO4, K2HPO4, KH2PO4); nguyên tố vi lƣợng (H3BO3, CoCl2.6H2O...) có xuất xứ Trung Quốc (Xilong), Agar (Việt Nam), Cao nấm men (Sigma, Hoa Kỳ). Hóa chất sử dụng trong phƣơng pháp điện di gel biến tính DGGE: Acrylamide, Bis-AA, 50x TAE buffer, Formamide, TEMED (tetramethyl ethylenediamine), APS (Ammonium persulfate) do hãng Affymetric (USB, Mỹ) cung cấp. Hoá chất sử dụng trong các thí nghiệm Sinh học phân tử: Bộ hóa chất sử dụng tách ADN (Glycogen 20 mg/ml, Ethanol 100 %, Ammonium acetate) , phản ứng PCR (USB Taq PCR Master Mix 2x), điện di kiểm tra sản phẩm PCR (HydraGreen Safe ADN Stain 20 000x, Loading Dye 6x, GeneRuler 1kb ADN Ladder), tinh sạch sản phẩm PCR (ExoSAP-IT PCR Product Cleanup). Tất cả đều đƣợc cung cấp bởi Affymetric USB, Merck và Fermentas (Mỹ). 30 Vật liệu cấu tạo pin nhiên liệu vi sinh vật: - Polyacrylic (Việt Nam) - Vải than chì (Việt Nam) - Thanh than chì (Việt Nam) - Màng nafion 117 (Hoa Kỳ) - Nối nhanh ϕ 4 mm (Trung Quốc) - Ống nƣớc phi ϕ 4 mm (Đài Loan) - Dây chuyền nƣớc (Trung quốc) Đồng Hồ đo điện: - Đồng hồ vạn năng Extech (Hoa Kỳ) - Máy đo điện tự động KEITHLEY (Hoa Kỳ) 2.1.2 Nguồn vi sinh vật sử dụng trong nghiên cứu Chúng tôi tiến hành chọn lựa các nguồn quần xã khác nhau phục vụ cho việc làm giàu hệ vi sinh vật điện hóa có khả năng tốt nhất cho việc phát triển cảm biến sinh học trong MFC từ nguồn tự nhiên và nguồn đã bị ô nhiễm gồm: - Nguồn bùn thải khu dân cư: phố Chùa Láng – quận Đống Đa - Hà Nội - Mẫu đất tự nhiên (ĐT): gồm hỗn hợp các nguồn đất đƣợc lấy từ Fansipang – Sapa – Lào Cai, Đất tại vƣờn quốc gia Cúc Phƣơng và đầm Vân Long – Ninh Bình. - Mẫu bùn tự nhiên (BT): gồm hỗn hợp của bùn đƣợc lấy từ Đầm vân Long – Ninh Bình vàVƣờn quốc gia Xuân Thủy – Nam Định. - Mẫu bùn hoạt tính (BH): Gồm bùn kỵ khí và hiếu khí (Nhà máy bia Hà Nội – Hƣng Yên – Khu Công Nghiệp Phố Nối A – Hƣng Yên). - Mẫu Nước Thải (NT): Bùn và nƣớc thải hỗn hợp (Làng giấy Phong Khê – Bắc Ninh; Làng tái chế kim loại Đan Hội – Bắc Ninh; Cơ sở dệt nhuộn – Hồi Quan – Bắc Ninh; Làng tái chế Ni lon – Văn Giang – Hƣng Yên). 31 - Mẫu hỗn hợp (HH): là hỗn hợp của mẫu đất tự nhiên, bùn tự nhiên, bùn hoạt tính, nƣớc thải đƣợc trộn với nhau. 2.2 CÁC THIẾT KẾ THÍ NGHIỆM VÀ PHƢƠNG PHÁP NGHIÊN CỨU 2.2.1 Lựa chọn thiết kế tối ƣu cho MFC Chúng tôi tiến hành nghiên cứu, tổng hợp, đánh giá các ƣu nhƣợc điểm của các dạng thiết kế MFC- và các vật liệu sử dụng cho MFC đã đƣợc công bố, qua đó chúng tôi tiến hành lựa chọn dạng vật liệu-thiết kế phù hợp nhất cho việc thiết kế MFC có khả năng làm cảm biến sinh học trong điều kiện Việt Nam. 2.2.2 Thiết kế, lắp đặt hệ thống MFC Pin nhiên liệu vi sinh vật đƣợc thiết kế dựa trên thiết kế của Kim và cộng sự [26]. Trong nghiên cứu này chúng tôi tiến hành thử nghiệm hai dạng thiết kế MFC (dạng khoang hình hộp chữ nhật và khoang hình trụ) và ba thể tích khoang anode (5 ml; 7,5 ml; và 10 ml) . Cụ thể, với MFC dạng thiết kế khoang hình chữ nhật (Hình 15) đƣợc cấu tạo từ polyarylic gồm: khoang cathode có thể tích là 7,5 ml với kích thƣớc ngoài là 50 x 100 x 15 mm, và kích thƣớc khoang là 50 x 10 x 15mm; khoang anode có thể tích khoang lần lƣợt là 5 ml, 7,5 ml, 10 ml với kích thƣớc ngoài là 50 x 100 x A (A = 10; 15; 20 mm), và kích thƣớc khoang trong bằng 50 mm x 10 mm x H (H = 10; 15 ; 20 mm). MFC đƣợc chặn ngoài bằng hai tấm ốm có kích thƣớc 50 x 100 x 15 mm. Khoảng cách giữa các tấm đƣợc ngăn cách bởi một lớp cao su dày 1 mm, hai khoang anode cà cathode đƣơc ngăn cách bằng màng Nafion N117 (DuPont, Hoa Kỳ), thiết bị đƣợc cố định bằng ốc và bu lông. Điện cực tại khoang anode và cathode đƣợc cấu tạo bằng vải than chì có kích thƣớc 9 mm x 45 mm x 5 mm với điện trở 0, 8 Ω/cm2 đƣợc nối với thanh gom điện bằng than trì có đƣờng kính 6 mm với điện trở 0, 2 Ω/cm2, hai điện cực đƣợc nối với điện trở 10Ω thông qua dây nối có đƣờng kính 1 mm. 32 MFC dạng thiết kế khoang hình trụ (Hình 16) đƣợc làm từ polyacrylic gồm: khoang cathode có thể tích là 7,5 ml kích thƣớc 45,24 x 45, 24 x 15 mm, kích thƣớc khoang đƣờng kính 25,24 mm độ cao 15 mm. Khoang anode có thể tích khoang lần lƣợt là 5 ml, 7,5 ml, và 10 ml có kích thƣớc ngoài 45,24 x 45, 24 x A (A = 10; 15; 20 mm), kích thƣớc khoang đƣờng kính 25,24 mm và chiều cao H = 10; 15; 20 mm. Mỗi khoang sẽ đƣợc ngăn bằng tấm chặn ngoài có kích thƣớc 45,24 x 45, 24 x 15 mm. Điện cực tại khoang anode và cathode đƣợc cấu tại bằng vải than chì có kích thƣớc 25 mm x 5mm điện trở 0,8 Ω/ cm2, và đƣợc nối với thanh gom điện bằng than chì có đƣờng kính 6 mm điện trở 0,2 Ω/ cm2, khoảng cách giữa các tấm đƣợc ngăn cách bởi một lớp cao su dày 1 mm, hai khoang anode và cathode đƣơc ngăn cách bằng màng Nafion N117 (DuPont, Hoa Kỳ), thiết bị đƣợc cố định bằng ốc và bu lông, đầu thanh gom điện than chì đƣợc nối với dây dẫn (đƣờng kính 1 mm) bằng ngàm cá sấu và điện trở mạch ngoài là 10 Ω. Hình 15 : MFC khoang chữ nhật Hình 16 : MFC khoang trụ 2.2.3 Quy trình làm giầu vi sinh vật trong các MFC: Phục vụ thí nghiệm lựa chọn thiết kế MFC tối ưu: Quần xã vi sinh vật thí điểm đƣợc làm giàu từ mẫu nƣớc thải khu dân cƣ tại phố Chùa Láng - quận Đống Đa - thủ đô Hà Nội. Quần xã đƣợc tiến hành làm giầu với dung dịch anode mô phỏng nƣớc thải có nồng độ BOD = 50 ppm với tốc độ dòng 0,3 ml/phút. Song song 33 với quá trình làm giầu, chúng tôi tiến hành chạy MFC đối chứng hóa học (MFC không đƣợc bổ sung vi khuẩn). Phục vụ thí nghiệm lựa chọn nguồn vi sinh vật tối ứu: Sau khi lựa chọn đƣợc thiết kế MFC tốt nhất cho việc phát triển cảm biến sinh học đánh giá chất lƣợng nƣớc thải, chúng tôi tiến hành thử nghiệm các MFC với thiết kế đó và hệ vi sinh vật làm giàu từ các nguồn quần xã vi sinh vật khác nhau (Mục 2.1.2). Các MFC đƣợc làm giàu với dung dịch anode mô phỏng nƣớc thải có nồng độ BOD 30 ppm với tốc độ dòng 0,3 ml/ phút tại điều kiện nhiệt độ phòng. Ban đầu hai khoang anode và cathode của các MFC bị ngăn bởi 1 lớp màng nilon (không có khả năng cho các ion đi qua) trong thời gian 14 ngày, sau đó chúng tôi tiến hành đổi chúng bằng lớp màng nafion117. 2.2.4 Vận Hành Hệ Thống MFC Hệ thống MFC của chúng tôi đƣợc vận hành liên tục theo Hình 17: Với khoang cathode chứa nƣớc bão hòa oxy đƣợc chảy tuần hoàn nhờ bơm (Boyu FP2000, Trung Quốc) dẫn nƣớc từ bồn chứa có sử dụng sục khí (HEIBAO aquarium HB-248A, Trung Quốc), nƣớc tại bồn đƣợc thay hàng ngày. Tại khoang anode, dung dịch mô phỏng nƣớc thải theo Kim và cộng sự (2006) đƣợc sử dụng với thành phần 1 lít dung dịch gồm: 0,56g (NH4)2SO4; 0,42g NaHCO3; 0,114 g KH2PO4 3H2O; 0,068 g K2HPO4; 0,0247 MnCl2 cộng 10 ml vi lƣợng (1,1 g FeSO4 7H2O; 0,1 g MnCl2 4H2O; 0,17 g CoCl2 6H2O; 0,1 g ZnCl2; 0,1 g CaCl2 2H2O; 0,002 g CuCl2 2H2O; 0,001 g H3BO3; 0,001 g Na2MoO3; 1 g NaCl; 0,13 g NiCl2 6H2O ) và thêm dung dịch có chứa nồng độ BOD cẩn kiểm tra gồm glucose và glutamat đƣợc tính toán nồng độ theo Ủy ban đo lƣờng tiêu chuẩn và sức khỏe cộng đồng của Hoa Kỳ (1995), dung dịch đƣợc đựng trong bình Duran 2 lít và chảy vào khoang anode thông qua dây chuyền dịch (Human Luzhou Huikang Development Co., Ltd, Trung Quốc), và tốc độ dòng vào đƣợc điều chỉnh nhờ có van điều tiết [26, 54]. Với các thí nghiệm làm giàu vi sinh vật anode và đánh giá hoạt động của các MFC, các MFC đƣợc vận hành với dung dịch nƣớc thải mô phỏng có giá trị BOD là 30 ppm. 34 Với các thí nghiệm lựa chọn thiết kế ƣu việt hơn, các MFC đƣợc vận hành với các dung dịch nƣớc thải mô phỏng có các giá trị BOD là 5 và 50 ppm, thay đổi luân phiên. Với các thử nghiệm khả năng đánh giá chất lƣợng nƣớc thải của các thiết bị, các MFC đƣợc vận hành với các dung dịch nƣớc thải mô phỏng có các nồng độ BOD khác nhau (0, 5, 15, 30 và 50 ppm). Hình 17: Sơ đồ hoạt động hệ thống MFC Hình 18: Hệ thống MFC vận hành trong phòng thí nghiệm 35 2.2.5 Đo đạc và xử lý số liệu Hiệu điện thế của các MFC đƣợc đo bằng đồng hồ vạn năng EX MN 35 (Extech, Hoa Kỳ), với thời gian 30 phút/ lần-đo một ngày 8 tiếng hoặc bằng cách sử dụng máy đo điện KEITHLEY (Hoa Kỳ) với thời gian đo 10 phút/lần, hiệu điện thế của MFC đƣợc xử lý và vẽ đồ thị bằng phầm mền Microsoft Excel 2010. Dòng điện của MFC sẽ đƣợc tính bằng công thức I = U/ R (Định luật ôm), trong đó: I là cƣờng độ dòng điện (Ampe: A), U là điện áp ở hai đầu đoạn mạch (Vol: V), R là điện trở của mạch (ohm). 2.2.6 Phƣơng pháp phân tích vi sinh vật theo phƣơng pháp truyền thống Phân lập hệ vi sinh vật trên điện cực anode: Sau khi làm giàu vi sinh vật trong MFC thành công, tiến hành cắt 5 x 1 x 5 mm điên cực anode cho vào 9 ml nƣớc muối sinh lý và tiến hành vortex, sau đó dịch điện cực anode đƣợc tiến hành pha loãng theo dày nồng độ giảm 10 lần đến 104 bằng nƣớc muối sinh lý, tiếp đó tiến hành cấy trải dịch điện cực anode trên môi trƣờng C, LB, BG11, Hansen, PDA. Các khuẩn lạc thu đƣợc sẽ đƣợc chọn lựa và làm thuần bằng phƣơng pháp cấy ria ba pha trên môi trƣờng cùng loại. Mẫu vi sinh vật thu đƣợc sẽ đƣợc bảo quản trên ống môi trƣờng thạch nghiêng tƣơng ứng với nhiệt độ 4oC và glycerol 15% tại nhiệt đô - 20 o C. Bảng 7: Môi trƣờng LB (phân lập các vi khuẩn dị dƣỡng) [62] STT. Thành phần Hàm lƣợng 1 Nƣớc cất 1 L 2 Peptone 15 g 3 Cao nấm men 5 g 4 NaCl 5 g 5 Agar 18 g pH 7 ± 0,5, khử trùng tại 121oC trong 20 phút. 36 Bảng 8: Môi trƣờng C [62] (phân lập các vi khuẩn có khả năng khử sulfate) STT. Thành phần Hàm lƣợng 1 Nƣớc cất 1 L 2 Sodium lactate 6 g 3 Na2SO4 4,5 g 4 NH4Cl 1 g 5 Cao nấm men 1 g 6 KH2PO4 0,5 g 7 Sodium citrate.2H2O 0,3 g 8 CaCl2.6H2O 0,06 g 9 MgSO4.7H2O 0,06 g 10 FeSO4.7H2O 0,004g 11 Agar 16 g pH 7.5 ± 0.2, khử trùng tại 121oC trong 20 phút. Nuôi trong điều kiện kỵ khí (Oxy tối thiểu) Bảng 9: Môi trƣờng PDA (phân lập nấm sợi) [62] STT. Thành phần Hàm lƣợng 1 Nƣớc cất 1 L 2 Khoai tây 200 g 3 Glucose 16 g 4 Agar 16 g pH 7 ± 0.5, khử trùng tại 110oC trong 20 phút. Bổ sung thêm ampicillin (10 mg/ 1L) ở nhiệt độ khoảng 60oC trong Box cấy vô trùng 37 Bảng 10: Môi trƣờng Hansen (phân lập nấm men) [62] STT. Thành phần Hàm lƣợng 1 Nƣớc cất 1 L 2 Glucose 50 g 3 KH2PO4 3 g 4 MgSO4.7H2O 3 g 5 Peptone 10 g 6 Agar 20 g pH 7 ± 0,5, khử trùng tại 110 oC trong 20 phút. Bổ sung thêm ampicillin (10 mg/ 1L) ở nhiệt độ khoảng 60oC trong Box cấy vô trùng Bảng 11: Môi trƣờng BG 11 (phân lập vi khuẩn lam và tảo) [62] STT. Thành phần Hàm lƣợng 1 Nƣớc cất 1 L 2 NaNO3 1,5 g 3 MgSO4.7H2O 0,075 g 4 K2HPO4 0,04 g 5 CaCl2.2H2O 0,036 g 6 Na2CO3 0,02 g 7 Citric acid 6,0 mg 8 Ferric ammonium citrate 6,0 mg 9 Disodium EDTA 1,0 mg 10 Hỗn hợp vi lƣợng A5 1,0 mL 11 Agar 16 g pH 7 ± 0,5, khử trùng tại 121oC trong 20 phút. 38 Bảng 12: Thành phần của dung dịch Trace metal mix A5 STT. Thành phần Hàm lƣợng 1 Nƣớc cất 1 L 2 H3BO3 2,86 g 3 MnCl2.4H2O 1,81 g 4 Na2MoO4.2H2O 0,39 g 5 ZnSO4.7H2O 0,222 g 6 CuSO4.5H2O 0,079 g 7 Co(NO3)2.6H2O 0,049 g Quan sát hình thái vi khuẩn: Các chủng phân lập đƣợc tiến hành nhuộm gram và đem soi dƣới kính hiển vi quang học (Zeiss - Đức), ở vật kính 100 x và đƣợc chụp ảnh bằng máy ảnh Canon G10 (Nhật Bản) ở các độ phóng đại 8.5 x; 11.5 x; 14 x. Với quy trình: lấy một khuẩn lạc thuần của chủng vi khuẩn và khuẩn lạc của Bacillus subtilis hoặc E. coli trộn với nhau và cố định hai vết bôi trên lam kính sạch, sau đó tiến hành nhuộm mẫu với dung dịch tím kết tinh (Crystal violet) trong 1 phút, tiếp ta rửa mẫu bằng nƣớc cất, mẫu đƣợc nhuộm tiếp bằng dung dịch Lugol trong 1 phút. Vết bôi đƣợc rửa lại bằng ethanol 96% trong 30 giây, sau đó đƣợc rửa lại bằng nƣớc cất. Mẫu đƣợc nhuộm tiếp bằng thuốc nhuộm bổ sung màu đỏ Safranin (hay Fuchsin Ziehl) trong 30 giây. Cuối cùng, mẫu đƣợc rửa bằng nƣớc cất, để khô và soi dƣới kính hiển vi quang học. 2.2.7 Phƣơng pháp DGGE Quy trình tách chiết DNA [30]: Mẫu điện cực anode hoặc dịch vi khuẩn đƣợc tách chiết DNA theo quy trình sau: Các ống Eppendorf có chứa 1 ml mẫu đƣợc ly tâm trên máy Eppendorf 5417R (Đức) ở 8000 rpm, 20oC trong 10 phút. Gạn bỏ dịch nổi; phần lắng đƣợc mix đều với 0,5 mL nƣớc vô trùng MQ. Sau đó, các dung dịch này đƣợc bổ sung 500 µL hỗn hợp Phenol: Chloroform: Isoamyl alcohol (25: 24: 1) và vortex khoảng 20 giây trƣớc khi ly tâm trên máy Eppendorf 5417R (Đức) ở 14.000 rpm, 20°C trong 10 - 15 phút. Tiếp đến, thu dịch nổi và chuyển vào một ống 39 Eppendorf vô trùng khác. Các ống này tiếp tục đƣợc bổ sung lần lƣợt 1 µL glycogen, 100 µL 7,5 M ammonium acetate và 750 µL ethanol 100% trƣớc khi ủ qua đêm ở nhiệt độ -20 °C. Hỗn hợp này tiếp tục đƣợc ly tâm trên máy Eppendorf 5417R (Đức) với điều kiện 14.000 rpm, 30 phút, 4 °C thu DNA, DNA thu đƣợc đƣợc rửa lại ba lần trong dung dịch ethanol 70%. Cuối cùng, DNA đƣợc để khô tự nhiên qua đêm trƣớc khi pha loãng với 50 µL nƣớc PCR. Sản phẩm tách chiết DNA đƣợc kiểm tra trên máy điện di BioRad (Mỹ) với nồng độ gel agarose 1% có chứa thuốc nhuộm HydraGreen Safe ADN Stain 20 000x (ACTGene) trong dung dịch TAE 1x với hiệu điện thế 100 V-thời gian 20 phút, và đƣợc quan sát trên máy soi gel LMW-20 UVP (UK). Bảng 13: Thành phần và chu trình nhiệt phản ứng PCR nhân gen16s rRNA Thành phần phản ứng Thể tích Chu trình nhiệt Taq PCR mix 12,5 µL 1. 95oC: 5 min 2. 95oC: 1 min 53 o C: 45 s 72 o C: 1 min  Lặp lại 30 chu kì. 3. 72oC: 7 min P63F (10 µM) 1,5 µL P1378R (10 µM) 1,5 µL DNA khuôn 1,5 µL Nƣớc PCR 8 µL Tổng thể tích 25 µL Quy trình khuếch đại đoạn gen 16s rRNA: DNA thu đƣợc từ điện cực anode hoặc chủng nuôi cấy thuần sẽ đƣợc đƣa vào chạy PCR trên máy PCR 9700 (Applied Biosystems, Mỹ) với mục đích khuếch đại gen 16s rRNA (1400 bp) bằng cặp mồi p63F (5′CAGGCCTAACACATGCAAGTC3′, mồi xuôi) và p1378R (5’CGGTGTGTACAAGGCCCGGGAACG3’, mồi ngƣợc) [19] với thành phần phản ứng và chu trình nhƣ Bảng 13, sản phẩm PCR đƣợc kiểm tra trên máy điện di 40 BioRad (Mỹ) với nồng độ gel agarose 1% có chứa thuốc nhuộm HydraGreen Safe ADN Stain 20 000x (ACTGene) trong dung dịch TAE 1x với hiệu điện thế 100 V- thời gian 20 phút, và đƣợc quan sát trên máy soi gel LMW-20 UVP (UK). Sau khi nhân đoạn 16s rRNA của mẫu thành công, chúng tôi tiếp tục sử dụng sản phẩm PCR khuếch đại gen 16s rRNA làm khuôn nhằm khuếch đại vùng V3 (200 bp) bằng cặp mồi p338F-GC (với một kẹp GC đƣợc thêm vào) (5’ ACTCCTACGGGAGGCAGCAG 3’, mồi xuôi) và p518R (5’ATTACCGCGGCTGCTGG 3’, mồi ngƣợc) [47] theo quy trình ở Bảng 14 để phục vụ cho quá trình phân tích trên DGGE. Sản phẩm PCR đƣợc kiểm tra trên máy điện di BioRad (Mỹ) với nồng độ gel agarose 1% có chứa thuốc nhuộm HydraGreen Safe ADN Stain 20 000x (ACTGene) trong dung dịch TAE 1x với hiệu điện thế 100 V-thời gian 20 phút, và đƣợc quan sát trên máy soi gel LMW-20 UVP (UK). Bảng 14: Thành phần và chu trình nhiệt phản ứng PCR nhân vùng V3 thuộc gen16s rRNA Thành phần phản ứng Thể tích Chu trình nhiệt Taq PCR mix 12,5 μL 1. 95 o C: 5 min 2. 95 o C: 30 s 53 o C: 30 s 72 o C: 45 s  Lặp lại 30 chu kì. 3. 72 o C: 5 min p338F (10 μM) 1,5 μL P518R (10 μM) 1,5 μL DNA khuôn 1,5 μL Nƣớc PCR 8μL Tổng thể tích 25 μL 41 Bảng 15: Thành phần của dung dịch biến tính 0% và 60% Thành phần Dung dịch biến tính 0% Dung dịch biến tính 60% Acrylamide 6 g 4,5 g Bis-AA 0,162 g 0,122 g 50 x TAE 2,5 mL 1,9 mL Urea - 25,2 g Formamide - 24 mL MQ water 100 mL 100 mL Quy trình điện di DGGE: Quá trình điện di đƣợc tiến hành trên gel polyacrylamide 6% với gradient biến tính Urea/ formamide từ 45% đến 60% (Bảng 15, 16). Ta tiến hành trộn 15 µl mỗi mẫu với 10 µl Loading Dye 6x và tra vào mỗi giếng. Quá trình điện di đƣợc thực hiện bằng bộ điện di DGGEK – 2401 (C.B.S Scientific - Mỹ), trong đệm TAE 1x, ở nhiệt độ 60oC, hiệu điện thế 38V, thời gian 16 giờ. Sau khi điện di, bản gel đƣợc nhuộm trong dung dịch HydraGreen Safe ADN Stain 1x trong 30 phút, sau đó rửa lại bằng nƣớc cất trong 10 phút và quan sát bằng máy soi LMW-20 UVP (UK). Bảng 16: Thành phần của “Working solution” Dung dịch stock Dung dịch biến tính 45% Dung dịch biến tính 60% Dung dịch biến tính 0% Dung dịch 60% 7,5 mL 10 mL 0 mL Dung dịch 0% 2,5 mL - 5 mL TEMED 8 µL 8 µL 5 µL APS 10% 40 µL 40 L 20 L 42 Quy trình thôi gel: Những băng phân tách trên bản gel DGGE đƣợc cắt bằng dao cắt gel vô trùng, sau đó đƣợc rửa lại bằng nƣớc MQ và bổ sung thêm 50 µl nƣớc MQ, để qua đêm ở 4oC. Dịch thôi ADN đƣợc dùng làm khuôn để thực hiện phản ứng PCR tƣơng tự nhƣ phản ứng PCR cho DGGE Bảng 15 với cặp mồi 338F và 518R. Sản phẩm PCR đƣợc tinh sạch bằng bộ kit ExoSAP – IT (Affymetric) và giải trình tự bởi FirstBase (Singapore). Phân tích kết quả DGGE: Kết quả điện di DGGE sẽ đƣợc phân tích nhờ phần mềm NTSYSpc2.0 dựa trên phân tích ma trận tƣơng đồng – ma trận khoảng cách của mẫu từ số lƣợng băng thu đƣợc, sau đó tiến hành phân tích nhóm (cluster analyses) để xác định tƣơng quan giữa các quần xã. Trình tự gen 16S rRNA của các đơn chủng và trình tự của các băng thu đƣợc trên điện di DGGE đƣợc phân tích trên phần mềm clustalx 2.0, và BioEdit Sequence Aligment Editor, sau đó đƣợc tiến hành tìm kiếm so sánh trình tự tƣơng đồng trên công cụ BLAST của NCBI ( 43 Chƣơng 3 – KẾT QUẢ VÀ THẢO LUẬN 3.1 LỰA CHỌN THIẾT KẾ MFC PHÙ HỢP 3.1.1 Lựa chọn vật liệu cho MFC Chúng tôi tiến hành so sánh ƣu nhƣợc điểm của từng loại vật liệu phục vụ cho thiết kế MFC đã đƣợc công bố trong những nghiên cứu trƣớc đây (Bảng 17; 18; 19). Qua đó, chúng tôi lựa chọn sử dụng vải than chì (0,8 Ω) làm điện cực, chúng đƣợc nối với thanh gom điện làm bằng than chì đƣờng kính 0,6 cm (0,2 Ω) thông qua keo epoxy (Thái Lan) có trộn với bột than chì. Tiếp theo, chúng tôi lựa chọn màng CEM nafion 117 làm màng ngăn cách giữa hai khoang MFC, vì loại màng này cho dòng điện phát sinh cao, tạo pH ổn định trong khoang anode. Cuối cùng, qua so sánh, chúng tôi chọn vật liệu polyacrylic làm khung MFC, vì đây là vật liệu có thể khử trùng và dễ dàng cải biến hình dạng. Bảng 17: Phân tích ƣu nhƣợc điểm của các điện cực trong MFC [37, 38, 51, 63] STT Tên Vật liệu (độ dẫn điện) Ƣu điểm Nhƣợc điểm 1 Giấy carbon (0,4 Ω) Tính dẫn điện cao, Giòn dễ gãy, không gian điện cực nhỏ 2 Vải than chì (2,2 Ω) Không gian điện cực lớn Tính dẫn điện thấp 3 Thanh than chì, miếng than chì (0,2 Ω) Tính dẫn điện cao Không gian điện cực thấp 44 Bảng 18: Phân tích ƣu nhƣợc điểm vật liệu cấu tạo khung MFC [37, 38] STT Tên Vật liệu Ƣu điểm Nhƣợc điểm 1 Vật liệu khung polyacrylic Có thể khử trùng đƣợc, Đễ dàng khoan cắt 2 Vật liệu khung bằng thủy tinh Có thể khử trùng Khó cải tiến, dễ vỡ, khó đặt mua với số lƣợng ít Bảng 19: Phân tích ƣu nhƣợc điểm của các loại màng phân tách [37, 38] STT Tên Vật liệu Ƣu điểm Nhƣợc điểm 1 Màng CEM nafion 117 (R=84+4 Ω; P=514 mW/m2) Điện trở trong thấp, năng lƣợng sản sinh cao Giá thành đắt 2 Màng AEM (R=88+4 Ω: P=610 mW/m2) Năng lƣợng phát sinh lớn, điện trở trong thấp, pH trong khoang anode cao, nếu hoạt động trong thời gian dài gây ức chế vi sinh vật 3 Màng Phân cực Có khả năng duy trì pH độc lập tại khoang anode và cathode Năng lƣợng sản sinh thấp 3.1.2 Lựa chọn thiết kế MFC nhằm phát triển cảm biến sinh học Sau khi lựa chọn đƣợc vật liệu để chế tạo MFC, chúng tôi tiếp tục nghiên cứu các dạng thiết kế MFC đã đƣợc công bố trên thế giới và so sánh phân tích ƣu nhƣợc điểm của chúng qua đó lựa chọn đƣợc dạng thiết kế tối ƣu nhất cho việc phát triển cảm biến sinh học đánh giá chất lƣợng nƣớc thải (Bảng 20, 21). Nhƣ ta đã biết, cảm biến sinh học (biosensor) trong đánh giá chất lƣợng nƣớc cần những yêu cầu nhƣ: chỉ dẫn chính xác chất lƣợng nƣớc, kiểm tra trực tiếp chất lƣợng nƣớc, thời gian phản ứng với sự thay đổi chất lƣợng nƣớc ngắn, giá thành rẻ Tuy nhiên, dòng điện đƣợc sinh ra bởi MFC chịu ảnh hƣởng bởi nhiều nhân tố nhƣ: hoạt động của vi sinh vật, sự di chuyển-tốc độ electron từ tế bào đến điện cực, sự di chuyển của proton từ khoang anode tới khoang cathode, điện trở trong của hệ thống, tốc độ và lƣợng oxy phản ứng tại khoang cathode, oxy hòa tan trong khoang anode[26] 45 Do đó, nhằm hạn chế các yếu tố ảnh hƣởng tới MFC, đã có rất nhiều dạng thiết kế MFC đã đƣợc nghiên cứu phục vụ cho việc phát triển cảm biến sinh học và tối ƣu độ hoạt động của chúng. . Ƣu nhƣợc điểm của các dạng thiết kế này đã đƣợc chúng tôi phân tích ở Bảng 20. Bảng 20: Phân tích ƣu nhƣợc điểm các loại thiết kế MFC [13, 14, 25, 37, 38] STT Loại MFC Ƣu điểm Nhƣợc điểm 1 MFC một khoang với cathode không khí - Dòng điện phát sinh cao - Điện trở trong thấp - Khó thiết kế điện cực cathode - Điện cực cathode có thể là trở ngại cho việc tiếp xúc với oxy nếu không đƣợc tƣới nƣớc hoặc dung dịch điện ly - Oxy có thể thấm qua màng vào khoang anode gây phản ứng không đặc hiệu 2 MFC hai khoang với cathode chứa dung dịch chất điện ly - Dòng điện phát sinh cao, ổn định - Chất điện ly thƣờng là chất độc cần đƣợc thay thƣờng xuyên 3 MFC hai khoang với cathode chứa nƣớc đƣợc sục khí - Dòng điện phát sinh thấp, ổn định - Thuận tiện trong chế tạo và vận hành - Điện trở trong cao - Oxy có thể thấm qua màng vào khoang anode gây phản ứng không đặc hiệu 4 MFC dạng ống - Dòng điện phát sinh cao - Cơ chất bị phân hủy chiệt để - Không bị tắc nếu dung địch đầu vào vẩn đục - Oxy có thể thấm qua màng vào khoang anode gây phản ứng không đặc hiệu - Điện cực cathode có thể là trở ngại cho việc tiếp xúc với oxy nếu không đƣợc tƣới nƣớc hoặc dung dịch điện ly 46 Bảng 21: Tổng hợp các nghiên cứu về dạng MFC biosensor Dạng MFC Chất cho điện tử Nồng độ cao nhất có thể đo Dòng điện phát sinh cao nhất Thể tích khoang Thời gian cảm biến Tài liệu MFC hai khoang (không sử dụng chất chuyền điện tử) Nƣớc thải 25 mg O2/l BOD 1.1 mA 25 ml 30 phút– 10h Kim và cộng sự (2003) [25] MFC hai khoang dạng C Glucose và glutamate 200 mg O2/l BOD 2.9 mA 5 ml 5 phút-10h Kim và cộng sự (2006) [26] MFC hai khoang (không chất chuyền điện tử) Glucose và glutamate 100 mg O2/l BOD 6 mA 20 ml 60 phút Chang và cộng sự (2004) [13] MFC một khoang Nƣớc thải 250 mg O2/BOD 0.4 mA 12 ml Lớn hơn 60 phút Lorenzo và cộng sự (2009) [17] MFC một khoang Nƣớc thải 78 mg O2/l BOD 0,27 mA 9 ml 30 phút- 10h Peixoto và cộng sự (2011) [55] Sau khi tiến hành nghiên cứu và so sánh ƣu-nhƣợc điểm của các dạng thiết kế MFC tại Bảng 20 và 21, chúng tôi lựa chọn thiết kế MFC dựa trên mô hình của Kim và cộng sự năm 2006 [26]. Đây là dạng thiết kế MFC có thể tích khoang anode nhỏ nên sẽ cơ thời gian phản ứng với các nồng độ BOD khác nhau nhanh hơn. MFC của chúng tôi đƣợc thiết kế là dạng MFC hai khoang với dạng hình hộp và hình trụ, với ba thể tích khoang anode là: 5 ml; 7,5 ml; 10 ml. Hệ thống MFC vận hành với khoang cathode sử dụng nƣớc bão hòa oxy chạy tuần hoàn (nƣớc đƣợc thay 1 47 ngày/lần), còn khoang anode không sử dụng chất truyền điện tử trung gian, và dịch đầu vào anode chúng tôi không sử dụng nitơ để tạo điều kiện kỵ khí. Với những đặc điểm trên, chúng tôi mong đợi MFC có thể tích khoang nhỏ sẽ cho tốc độ cảm ứng với chất lƣợng nƣớc thải nhanh hơn. Việc không sử dụng dung dịch đầu vào anode kỵ khí, không sử dụng chất truyền đi

Các file đính kèm theo tài liệu này:

  • pdfluanvanthacsi_chuaphanloai_282_3801_1870173.pdf
Tài liệu liên quan