Luận văn Nghiên cứu sử dụng chỉthị its để đánh giá quan hệ di truyền và nhận dạng một số mẫu giống cây óc chó thu thập tại các tỉnh miền núi phía bắc

LỜI CAM ĐOAN

LỜI CẢM ƠN

DANH MỤC CÁC TỪ VIẾT TẮT

DANH MỤC HÌNH ẢNH

DANH MỤC BẢNG

MỤC LỤC . 1

MỞ ĐẦU. 3

CHƯƠNG I: TỔNG QUAN TÀI LIỆU. 6

1.1. GIỚI THIỆU VỀ CÂY ÓC CHÓ . 6

1.1.1. Nguồn gốc và phạm vi phân bố của cây Óc chó. 6

1.1.2. Đặc điểm thực vật học và thành phần hóa học trong hạt của cây óc

chó . 8

1.1.3. Đặc điểm sinh thái và phạm vi phân bố . 11

1.1.4. Giá trị sử dụng và giá trị kinh tế . 13

1.2. TỔNG QUAN PHƯƠNG PHÁP NGHIÊN CỨU VỀ PHÂN LOẠI

THỰC VẬT . 14

1.2.1. Các phương pháp phân loại dựa trên đặc điểm hình thái . 14

1.2.2. Các phương pháp dựa trên chỉ thị phân tử . 15

1.2.2.1. Các Marker phân tử dựa trên DNA. 15

1.2.2.2. Sử dụng các trình tự DNA bảo tồn cao trong phân tích quan hệ

phát sinh ở thực vật . 17

1.3. CÁC NGHIÊN CỨU VỀ ĐA DẠNG DI TRUYỀN ÓC CHÓ . 21

CHƯƠNG 2: VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU. 23

2.1. VẬT LIỆU. 23

2.2. HÓA CHẤT. 25

2.3. PHƯƠNG PHÁP NGHIÊN CỨU. 25

2.3.1. Tách chiết DNA tổng số. 25

pdf82 trang | Chia sẻ: honganh20 | Ngày: 03/03/2022 | Lượt xem: 305 | Lượt tải: 1download
Bạn đang xem trước 20 trang tài liệu Luận văn Nghiên cứu sử dụng chỉthị its để đánh giá quan hệ di truyền và nhận dạng một số mẫu giống cây óc chó thu thập tại các tỉnh miền núi phía bắc, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
truyền trong quả óc chó Ý dựa trên phân tích isozyme và tìm thấy sự khác biệt không đáng kể đối với các thông số di truyền được nghiên cứu [19]. Năm 1998, Nicese và cộng sự đã sử dụng chỉ thị RAPD để nghiên cứu sự đa dạng di truyền của 19 mẫu óc chó được sử dụng làm bố mẹ trong chương trình chọn tạo giống của trường đại học California. Kết quả cho thấy 19 mẫu nghiên cứu phân làm 2 nhóm, sự phân nhóm này liên quan đến nguồn gốc phả hệ của các mẫu. Các kiểu gen có chung cha hoặc mẹ thường có xu hướng tạo thành nhóm với nhau [23]. Wang và cộng sự (2008) đã sử dụng chỉ thị microsatellite để nghiên cứu đa dạng di truyền và cấu trúc của quần thể cây Óc chó Cùng Trung và Tây Nam Trung Quốc. Kết quả cho thấy quần thể này khá đa dạng, tỷ lệ dị hợp dao động từ 0,389 đến 0,687. Dựa vào cây phân loại, có thể thấy khoảng cách di tryền của quần thể có liên quan đến đến sự phân bố địa lý của chúng [24]. Miltiadis và cộng sự (2010) sử dụng chỉ thị ISSR để nghiên cứu sự đa dạng di truyền giữa các giống óc chó đang được canh tác với các giống bản địa tại Hy Lạp. Kết quả cho thấy các mẫu óc chó khảo sát có độ đa dạng di truyền rất cao với hệ số tương đồng di truyền dao động từ 0,13 đến 0,93. Kiểu gen của các giống óc chó bản địa đa dạng hơn nhiều so với các giống ngoại óc chó đang được canh tác [25]. 22 Uzma Noor Shah và cộng sự (2017) đã sử dụng 19 mồi SSR để đánh giá đa dạng di truyền các mẫu óc chó thu thập tại Jammu và Kashmir, Ấn Độ. Kết quả phân tích cho thấy 96 mẫu óc chó được khảo sát có tỷ lệ đa hình lên tới 89,6%, hệ số tương đồng di truyền dao động từ 0 đến 0,43, tỷ lệ dị hợp dao động từ 0,043 đến 0,067 [26]. Ciarmiello LF và cộng sự (2011) sử dụng cho 18 giống J. regia L. được phân lập từ các nguồn gốc địa lý khác nhau. Kích thước của các trình tự dao động từ 257 đến 263 căn cứ cho ITS1 và từ 217 đến 219 căn cứ cho ITS2. Sự thay đổi của các GC là 55-56,7% đối với ITS1 và 57,1-58,9% đối với ITS2. Dữ liệu này thể hiện sự hiện diện của đa hình trong các giống cây trồng. Sự sắp xếp của các chuỗi ITS1-5.8S-ITS2 từ 18 giống óc chó cho thấy có 244 đa hình đơn nucleotide (SNPs). Dự đoán cấu trúc thứ cấp ITS1 và ITS2 RNA từ mỗi giống đã được cải thiện bằng cách phát hiện các yếu tố chức năng chính được chia sẻ bởi tất cả các trình tự trong các sắp xếp. Phân tích phát sinh loài của vùng ITS1-5.8S-ITS2 phân tách rõ ràng trình tự cô lập thành hai cụm. Kết quả cho thấy vùng ITS1 và ITS2 có thể được sử dụng để phân biệt các giống cây Óc chó này [27]. Các nghiên cứu trên cho thấy rằng, marker phân tử ITS của DNA ribosome là phù hợp nhất để điều tra các mối quan hệ phát sinh và sinh học trong chi Juglans do RAPD và ISSR không phù hợp để xác định giống cây trồng do thiếu khả năng tái lặp còn SSR là sự khác biệt về kích thước giữa sản phẩm khuếch đại từ mỗi alen thường nhỏ, làm biến dạng đáng tin cậy bằng gel agarose tiêu chuẩn điện di. Đánh giá đa dạng di truyền là một trong vấn đề còn khá mới đối với các loài cây lâm nghiệp ở Việt Nam. Hiện nay, trong công tác bảo tồn nguồn gen và khai thác phát triển nguồn gen đang được quan tâm vấn đề đánh giá di truyền nguồn gen các loài cây, các giống cây trồng làm cơ sở cho việc lưu giữ, bảo tồn những nguồn gen có giá trị. Đến nay, chưa có công trình nào nghiên cứu xác định đa dạng di truyền nguồn gen cây Óc chó ở Việt Nam. Điều này là một trong những vấn đề còn tồn tại trong công tác bảo tồn và phát triển nguồn gen cây Óc chó. 23 CHƯƠNG 2: VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 2.1. VẬT LIỆU Vật liệu sử dụng trong nghiên cứu là 26 mẫu lá non cây Óc chó được thu thập tại các tỉnh miền núi phía Bắc gồm 9 mẫu thuộc huyện Đồng Văn, tỉnh Hà Giang; 5 mẫu thuộc huyện Sa Pa, tỉnh Lào Cai và 12 mẫu thuộc các huyện Sỉn Hồ và huyện Phong Thổ tỉnh Lai Châu do Viện Nghiên cứu Lâm sinh cung cấp. Bảng 2. 1: Danh sách 26 mẫu Óc chó STT Ký hiệu mẫu Địa điểm thu thập mẫu 1 HG1 Lũng Hoà B, Sà Phìn, Đồng Văn, Hà Giang 2 HG2 Sà Phìn A, Sà Phìn, Đồng Văn, Hà Giang 3 HG5 Sà Phìn A, Sà Phìn, Đồng Văn, Hà Giang 4 HG7 Há Hơ, Sà Phìn, Đồng Văn, Hà Giang 5 HG9 Lũng Thầu, Sà Phìn, Đồng Văn, Hà Giang 6 HG11 Lũng Thầu, Sà Phìn, Đồng Văn, Hà Giang 7 HG16 Lý Chá Tủng, Sà Phìn, Đồng Văn,Hà Giang 8 HG18 Thành Ma Tủng, Sà Phìn, Đồng Văn, Hà Giang 9 HG22 Séo Lủng B, Sảng Tủng, Đồng Văn, Hà Giang 10 LCa01 Tổ 3, xã Sa Pa, huyện Sa Pa, Lào Cai 24 11 LCa03 Tổ 3, xã Sa Pa, huyện Sa Pa, Lào Cai 12 LCa04 Tổ 3, xã Sa Pa, huyện Sa Pa, Lào Cai 13 LCa10 Tổ 13, TT Sa Pa, huyện Sa Pa, tỉnh Lào Cai 14 LCa12 Tổ 13, TT Sa Pa, huyện Sa Pa, tỉnh Lào Cai 15 LC3 Bành Phán, Tả Phìn, Sìn Hồ, Lai Châu 16 LC14 Xăng Tăng Ngai, Phan Xô Lin, Sìn Hồ, Lai Châu 17 LC18 Tủa Sín Chải, Sìn Hồ, Lai Châu 18 LC23 Sìn Hồ,Lai Châu 19 LC25 Làng Mô, Sìn Hồ, Lai Châu 20 LC37 Hợp 2, Dào San, Phong Thổ, Lai Châu 21 LC42 Cao Sín Chải, Dào San, Phong Thổ, Lai Châu 22 LC48 Lièng Chư, Dào San, Phong Thổ, Lai Châu 23 LC52 Hà Nhì,Tùng Qua Lìn, Phong Thổ, Lai Châu 24 LC55 Khấu Rào, Tùng Qua Lìn, Phong Thổ, Lai Châu 25 LC65 Pờ Xa, Pa Vây Sử, Phong Thổ, Lai Châu 26 LC68 Ngài Thầu, Pa Vây Sử, Phong Thổ, Lai Châu 25 2.2. HÓA CHẤT Một số hóa chất thông dụng dùng trong sinh học phân tử của các hãng Sigma, Merck,...CTAB, Tris base, Boric acid, NaCl, dNTPs, EDTA, 6X orange loading dye solution, Taq Polymeraza, Ethanol, 2-propanol, Acetic acid glacial, Phenol, Chloroform, isoamyalcohol, Agarose, kit Qiagen, các mồi ITS. Bảng 2. 2: Danh sách các mồi ITS (White và cộng sự, 1990)[28] TT Mồ i Trình tự Nucelotid ITS1 ́5’ TCCGTAGGTGAACCTTGCGG 3’ ITS8 5’ GCACTACGATGAAGAACGCT 3’ Kích thước đoạn DNA được khuếch đại bởi cặp mồi ITS 1-8 nằm trong khoảng 750-800bp. 2.3. PHƯƠNG PHÁP NGHIÊN CỨU 2.3.1. Tách chiết DNA tổng số Trong nghiên cứu này, chúng tôi đã lựa chọn phương pháp sử dụng CTAB của P. Doyle and Doyle (1987) [29] có một số cải tiến nhỏ để tiến hành tách chiết DNA từ các mẫu nghiên cứu. Quy trình: - Chuẩn bị sẵn dung dịch đệm chiết CTAB ở 60C. - Nghiền 0,3 gam mẫu lá bằng chày cối sứ vô trùng trong nitơ lỏng đến khi thành dạng bột mịn (mẫu óc chó, chày, cối được giữ trước ở - 80C). - Hoà tan mẫu đã nghiền nhỏ trong 800l CTAB buffer và 60l SDS 10%. Thành phần dung dịch đệm chiết: Tris-bazơ 100 mM, EDTA 20 mM, NaCl 1,4 M, CTAB 2% và PVP 1%. - Ủ mẫu ở 65C trong bể ổn nhiệt, thời gian 30 phút. - Làm nguội ở nhiệt độ phòng và bổ sung 200l potassium acetate 5M, trộn đều và ủ trên đá 45 phút. 26 - Bổ sung thể tích tương đương chloroform—isoamylalcohol (24:1), lắc nhẹ cho tới khi thành dạng nhũ sữa. Ly tâm 11000 vòng/phút trong 30 phút ở nhiệt độ 4C. Hút dung dịch phía trên chuyển sang ống mới. - Tiếp tục chiết lần 2 bằng chloroform—isoamylalcohol (24:1), thu được dịch chiết chứa DNA. - Tủa DNA bằng isopropanol đã làm lạnh. Để ở -20C trong 1 giờ. - Ly tâm thu tủa 11000 vòng/phút trong 15 phút ở 4C. - Rửa tủa bằng ethanol 70%, ly tâm thu tủa - Làm khô và hòa tan DNA, loại ARN, hoà tan DNA trong đệm TE. 2.3.2. Thành phần của 1 phản ứng PCR Mỗi phản ứng PCR bao gồm các thành phần: Bảng 2. 3: Thành phần phản ứng PCR STT Thành phần Thể tích (µl)1 1 Nước cất hai lần khử ion 9 2 Buffer Mg + 25 Mm 1,5 3 dNTPs 10 Mm 0,3 4 Taq DNA polymerase 5 U/µl 0,2 5 Mồi ITS1 10 µM 1,5 6 Mồi ITS8 10 µM 1.5 7 DNA 50ng/µl 1 Tổng thể tích của một phản ứng 15,0 2.3.3. Chương trình chạy PCR Phản ứng PCR được tiến hành trong ống eppendorf 0,2ml và thực hiện trên máy Mastercycler epgradient S theo chu trình sau: 27 Bảng 2. 4: Chu trình phản ứng PCR Các bước Nhiệt độ ( oC) Thời gian Chu kì 1 94 5 phút 1 2 94 1 phút 35 3 58 45 giây 4 72 50 giây 5 72 7 phút 1 6 4 ∞ 1 Sau khi hoàn thành chương trình chạy PCR, sản phẩm PCR được bổ sung 4µl loading dye rồi tiến hành điện di. 2.3.4. Phương pháp điện di trên agarose - Cân 0,6g agarose cho vào 40 ml TAE 1X, đun đến sôi để agarose tan hoàn toàn. Để nguội 45-50C bổ sung 2,5l Ethidium Bromide, đổ vào khuôn gel đã được chuẩn bị sẵn. Sau 30-60 phút, khi gel đã nguội và đông cứng thì chuyển khay chứa bản gel vào máy điện di và cho đệm chạy TAE 1X vào buồng điện di sao cho đệm ngập bản gel khoảng 0,5-1 cm. - Tra mẫu: Sản phẩm PCR được trộn với 4 l loading dye và tra vào các giếng trên gel. - Chạy điện di: Sau khi tra mẫu điện di xong, máy điện di được kết nối với bộ nguồn. Đặt 130 V. - Quan sát: gel được soi dưới đèn tử ngoại, DNA sẽ được phát sáng nhờ liên kết với Ethidium Bromide. 2.3.5. Phương pháp thôi gel theo kit Qiagen - Cắt lấy đoạn DNA mong muốn từ gel agarose, cho đoạn gel vừa cắt vào ống eppendorf 2ml. - Bổ sung buffer QG theo tỷ lệ 3 thể tích QG : 1 thể tích gel (100mg ~100μl). 28 - Ủ ở nhiệt độ 50°C trong khoảng 10 phút cho đến khi gel tan hoàn toàn. - Sau khi gel tan hoàn toàn, kiểm tra màu của dung dịch phải là màu vàng, nếu màu của dung dịch là màu cam hoặc màu tím xanh thì phải bổ sung 10μl sodium acetate 3M, pH 5. - Cho dung dịch mẫu đã hoà tan ở trên vào cột QIAquick và ly tâm tốc độ 13 000 rpm trong 1 phút. - Bổ sung 500 μl buffer QG vào cột QIAquick và ly tâm tốc độ 13 000 rpm trong 1 phút để loại hết agarose dư thừa. - Bổ sung 750 μl buffer PE vào cột QIAquick, để cột thẳng đứng 5 phút sau đó ly tâm tốc độ 13 000 rpm trong 1 phút. - Chuyển cột QIAquick sang ống microcentrifuge 1.5ml sạch. - Để hoà tan DNA, bổ sung 30 μl nước (pH 7 – 8.5) vào giữa màng của cột QIAquick và ly tâm tốc độ 13 000 rpm trong 1 phút, thu lượng DNA tinh sạch. 2.3.6. Giải trình tự Sản phẩm PCR ITS sau khi được tinh sạch, được giải trình tự tại công ty Macrogen (HànQuốc) bằng máy Applied Biosystems 3500.. Kết quả giải trình tự được được so sánh với các trình tự tương đồng trên NCBI bằng công cụ căn trình tự ClustalW của phần mềm Mega 6.0 và CLC 8.0. Sau đó, các trình tự được tập hợp lại và phân tích bằng chương trình MEGA v6.0 để tạo cây phát sinh loài. 29 CHƯƠNG 3: KẾT QUẢ VÀ THẢO LUẬN 3.1. KẾT QUẢ TÁCH CHIẾT DNA Tách chiết axit nucleic là công việc đầu tiên đóng vai trò quan trọng trong công nghệ DNA. Nhờ tiến bộ và sự đổi mới công nghệ mà tách chiết axit nucleic ngày nay đã trở nên đơn giản. Hiện nay có rất nhiều phương pháp tách chiết DNA tổng số của thực vật. Tuy nhiên đối với từng đối tượng nhất định cần có phương pháp riêng. Do vậy, việc lựa chọn và cải tiến phương pháp cho phù hợp với từng đối tượng là điều rất cần thiết và quan trọng. Trong nghiên cứu này, chúng tôi đã lựa chọn phương pháp sử dụng CTAB của P.Doyle and Doyle (1987)[29] có một số cải tiến nhỏ để tiến hành tách chiết DNA tổng số của 26 mẫu Óc chó nghiên cứu. Kết quả tách chiết DNA tổng số của 26 mẫu Óc chó được kiểm tra bằng phương pháp điện di trên gel agarose 1%. Hình 3. 1: Ảnh điện di DNA tổng số của 26 mẫu Óc chó Kết quả điện di trên gel agarose 1% ở Hình 3.1 thể hiện sản phẩm DNA tổng số rõ nét, rõ băng cho thấy chất lượng DNA của các mẫu tốt. Kết quả điện di cũng cho thấy DNA có nồng độ tương đối cao, đảm bảo mức độ nguyên vẹn và tinh sạch, đáp ứng được các yêu cầu dành cho việc phân tích đa hình di truyền trong các thí nghiệm tiếp theo. 30 3.2. KẾT QỦA PCR VÀ TINH SẠCH CÁC SẢN PHẨM KHUẾCH ĐẠI Sau khi thực hiện PCR, sản phẩm khuếch đại với cặp mồi ITS1/ITS8 và được điện di trên gel agarose 1,5% cho băng đơn hình với kích thước khoảng 750-800bp. Kết quả của đối chứng âm là nước không xuất hiện băng vạch chứng tỏ DNA đã được khuyếch đại và không bị nhiễm tạp chất. Kết quả được trình bày ở Hình 3.2. Hình 3. 2: Phổ điện di sản phẩm PCR với cặp mồi ITS1/ITS8 trên 26 mẫu Óc chó (M1KB: Marker ladder 1Kb; H2O: Đ/c âm) Kết quả khuếch đại sản phẩm PCR của từng mẫu được tiến hành thôi gel, sử dụng cột Sigma GenElute TM Agarose Spin column (USA), nhằm thu được sản phẩm PCR đặc hiệu. 3.3. KẾT QUẢ KHẢO SÁT VÙNG TRÌNH TỰ ITS1-5,8SrRNA-ITS2 Ở CÁC MẪU NGHIÊN CỨU Bên cạnh việc phân loại theo phương pháp truyền thống dựa vào việc so sánh hình thái giải phẫu của cơ quan sinh sản và dinh dưỡng, trong việc định loại các taxon sinh vật hiện đại, đặc biệt là các taxon có sự biến động hình thái lớn như các loại thực vật, trong đó có các loài thuộc chi Juglans, các dữ liệu về đặc tính phân loại và quan hệ phát sinh dựa trên các vùng bảo thủ cao (phylogenetical characteristics) đóng một vai trò quan trọng. Các dữ liệu này dựa trên đặc điểm trình tự các nucleotide của các vùng trình tự bảo 31 thủ cao trong bộ gen nói chung và các DNA barcode nói riêng nhiều khi chính là cơ sở để nhận dạng và định loại một số taxon của Óc chó. Việc xác định trình tự và sử dụng trình tự nucleotide đoạn ITS1- 5,8SrRNA-ITS2 để so sánh nhằm tìm ra mối quan hệ phát sinh giữa các loài hoặc sự đa dạng di truyền trong một chi, thậm chí các bậc phân loại dưới loài trong một loài đã được sử dụng phổ biến từ lâu trên thế giới. Sản phẩm PCR với cặp mồi ITS1/ITS8 (Bảng 2.2), sau khi tinh sạch được phân tích trực tiếp trên máy giải trình tự ABI PRISM 3100 DNA Analyzer (Applied Biotech) và phần mềm MEGA v6.0, kết quả cho ra giản đồ có các đỉnh (peak) với 4 màu sắc khác nhau tương ứng với 4 loại nucleotide và biểu thị dãy trình tự các nucleotide (Hình 3.3). Kết quả thu được 26 đoạn trình tự ITS của 26 mẫu Óc chó với số nucleotide khác nhau trên từng mẫu. 32 Hình 3. 3: Một đoạn giản đồ có các đỉnh với 4 màu sắc khác nhau tương ứng với 4 loại nucleotide của mẫu Óc chó HG02, HG05 và HG18 Thông qua quá trình khuếch đại và giải trình tự đối với các mẫu khảo sát theo phương pháp được nêu trong phần vật liệu và phương pháp nghiên cứu, xác định vùng ITS1-5,8SrRNA-ITS2 trên sản phẩm khuếch đại thông 33 qua việc căn trình tự và đối chiếu với các trình tự ITS1-5,8S rRNA và ITS2 của các taxon cùng chi trên Genbank, thu được các trình tự có độ dài được thể hiện trong Bảng 3.1. Bảng 3. 1: Độ dài các trình tự thuộc 26 mẫu Óc chó nghiên cứu và mẫu tham chiếu AF399876.1 STT Kí hiệu Tổng số nucleotide STT Kí hiệu Tổng số nucleotide 1 HG1 729 14 LCa12 729 2 HG2 729 15 LC3 729 3 HG5 729 16 LC14 731 4 HG7 729 17 LC18 729 5 HG9 729 18 LC23 729 6 HG11 729 19 LC25 729 7 HG16 729 20 LC37 729 8 HG18 729 21 LC42 729 9 HG22 729 22 LC48 729 10 LCa01 729 23 LC52 727 11 LCa03 729 24 LC55 726 12 LCa04 729 25 LC65 725 13 LCa10 733 26 LC68 729 27 AF399876.1* 729 Trung bình 728,9 *: Trình tự tương ứng của mẫu Óc chó được lấy từ Genbank với mã truy cập là AF399876.1.( https://www.ncbi.nlm.nih.gov/nuccore/AF399876.1 ) 34 Kết quả thu được từ Bảng 3.1. cho thấy độ dài vùng ITS1-5,8SrRNA- ITS2 có sự khác biệt nhau giữa các mẫu đại diện cho các taxon khảo sát, dao động từ 725 – 733 nucleotide. Khảo sát thành phần nucletotide thuộc các trình tự ITS1-5,8SrRNA- ITS2 của các mẫu nghiên cứu, thu được kết quả trình bày trong Bảng 3.2. Bảng 3. 2: Thành phần bốn loại nucleotide của 26 mẫu nghiên cứu và mẫu tham chiếu AF399876.1 STT Mẫu %T (U) %C %A %G %GC %AT 1 AF399876.1 21,3 27,9 22,7 28,1 56,0 44,0 2 HG1 21,7 27,8 22,4 28,1 56,0 44,0 3 HG02 22,2 27,4 22,2 28,1 55,6 44,4 4 HG05 21,9 27,8 22,1 28,1 56,0 44,0 5 HG7 21,8 27,8 22,4 28,0 55,8 44,2 6 HG9 21,7 27,8 22,5 28,0 55,8 44,2 7 HG11 21,9 28,0 21,8 28,3 56,2 43,8 8 HG16 21,8 27,8 22,4 28,0 55,8 44,2 9 HG18 21,8 28,0 22,4 27,8 55,8 44,2 10 HG22 21,8 27,6 22,4 28,3 55,8 44,2 11 LCa01 21,8 27,8 224 28,0 55,8 44,2 12 LCa03 21,8 27,8 22,4 28,0 55,8 44,2 Commented [TDT1]: Điều này chưa chính xác. Vì giải trình tự từ sản phẩm PCR nên sẽ mất khoảng 30-40 nu từ hai đầu do chất lượng base calling kém ở vùng gắn mồ i. Ở đây cần align và phân tích phần trình tự chung nhất của 26 mẫu phân tích và ref. thì mới có ý nghĩa 35 13 LCa04 21,8 27,8 22,4 28,0 55,8 44,2 14 LCa10 22,0 28,1 22,4 27,6 55,7 44,3 15 LCa12 21,8 27,8 22,4 28,0 55,8 44,2 16 LC3 21,7 27,8 22,6 27,8 55,7 44,3 17 LC14 21,8 28,0 22,3 27,9 56,0 44,0 18 LC18 21,8 27,7 22,6 27,8 55,6 44,4 19 LC23 21,9 27,7 22,4 28,0 55,7 44,3 20 LC25 21,8 27,8 22,4 28,0 55,8 44.,2 21 LC37 21,8 27,8 22,4 28,0 55,8 44,2 22 LC42 21,8 27,8 22,5 27,8 55,7 44,3 23 LC48 21,9 28,0 22,2 27,8 55,8 44,2 24 LC52 21,7 27,9 22,6 27,8 55,7 44,3 25 LC55 22,2 28,2 21,8 27,8 56,1 43,9 26 LC65 21,8 28,1 22,5 27,6 55,7 44,3 27 LC68 21,9 27,8 22,6 27,8 55,6 44,4 Trung bình 21,8 27,9 22,4 27,9 55,8 44,2 *Chú thích: T: Thymine, C: Cytosine, A: Adenine. G: Guanin Kết quả ở Bảng 3.2 cho thấy, thành phần Guanin, Cytosine, Adenine và Thymine của các mẫu nghiên cứu khác nhau trong đó tỉ lệ thành phần 36 Thymine là thấp nhất và Guanin cao nhất. Đây cũng là đặc điểm cho thấy sự khác nhau giữa các mẫu khảo sát dựa trên vùng ITS1-5,8SrRNA-ITS2. Nhìn chung, các mẫu nghiên cứu có tỷ lệ Guanin và Cytosine cao hơn tỷ lệ Adenine và Thymine hay nói một cách khác là đều có thành phần %GC cao hơn thành phần %AT và sự chênh lệch này có ở cây hai lá mầm. Mẫu HG11 có thành phần GC cao nhất (56,2 %) và có thành phần AT 43,8%) thấp nhất. Tỷ lệ thành phần %GC trung bình ở cả 26 mẫu nghiên cứu là 55,8% và tỷ lệ thành phần %AT trung bình 44,2% (Bảng 3.2). 3.4. KẾT QỦA SO SÁNH TRÌNH TỰ NUCLEOTIDE VÙNG ITS1 5,8SrRNA - ITS2 CỦA CÁC MẪU NGHIÊN CỨU Sản phẩm PCR sau khi được tinh sạch, được giải trình tự tại công ty Macrogen (Hàn Quốc). Kết quả giải trình tự được vùng ITS1-5,8S-ITS2 của các mẫu nghiên cứu được tiến hành so sánh với nhau bằng công cụ căn trình tự ClustalW của phần mềm Mega 6.0 và CLC 8.0, kết quả được thể hiện trong Hình 3.4. Commented [TDT2]: Statement này chưa vững chắc. Chiều dài trình tự của từng mẫu khác nhau (do kết qủa giải trình tự) nên sự khác nhau là ĐƯƠNG NHIÊN. Nếu ch ỉ phân tích cho vùng trình tự chung, kết quả mới chính xác 37 38 39 40 41 42 Hình 3. 4: Kết quả gióng hàng, gióng cột 26 trình tự ITS1-5,8SrRNA- ITS2 của 26 mẫu Óc chó và mẫu tham chiếu AF399876.1 Kết quả Hình 3.4, có thể nhận thấy sự khác biệt giữa các trình tự chủ yếu là các vị trị đa hình đơn (SNP) ở 26 mẫu nghiên cứu. Trong đó, 1 nucleotide bị thay thế bởi một nucleotide khác, bên cạnh đó cũng có một số đột biến InDel giữa các trình tự. Điều này có thể là do hệ quả sự biến động theo hướng mất hoặc tăng thêm (deletion và insertion) một hay một số nucleotide trong trình tự vùng ITS1-5,8SrRNA-ITS2 của các mẫu Óc chó khảo sát. Trình tự nucleotide của mẫu HG02, đây là mẫu nghiên cứu có nhiều điểm sai khác nhất trong dãy trình tự do đó mẫu này có sự khác biệt lớn nhất so với mẫu tham chiếu. Các mẫu như: LC52 mất 2 nucleotide tại vị trí 412- 413; LC55 mất đi 3 nucleotide ở vị trí số 656-658; LC65 mất 4 nucleotide tại vị trí 20 và 301-303 và Lca10 thêm 4 nucleotide ở vị trí 576-579. Một số 43 mẫu có sự sai khác rất ít trong dãy trình tự như HG18, LC23, LC42, LC68 chỉ có 1 điểm sai khác duy nhất. Hai mươi sáu mẫu Óc chó được nghiên cứu có sự khác biệt rất nhiều về trình tự vùng ITS1-5,8SrRNA-ITS2, sự biến động trình tự giữa các mẫu thể hiện rõ nhất ở khoảng 70 nucleotide đầu và 200 nucleotide cuối, đây chính là các vùng trống không mang mã hai phía của gen 5,8S rRNA. Nói cách khác, ở các mẫu Óc chó trong nghiên cứu này thì sự biến động trình tự xảy ra mạnh mẽ ở vùng ITS1 và ITS2 nhưng ít hơn ở vùng gen 5,8S rRNA. Sự biến động ít hay nhiều trong dãy trình tự của 26 mẫu Óc chó nghiên cứu đã thể hiện mối quan hệ về mặt di truyền, đồng thời sự khác nhau trong dãy trình tự của các mẫu cũng thể hiện được tính đa dạng của các mẫu nghiên cứu nhằm mục đích phân loại, chọn lọc được nguồn gen tốt. 3.5. KẾT QUẢ XÂY DỰNG CÂY QUAN HỆ PHÁT SINH GIỮA 26 MẪU NGHIÊN CỨU Sự khác biệt về trình tự vùng ITS1-rRNA-ITS2 giữa các mẫu nghiên cứu được thể hiện thông qua hệ số tương đồng của từng cặp mẫu, được tính toán bằng công cụ đo khoảng cách di truyền của phần mềm CLC v8.02 và thống kê chỉ ra ở Bảng 3.3. 44 Bảng 3. 3: Hệ số tương đồng di truyền giữa 26 mẫu nghiên cứu và mẫu tham chiếu AF399876.1 vào trình tự vùng ITS1-5,8SrRNA-ITS2 *Ghi chú: Thứ tự mẫu từ 1 đến 27 theo hàng ngang giống thứ tự mẫu theo hàng dọc Kết quả phân tích dựa vào đoạn trình tự ITS1-5,8S-ITS2 cho thấy, các mẫu Óc chó của Việt Nam khá đa dạng di truyền với hệ số tương đồng di truyền dao động từ 92,73% ( ở mẫu HG11) đến 100,00%, khác biệt di truyền gần nhất là 0,00 và xa nhất là 0,07. Nhiều mẫu óc chó có chung nguồn gốc do đó hệ số tương đồng di truyền của chúng là 100%. Với kết quả trên so với kết quả hệ số tương đồng (0,13-0,93) của Miltiadis và cộng sự (2010) sử dụng chỉ thị ISSR để nghiên cứu sự đa dạng di truyền giữa các giống óc chó đang được canh tác với các giống bản địa tại Hy Lạp thì thấp hơn (0,73). Còn so hệ số tương đồng (0,00-0,43) của Uzma Noor Shah và cộng sự Commented [TDT3]: “ ”Khác biệt” chứ không phải khoảng cách nhé. Khoảng cách “ distant” là phương pháp phân tích khác 45 (2016) đã sử dụng 19 mồi SSR để đánh giá đa dạng di truyền 96 mẫu óc chó thu thập tại Jammu và Kashmir, Ấn Độ thì cũng nhỏ hơn (0,36). Kết quả này rất hữu ích trong nghiên cứu về nguồn gốc, tiến hóa, quan hệ phát sinh chủng loại cây Óc chó của Việt Nam. Từ đó xác định chính xác những nguồn gen có năng suất, chất lượng cao phục vụ công tác nhân giống, phát triển và bảo tồn các nguồn gen Óc chó quý tại Việt Nam. Nếu chỉ xét riêng theo từng địa phương, Hà Giang là nơi độ đa dạng di truyền lớn hơn 2 địa phương còn lại. Các mẫu Óc chó thu thập tại Hà Giang có hệ số tương đồng dao động trong khoảng 93,55% -100%. Hệ số tương đồng di truyền của các mẫu Óc chó thu thập tại Lai Châu dao động trong khoảng 96,30%-100%. Hệ số tương đồng của các mẫu Óc chó thu thập tại Lào Cai dao động trong khoảng 98,23%-100%. Sau khi xác định được trình tự nucleotide vùng ITS1-5,8SrRNA-ITS2, tiến hành dựng cây quan hệ phát sinh bằng phần mềm Mega 6.0 theo phương pháp Maximum likelihood, kết quả thể hiện ở Hình 3.5. Commented [TDT4]: Cái này cần cẩn trọng. ITS là marker đặc hiệu gen trong khi các ch ỉ tị ISSR và SSR là ch ị thị phân bố trên hệ gen. Kết quả của ISSR và SSR có ý nghĩa hơn khi phân tích dưới loài vì đánh giá trên nhiều locus chứa SSR trên toàn hệ gen, trong khi ITS là marker phân loại mạnh ở cấp độ loài 46 Hình 3. 5: Sơ đồ hình cây về mối quan hệ di truyền giữa 26 mẫu nghiên cứu và mẫu tham chiếu AF399876.1 Qua Hình 3.5 cho thấy, dựa vào trình tự vùng ITS1-5,8SrRDN-ITS2, 26 mẫu Óc chó được khảo sát chia thành 3 nhóm chính dựa trên sự khác biệt di truyền của chúng:  Nhóm I: gồm có 2 taxon nghiên cứu là HG11 và HG02, hai mẫu này đều được thu tại xã Sà Phìn-huyện Đồng Văn- Hà Giang. Mẫu nghiên cứu HG11 có hệ số tương đồng di truyền với các mẫu còn lại dao động từ 92,73% (so với LC65) đến 95,20% (so với HG1), khoảng cách di truyền xa nhất là 0,07 và gần nhất là 0,03; và HG02 có hệ số tương đồng di truyền LC25 LC37 AF399876.1 HG7 HG16 LCa01 LCa03 LCa04 LCa12 LC14 LC23 LC68 LC52 HG18 LC42 HG9 LC18 LC65 HG22 LC55 LC3 LC48 LCa10 HG05 HG1 HG02 HG11 Commented [TDT5]: Lưu ý phylotree đang thể hiện khoảng cách di truyền “ ”distant”” chứ không phải mức độ tương đồng di truyền 47 với các mẫu còn lại từ 93,00% ( so với LC65) đến 95,75% (HG1), khoảng cách di truyền xa nhất là 0,07 và gần nhất 0,03.  Nhóm II: có một taxon nghiên cứu là HG1 (Lũng Hoà B, Hà Giang) có hệ số tương đồng di truyền với các mẫu còn lại dao động từ 95,20% (HG11) đến 97,94% ( HG18) và khoảng cách di truyền xa nhất là 0,05; gần nhất là 0,02.  Nhóm III: gồm 23 taxon nghiên cứu còn lại và mẫu tham chiếu. Nhóm này được chia thành 3 tiểu nhóm:  Nhóm 1: có một taxon nghiên cứu là HG05 (Sa Phìn A, Hà Giang) có hệ số tương đồng di truyền với các mẫu còn lại dao động từ 94,79% (so với HG11) đến 98,90% và khoảng cách di truyền xa nhất là 0,05 và gần nhất là 0,01.  Nhóm 2: chỉ có 01 taxon nghiên cứu là Lca10 có nguồn gốc ở Sa Pa, Lào Cai, có hệ số tương đồng di truyền với các mẫu còn lại dao động từ 93,59% (so với HG11) đến 98,23% và khoảng cách di truyền xa nhất là 0,06 và gần nhất là 0,01.  Nhóm 3: gồm 21 taxon nghiên cứu còn lại và mẫu tham chiếu. Nhóm này được chia thành 8 nhóm phụ: - Nhóm phụ 3.1: gồm 4 taxon nghiên cứu là HG22 (Séo Lủng B, Hà Giang ), LC55 (Khấu Rào, Lai Châu), LC3 (Bành Phán, Lai Châu) và LC48 (Lìeng Chư, Lai Châu). Hệ số tương đồng di truyền với các mẫu còn lại dao động từ 93,55% (so với HG11) đến 99,04%. Khoảng cách di truyền xa nhất là 0,07 (HG11) và khoảng cách di truyền thấp nhất là 0,01 chủ yếu với các mẫu nằm trong nhóm phụ 3.8. Nhóm phụ 3.2 : gồm 3 taxon nghiên cứu là HG9 (bản Sà Phìn A- Hà Giang), LC18( xã Tủa Sín Chải – Lai Châu) và LC65 (xã Pa Vây Sử- Lai Châu). Hệ số tương đồng

Các file đính kèm theo tài liệu này:

  • pdfluan_van_nghien_cuu_su_dung_chithi_its_de_danh_gia_quan_he_d.pdf
Tài liệu liên quan