Luận văn Nghiên cứu tính đa hình đơn nucleotid tại intron 1 và sự liên quan của gen FTO với bệnh đái tháo đường týp 2 ở người từ 40 đến 64 tuổi

DANH MỤC CÁC HÌNH VÀ BIỂU ĐỒ .iii

DANH MỤC CÁC BẢNG . iv

CÁC CHỮ VIẾT TẮT . v

ĐẶT VẤN ĐỀ. 1

CHƯƠNG I. TỔNG QUAN TÀI LIỆU. 3

1.1. TỔNG QUAN VỀ BỆNH ĐÁI THÁO ĐƯỜNG. 3

1.1.1. LƯợc sử nghiên cứu và thuật ngữ đái tháo đƯờng . 3

1.1.2. Đặc điểm dịch tễ học của bệnh đái tháo đƯờng. 4

1.1.3. Phân loại bệnh đái tháo đƯờng. 7

1.1.4. Các yếu tố nguy cơ của bệnh đái tháo đƯờng týp 2. 8

1.1.5. Cơ chế bệnh sinh của đái tháo đƯờng týp 2 . 12

1.1.6. Chẩn đoán bệnh đái tháo đƯờng . 13

1.2. TỔNG QUAN NGHIÊN CỨU VỀ GEN FTO . 16

1.2.1. Các gen có liên quan đến bệnh đái tháo đƯờng týp 2 . 16

1.2.2. LƯợc sử nghiên cứu về gen FTO . 17

1.2.3. Vị trí và cấu trúc của gen FTO . 19

1.2.4. Protein FTO. 20

1.2.5. Sự điều hòa và biểu hiện của gen FTO . 22

1.2.6. Chức năng của FTO . 23

1.2.7. Nghiên cứu gen Fto ở chuột và thiếu hụt chức năng gen FTO ở ngƯời

. 28

1.2.8. Sự liên quan của gen FTO với bệnh đái tháo đƯờng týp 2 . 30

CHƯƠNG II. PHƯƠNG PHÁP NGHIÊN CỨU . 35

2.1. ĐỐI TƯỢNG NGHIÊN CỨU . 35

2.2. HOÁ CHẤT VÀ TRANG THIẾT BỊ . 36

2.2.1. Hóa chất . 36

2.2.2. Trang thiết bị. 36

pdf77 trang | Chia sẻ: mimhthuy20 | Ngày: 22/09/2020 | Lượt xem: 275 | Lượt tải: 0download
Bạn đang xem trước 20 trang tài liệu Luận văn Nghiên cứu tính đa hình đơn nucleotid tại intron 1 và sự liên quan của gen FTO với bệnh đái tháo đường týp 2 ở người từ 40 đến 64 tuổi, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
thân Fto có thể ảnh hƣởng tới cân bằng năng lƣợng bằng cách tác động trực tiếp đến việc tiêu thụ thức ăn. Kết quả này cũng thống nhất với sự liên quan trực tiếp của các alen nguy cơ của FTO/Fto tới việc tăng tiêu thụ thức ăn. Chúng cũng tƣơng đồng với chứng bội thực đƣợc thấy ở chuột thiếu hụt Fto (Fto-/-), mặc dù cả 2 mô hình chuột thiếu hụt Fto đều có kiểu hình gầy. Điều đó cho thấy Fto ở ARC của vùng dƣới đồi đóng vai trò quan trọng trong kiểm soát tiêu thụ đƣa vào, Fto ở những vùng khác hoặc các mô khác (mà cũng bị ảnh hƣởng bởi sự thiếu hụt Fto chung) cũng chịu trách nhiệm đối với sự tăng tiêu thụ năng lƣợng đƣợc thấy ở cả 2 mô hình chuột. 1.2.6.4. Sự liên quan của FTO đối với cân bằng năng lượng Mối liên quan giữa các alen nguy cơ của FTO với sự tiêu thụ năng lƣợng đã đƣợc nghiên cứu. Mặc dù một vài nghiên cứu đã chỉ ra rằng sự tiêu thụ năng lƣợng tăng ở những ngƣời đồng hợp tử alen nguy cơ của FTO [32], tuy nhiên sự liên quan này không còn nữa khi tác giả hiệu chỉnh đối với BMI và khối nạc cơ thể. Một số nghiên cứu khác cũng không tìm ra đƣợc sự liên quan nào. Với những kết quả này, 28 ngƣời ta cho rằng gen FTO có ảnh hƣởng đối với năng lƣợng đƣa vào nhiều hơn đối với cân bằng năng lƣợng. Ở ngƣời, ảnh hƣởng của các SNP của gen FTO đối với trọng lƣợng cơ thể chủ yếu thông qua năng lƣợng tiêu thụ thì ở chuột Fto đóng vai trò trực tiếp trong cân bằng năng lƣợng bằng cách điều hòa việc tiêu thụ năng lƣợng. Thực vậy những ngƣời mang kiểu gen AA và AT của SNP rs9939609 có sự tăng năng lƣợng tiêu thụ cao hơn so với những ngƣời mang kiểu gen TT là 800 KJ/ngày, nhƣ vậy những ngƣời mang alen nguy cơ (A) sẽ có sự tăng cân nhiều và lâu dài trong suốt cả cuộc đời. Mặc dù đã có một số nghiên cứu về sự liên quan của các SNP của FTO với tiêu thụ năng lƣợng nhƣng kết quả vẫn còn chƣa thống nhất. Vấn đề chính gặp phải là các phép đo lƣờng chính xác thành phần tiêu thụ năng lƣợng trong cơ thể ngƣời gặp rất nhiều khó khăn về kỹ thuật. Những nghiên cứu gần đây ở cộng đồng ngƣời Châu Phi cũng đã thấy sự liên quan của gen FTO đối với bệnh béo phì. Tuy nhiên, trong những nghiên cứu này, mối liên quan mạnh nhất lại đƣợc thấy là ở 2 SNP ít đƣợc biết đến hơn là rs3751812 và rs9941349, điều đó khiến ngƣời ta nghi ngờ rằng những biến thể đã đƣợc nghiên cứu nhiều là rs9939609 và rs8050136 có thể không phải là những SNP liên quan chính ở cộng đồng ngƣời Châu Âu [58]. Trong một vài nghiên cứu ở ngƣời lớn và trẻ em, những bệnh nhân có ít nhất 1 alen nguy cơ của FTO thì có mức tiêu thụ thức ăn nhiều hơn, giảm đáp ứng no và thƣờng mất kiểm soát ăn hơn so với những ngƣời có đồng hợp tử alen không nguy cơ [106]. Nhiều nghiên cứu đã chỉ ra rằng sự tăng năng lƣợng tiêu thụ ở ngƣời có alen nguy cơ là do tăng sự ƣa thích đối với các thức ăn nhiều năng lƣợng, đặc biệt là những thức ăn có hàm lƣợng mỡ cao hơn là tăng về tổng lƣợng thức ăn tiêu thụ [32, 100]. 1.2.7. Nghiên cứu gen Fto ở chuột và thiếu hụt chức năng gen FTO ở ngƣời 1.2.7.1. Mô hình nghiên cứu ở chuột Gen Fto là một trong sáu gen liên tiếp nằm trong một đột biến mất đoạn 1.6Mb xảy ra tự nhiên ở mô hình chuột gọi là fused toes (Ft) [81]. Chuột đồng hợp tử Ft bị chết phôi với những dị tật nặng về sự phát triển của hệ thần kinh trung ƣơng, đƣợc mô tả là không có đối xứng phải-trái và chậm phát triển mà dẫn tới chết 29 trong khoảng thời gian phôi 10 ngày [24]. Chuột dị hợp tử có nhiều ngón chân (do vậy mà gọi là fused toes) ở chi trƣớc và tăng sinh tuyến ức [24]. Ngoài Fto, có 5 gen khác trong đột biến mất là Irx3, Irx 5, Irx6, Fts và Ftm (hiện nay đƣợc gọi là Rgrip1l). Mô hình chuột hoàn toàn không có Fto lần đầu tiên đƣợc nghiên cứu năm 2009, có biểu hiện kiểu hình phức tạp: chậm phát triển sau sinh, giảm mỡ và khối nạc cơ thể [48], tỷ lệ chết cao sau sinh cũng nhƣ là giảm hoạt động di chuyển tự phát. Điều ngạc nhiên là chuột dị hợp tử về đột biến mất Fto chịu đƣợc chế độ ăn giàu mỡ gây bệnh béo phì. Mô hình chuột với đột biến gen ENU (N-ethyl-N-nitrosourea) gây nên đột biến điểm ở Fto (I367F) làm mất một phần chức năng gen Fto cũng đã đƣợc nghiên cứu [39]. Giống nhƣ chuột mất hoàn toàn Fto, chuột đực mang gen I367F của Fto cũng giảm khối mỡ và bộc lộ tăng tiêu thụ năng lƣợng. Tuy nhiên, những chuột này không bị chậm phát triển, không bộc lộ chứng bội thực và giảm hoạt động di chuyển. Đột biến I367F làm cho Fto vẫn có một phần chức năng, do đó nó gây hậu quả nhẹ hơn là đột biến mất hoàn toàn, điều đó có thể giải thích cho khác biệt về khối lƣợng cơ thể, kích thƣớc, lƣỡng giới tính và không bị tử vong sớm ở thời kỳ bào thai từ tháng thứ 5 đến tháng thứ 8. Hai mô hình thiếu Fto ở chuột đã cung cấp những bằng chứng về vai trò của Fto đối với sự phát triển bình thƣờng của cơ thể, hệ thần kinh trung ƣơng và sự liên quan với tiêu thụ năng lƣợng. 1.2.7.2. Ảnh hưởng ở người bị thiếu chức năng gen FTO Năm 2009, Boissel và các cộng sự đã thấy nhiều gia đình cùng huyết thống ngƣời Palestin Ả Rập với 9 thành viên bị ảnh hƣởng bởi một hội chứng đa dị tật mà không rõ nguyên nhân, tất cả họ đều có kiểu gen đồng hợp tử đối với một đột biến từ arginine sang glutamine tại vị trí 316 (R316Q) ở gen FTO [29]. Do R316 là 1 trong 3 phần bắt buộc cần thiết cho sự bám của 2OG (đƣợc bảo tồn tuyệt đối trong họ AlkB ở tất cả các loài) nên đột biến này làm cho FTO mất hoạt tính xúc tác. Hội hội chứng đa di tật do đột biến R316Q gồm: chậm phát triển sau sinh, nhỏ đầu, thiếu nghiêm trọng chức năng của não, biến dạng mặt, dị tật tim và hở hàm ếch. Tuy nhiên, do kiểu hình dị tật nặng nhƣ vậy nên tất cả các cá thể bị ảnh hƣởng đều chết 30 trong vòng 30 tháng sau khi sinh và không có số liệu nhân trắc nào của thành viên trong gia đình không bị ảnh hƣởng và dị hợp tử đối với R316Q. Vì vậy ngƣời ta cho rằng FTO dƣờng nhƣ là rất cần thiết đối với sự phát triển bình thƣờng của rất nhiều hệ thống cơ quan bao gồm cả hệ thần kinh trung ƣơng, hệ tuần hoàn. Sự thiếu hoàn toàn hoạt tính xúc tác của FTO khiến cho cá thể không thể sống lâu đƣợc sau khi sinh. Những bất thƣờng chức năng não và sự phát triển của những ngƣời bị thiếu chức năng của gen FTO giống với kiểu hình của những bệnh nhân bị lặp một đoạn nhiễm sắc thể nhỏ mang gen FTO [94]. Do những cá thể bị ảnh hƣởng bởi đột biến thiếu chức năng (R316Q) ở dạng đồng hợp tử đều chết sớm và không có các số đo nhân trắc của bố mẹ ở dạng dị hợp tử hoặc họ hàng nên chỉ có thể dựa vào những đột biến làm thay đổi acid amin của gen FTO để xác định xem những đột biến đó có đƣợc tích lũy ở những cá thể gầy hoặc béo phì nặng hay không. Những đột biến làm thay đổi acid amin (mà tất cả đều đƣợc thấy ở dạng dị hợp tử) thì không khác biệt giữa nhóm ngƣời gầy và béo. Tuy nhiên có sự khác biệt đáng kể giữa 3 đột biến về mặt chức năng là R96H, R316Q và R322Q. R322 là Arginin thứ 2 bắt buộc cần thiết cho sự bám của 2OG và R96, và cần thiết để nhận biết cơ chất. Tất cả 3 đột biến này đều làm mất hoàn toàn hoạt tính xúc tác của FTO. R316Q đƣợc thấy ở dạng dị hợp tử ở những ngƣời gầy, trong khi đó R322Q và R96H lại đƣợc thấy ở cả nhóm gầy và béo. 1.2.8. Sự liên quan của gen FTO với bệnh đái tháo đƣờng týp 2 Các nghiên cứu ở nhiều dân tộc trên thế giới đã phát hiện ra mối liên quan của gen FTO đối với bệnh đái tháo đƣờng týp 2. Sau công bố đầu tiên của Frayling và Dina năm 2007 [42, 49], các nghiên cứu tiếp theo ở cộng đồng ngƣời Châu Âu [60], Nam Á [110], Đông Nam Á [35, 62, 72, 89] và gần đây là Châu Phi [55] đã chứng tỏ ảnh hƣởng của gen FTO đối với bệnh đái tháo đƣờng. Gen FTO là một gen lớn gồm hơn 400kb và 9 exon và có chứa rất nhiều vùng bảo thủ. Vùng intron 1 của gen FTO nằm trong một LD block dài 49 kb có chứa các SNP rs9939609, rs1421085, rs17817449 và rs8050136 đã đƣợc biết là liên quan mạnh với bệnh đái tháo đƣờng và béo phì [84]. Các SNP trên gen FTO có liên quan tới đái tháo đƣờng đã đƣợc 31 nghiên cứu nhiều ở các cộng đồng trên thế giới bao gồm: rs9940128, rs7191344 [110], rs8050136 [78], rs9939609 [49] (nằm ở intron 1), rs918031 và rs1588413 (nằm ở intron 8), rs11076023 (nằm ở vùng 3’ không dịch mã) [86]. Cho tới nay 2 SNP rs9939609 và rs8050136 là 2 SNP đƣợc nghiên cứu nhiều nhất đối với bệnh đái tháo đƣờng và béo phì. Tuy nhiên kết quả của các nghiên cứu ở các cộng đồng khác nhau vẫn chƣa hoàn toàn thống nhất và có những ý kiến cho rằng ảnh hƣởng của gen FTO đối với bệnh đái tháo đƣờng là do thông qua ảnh hƣởng của béo phì [49]. Năm 2010, Liu và các cs đã thực hiện nghiên cứu tổng hợp ở Châu Á và chứng minh rằng 2 SNP rs9939609 và rs8050136 nằm trên intron 1 của gen FTO có ảnh hƣởng đối với bệnh đái tháo đƣờng và ảnh hƣởng này hoàn toàn độc lập với ảnh hƣởng của béo phì (BMI). Mỗi alen nguy cơ của SNP rs9939609 làm tăng 1,12 lần (P = 9,8 x 10 -4 ) và SNP rs8050136 làm tăng 1,11 lần (P = 2,2 x 10-7) nguy cơ mắc đái tháo đƣờng so với ngƣời không mang alen nguy cơ ở ngƣời Châu Á [75]. Gần đây vào năm 2012, Li và các cs cũng thực hiện một nghiên cứu tổng hợp lớn bao gồm 32 nghiên cứu khác nhau với 96.551 ngƣời ở Đông và Nam Á về mối liên quan của gen FTO đối với bệnh đái tháo đƣờng. Nhóm tác giả cũng thu đƣợc kết quả giống nhƣ kết quả của nhóm nghiên cứu trƣớc đó. Mỗi alen nguy cơ của SNP rs9939609 làm tăng 1.15 lần (P = 5.5 x 10-8) nguy cơ mắc đái tháo đƣờng (Hình 1.10). Sau khi hiệu chỉnh với BMI thì mối liên quan vẫn không bị thay đổi với OR = 1,10; P = 6,6 x 10 -5 . Mặc dù có một số nghiên cứu khác không thấy đƣợc sự liên quan của gen FTO đối với bệnh đái tháo đƣờng hoặc chỉ thấy ảnh hƣởng nhỏ, tuy nhiên những kết quả chênh lệch này có thể do cỡ mẫu nghiên cứu chƣa đủ lớn để phát hiện ra ảnh hƣởng và do tần số alen nguy cơ của gen FTO (alen A của SNP rs9939609) ở ngƣời Châu Á thấp (16% ở ngƣời Hán ở Trung Quốc, 19% ở ngƣời Nhật Bản). Nghiên cứu tổng hợp ở Châu Âu cũng thấy kết quả tƣơng tự nhƣ vậy, SNP rs9939609 làm tăng 1,13 (P = 4,5 x 10-8) lần nguy cơ mắc đái tháo đƣờng ở ngƣời Châu Âu [60]. Một số SNP ở vùng intron 4 của gen FTO cũng gây tăng insulin lúc đói và tăng kháng insulin [65]. 32 Cho tới nay SNP rs9939609 đƣợc biết đến là có ảnh hƣởng mạnh nhất đối với bệnh béo phì ở ngƣời Châu Âu và có liên quan với bệnh đái tháo đƣờng týp 2 ở nhiều cộng đồng trên thế giới. Hơn nữa SNP rs9939609 còn đại diện cho chùm gồm 10 SNP nằm trong vùng intron 1 của gen FTO có liên quan rất mạnh đối với đái tháo đƣờng và béo phì (Hình 1.10). Do các SNP này nằm ở vùng intron của gen vì vậy mà vai trò của nó trong cơ chế bệnh sinh của đái tháo đƣờng hoặc béo phì đều chƣa đƣợc hiểu rõ. Mặt khác chính sự liên kết của các SNP này trong cùng LD block càng khiến cho việc nghiên cứu các SNP này trở nên khó khăn hơn vì khó xác định đƣợc chính xác ảnh hƣởng của SNP nào là chính trong cả vùng LD block [26]. Có thể ảnh hƣởng của SNP rs9939609 tới bệnh đái tháo đƣờng là ảnh hƣởng trực tiếp hoặc gián tiếp qua một SNP nào đó nằm trong cùng LD block. Do đó nghiên cứu SNP rs9939609 có thể giúp “hé lộ” chức năng, ảnh hƣởng của một SNP nào khác nằm trong vùng LD block đối với bệnh mà có thể là những SNP ảnh hƣởng trực tiếp đối với bệnh nhƣng vẫn chƣa đƣợc tìm ra. Gần đây SNP rs9939609 còn đƣợc biết đến có liên quan với tính kháng insulin và béo phì ở những ngƣời mắc hội chứng buồng trứng đa nang [111]. Hình 1.10. Cụm SNP tại intron 1 của gen FTO liên quan với đái tháo đƣờng týp 2 [48]. Cụm SNP tại intron 1 33 Hình 1.11. Sự liên quan của SNP rs9939609 với bệnh đái tháo đƣờng týp 2 trong nghiên cứu tổng hợp ở Đông và Nam Á [72] 1.2.9. Sự liên quan của gen FTO với các rối loạn khác ở ngƣời Mối liên quan giữa các biến thể của gen FTO và những rối loạn khác ở ngƣời vẫn tiếp tục đƣợc tìm thấy. Một công bố gần đây cho thấy các biến thể của FTO có mối liên quan với hội chứng mạch vành cấp tính, tăng áp lực máu và cƣờng androgen ở phụ nữ mắc hội chứng buồng trứng đa nang. Một nghiên cứu khác ở ngƣời già khỏe mạnh đƣợc chụp cộng hƣởng từ MRI não đã phát hiện ra sự teo cấu 34 trúc não ở những ngƣời có alen nguy cơ của gen FTO [70]. Các SNP nằm ở intron 1 của gen FTO có liên quan với nguy cơ ung thƣ vú, đặc biệt là các SNP rs1477196, rs9939609, rs7206790 và rs8047395. Trong một nghiên cứu tổng hợp hơn 20 nghiên cứu bệnh – chứng, gen FTO làm tăng 20% nguy cơ mắc ung thƣ vú ở phụ nữ có liên quan với đái tháo đƣờng týp 2. Trong 4 nghiên cứu thuần tập, nguy cơ ung thƣ vú tăng 24% ở những bệnh nhân bị đái tháo đƣờng týp 2. Gen FTO ở những mô vú bình thƣờng có mức độ biểu hiện mARN cao hơn đáng kể so với ở mô ung thƣ vú. Hơn nữa, khi so sánh các loại tế bào ung thƣ vú khác nhau thì không tìm thấy sự khác biệt đáng kể nào về mức độ biểu hiện của mARN của gen FTO. FTO có biểu hiện trong các mô ung vú của ngƣời và nó có vai trò trong quá trình đề methyl hóa, điều đó cho thấy ảnh hƣởng trực tiếp của gen FTO tới bệnh ung thƣ vú [67]. 35 CHƢƠNG II. PHƢƠNG PHÁP NGHIÊN CỨU 2.1. ĐỐI TƢỢNG NGHIÊN CỨU Đối tƣợng nghiên cứu đƣợc chọn từ cộng đồng với nhóm bệnh gồm 98 ngƣời bị đái tháo đƣờng týp 2 và nhóm chứng có 251 ngƣời bình thƣờng thuộc dân tộc Kinh có tuổi từ 40-64 sống tại tỉnh Hà Nam. Cách chọn đối tƣợng nghiên cứu qua 2 giai đoạn:  Giai đoạn 1. Điều tra sàng lọc ban đầu:  Chọn ngẫu nhiên 30 xã hoặc phƣờng trong tỉnh Hà Nam.  Trong mỗi xã (phƣờng) chọn ngẫu nhiên 100 ngƣời từ độ tuổi 40 đến 64 và không có quan hệ họ hàng.  Loại bỏ các đối tƣợng đang mang thai, đang ốm và những đối tƣợng có vấn đề về thần kinh hoặc không thể tham gia nghiên cứu. Kết quả của điều tra sàng lọc: 3.000 đối tƣợng từ độ tuổi 40 đến 64 tuổi đã đƣợc chọn ngẫu nhiên và là đại diện cho toàn thể ngƣời dân tộc Kinh sinh sống ở Hà Nam.  Giai đoạn 2. Chọn nhóm bệnh và nhóm chứng  Sau khi điều tra sàng lọc, mỗi đối tƣợng mắc đái tháo đƣờng týp 2 đƣợc ghép với 2 hoặc 3 đối tƣợng có glucose huyết tƣơng bình thƣờng và có tuổi tƣơng đƣơng với tuổi của đối tƣợng mắc đái tháo đƣờng (chênh lệch trên dƣới 3 tuổi), có cùng giới tính và ở cùng xã/phƣờng làm đối chứng. Kết quả: 349 ngƣời Kinh có độ tuổi từ 40 đến 64 tuổi đã tham gia vào nghiên cứu bao gồm: 98 đối tƣợng bị đái tháo đƣờng týp 2 và 251 ngƣời bình thƣờng làm đối chứng. 36 2.2. HOÁ CHẤT VÀ TRANG THIẾT BỊ 2.2.1. Hóa chất Trong nghiên cứu này chúng tôi sử dụng hóa chất sau:  Wizard Genomic DNA purification Kit (Promega)  GoTaq Green Master mix 2x (Promega)  Nƣớc tinh sạch GIBCO® UltraPure Distilled Water (Invitrogen)  PCR master mix 2x (Fermentas)  Enzyme giới hạn FasDigest® ScaI (Fermentas)  Thạch Agarose (Promega)  Đệm điện di UltraPureTM 10X TBE Buffer (Invitrogen)  RedSafeTM (Intron Biotechnology)  Thang ADN chuẩn ΦΧ174 DNA HaeII Gigest (Biolabs) 2.2.2. Trang thiết bị Trang thiết bị sử dụng trong nghiên cứu:  Máy NanoDrop 1000 (Nhật Bản)  Bể ổn nhiệt (Nhật Bản)  Máy PCR mastercycler epgradient (Eppendorf)  Máy điện di Mulpid Exu (Nhật Bản)  Máy ly tâm (Nhật Bản)  Máy minispin (Eppendorf)  Máy chụp Geldoc (Mỹ) 37 2.3. PHƢƠNG PHÁP NGHIÊN CỨU 2.3.1. Thiết kế nghiên cứu Nghiên cứu đƣợc thiết kế theo mô hình bệnh – chứng có đối tƣợng nghiên cứu đƣợc tuyển chọn từ cộng đồng để xác định tính đa hình và sự liên quan của gen FTO tại SNP rs9939609 đối với bệnh đái tháo đƣờng týp 2. 2.3.2. Các phƣơng pháp thu thập thông tin 2.3.2.1. Thu thập thông tin về đối tượng Phỏng vấn theo bộ câu hỏi để thu thập số liệu về đặc điểm của đối tƣợng nghiên cứu gồm: tuổi, dân tộc, trình độ văn hóa, nghề nghiệp, tình trạng hôn nhân, mức thu nhập, tiền sử bệnh tật, tiền sử hút thuốc, uống rƣợu, thời gian làm việc tĩnh tại, xem tivi và ngủ trƣa. 2.3.2.2. Đo các chỉ số nhân trắc, huyết áp Các chỉ số nhân trắc bao gồm chiều cao, cân nặng, số đo vòng eo và chu vi hông, tỉ lệ phần trăm mỡ cơ thể đƣợc đo 2 lần đối với mỗi ngƣời và tính giá trị trung bình để sử dụng cho phân tích. Đo chiều cao đứng bằng thƣớc gỗ chuẩn ở tƣ thế đứng thẳng và không mang giầy dép. Cân nặng đƣợc đo bằng cân điện tử OMRON khi đối tƣợng mặc áo nhẹ và không đi giầy, dép. Chỉ số khối cơ thể (BMI) đƣợc tính bằng cân nặng chia cho bình phƣơng chiều cao (kg/m2). Tỉ lệ eo – hông (waist – hip ratio WHR) đƣợc tính là chu vi vòng eo (cm) chia cho vòng hông (cm). Phần trăm mỡ cơ thể đƣợc tính bằng phƣơng pháp điện trở sinh học, sử dụng cân OMRON (HBF-351, Kyoto, Nhật Bản). Huyết áp đƣợc đo 2 lần ở trạng thái ngồi nghỉ sau khi đối tƣợng đã nghỉ ngơi ít nhất 5 phút, lấy giá trị trung bình để sử dụng cho phân tích. 2.3.2.3. Phương pháp chẩn đoán đái tháo đường Tất cả đối tƣợng đều đƣợc hƣớng dẫn nhịn đói qua đêm ít nhất 8 giờ trƣớc ngày lấy mẫu. Mẫu máu tĩnh mạch đƣợc lấy vào buổi sáng khi đói, đựng trong ống vô trung có chứa chất chống đông EDTA, đƣợc ly tâm ngay lập tức và giữ ở 2 – 8oC trong hộp đá, sau đó vận chuyển tới phòng xét nghiệm của Trung tâm Y tế Dự 38 phòng tỉnh Hà Nam để phân tích trong vòng 6 giờ. Các chỉ số glucose huyết tƣơng, cholesterol tổng số, HDL-C, LDL-C và triglyceride đƣợc đo bằng máy phân tích bán tự động (Screen Master Lab; Hospitex Diagnostics LIHD112, Italia) với bộ kit thƣơng mại (Chema.Diagnostica, Italia). Nồng độ glucose huyết tƣơng đƣợc đo bằng phƣơng pháp glucose oxy hóa (GOD-PAP). Cholesterol huyết thanh tổng số, HDL-C, LDL-C và triglyceride đƣợc đo bằng phƣơng pháp enzym. Chẩn đoán đái tháo đƣờng theo tiêu chuẩn của Tổ chức Y tế Thế giới và Liên đoàn đái tháo đƣờng Quốc tế, sử dụng chỉ số glucose huyết tƣơng tĩnh mạch lúc đói (fasting plasma glucose – FPG) và dung nạp glucose (oral glucose tolerance – OGT). Đối tƣợng đƣợc chẩn đoán mắc đái tháo đƣờng týp 2 nếu có FPG ≥ 7.0 mmol/L (126 mg/dL) hoặc OGTT sau 2 giờ ≥ 11.1 mmol/L (200 mg/dL) hoặc đã đƣợc chẩn đoán mắc đái tháo đƣờng týp 2 trƣớc đó và hiện đang sử dụng thuốc điều trị. Nồng độ glucose huyết thanh bình thƣờng đƣợc phân loại khi FPG < 5.6 mmol/L (100 mg/dL) và OGTT < 7.8 mmol/L (140/dL). 2.3.3. Các phƣơng pháp sinh học phân tử 2.3.3.1. Tách ADN Máu tĩnh mạch của đối tƣợng nghiên cứu đƣợc chống đông bằng EDTA. ADN tổng số đƣợc tách từ tế bào bạch cầu sử dụng bộ Kit Wizard® Genomic ADN Purification (Promega Corporation, USA). Các bƣớc tiến hành nhƣ sau: 1. Thêm 900 μl dung dịch Cell Lysic Solution vào ống 1,5 ml đã tiệt trùng 2. Lắc nhẹ ống máu đến khi trộn hoàn toàn; chuyển 300 μl máu sang ống chứa dung dịch Cell Lysic Solution. Đảo ống nhẹ nhàng 5 – 6 lần để trộn đều 3. Ủ dung dịch đã trộn 10 phút ở nhiệt độ phòng (đảo ống 2 – 3 lần khi ủ). Ly tâm ở 14.000xg trong 20 giây ở nhiệt độ phòng 4. Loại bỏ tối đa dung dịch nổi nhƣng không chạm vào hạt trắng có thể nhìn thấy ở đáy ống. Để lại khoảng 20 μl dung dịch 5. Thêm 100 μl dung dịch Cell Lysis Solution, làm lại bƣớc 3 và 4. Để lại khoảng 20 μl dung dịch 39 6. Thêm 300 μl dung dịch Nuclei Lysis Solution 7. Vortex cho tới khi tan kết tủa 8. Ủ dung dịch ở 37oC trong 30 phút cho tới khi kết tủa tan hoàn toàn 9. Làm mát ở nhiệt độ phòng (ít nhất 5 phút) 10. Thêm 1,5 μl dung dịch RNase Soulution vào và trộn mẫu bằng cách đảo đầu ống 2 – 5 lần 11. Ủ hỗn hợp ở 37oC trong 15 phút. Làm mát ở nhiệt độ phòng ít nhất là 5 phút 12. Thêm 100 μl dung dịch Protein Precipitation (có thể thấy kết tủa protein) 13. Vortex mạnh trong 10 – 20 giây 14. Ly tâm ở 13.000 – 16.000 xg trong 3 phút ở nhiệt độ phòng (xuất hiện kết tủa màu nâu ở đáy ống ) 15. Cho 300 μl isopropanol ở nhiệt độ phòng vào ống 1,5 ml vô trùng mới 16. Chuyển dung dịch nổi sau khi ly tâm ở bƣớc 14 vào ống chứa isopropanol. Chú ý không hút hết dung dịch và để đầu pipet chạm vào kết tủa protein tránh nhiễm ADN với kết tủa 17. Trộn nhẹ nhàng dung dịch bằng cách đảo đầu cho tới khi có thể nhìn thấy vẩn tủa là các sợi ADN màu trắng 18. Ly tâm ở 13.000 – 16.000 xg (có thể thấy hạt ADN vẩn tủa màu trắng) 19. Gạn bỏ dung dịch nổi, thấm dung dịch trên thành ống sau khi gạn 20. Thêm 300 μl cồn 70% ethanol ở nhiệt độ phòng, đảo nhẹ ống vài lần để rửa kết tủa ADN. Ly tâm 14.000 xg ở nhiệt độ phòng 21. Hút cẩn thận dung dịch ethanol bằng pipet (hoặc pipet Pasteur) 22. Đảo ống đặt trên giấy thấm và làm khô hạt tủa ở nhiệt độ phòng 23. Thêm 100 μl dung dịch ADN Rehydration Soulution vào ống 24. Ủ dung dịch qua đêm ở 4 oC (hoặc ủ qua đêm ở nhiệt độ phòng; hoặc ủ dung dịch ở 65 độ C trong 1 giờ, phải trộn dung dịch bằng cách búng nhẹ vào ống) 25. Bảo quản ADN ở âm 20oC. Dung dịch chứa ADN đƣợc đo nồng độ và đánh giá độ tinh sạch bằng máy NanoDrop. 40 2.3.3.2. Xác định kiểu gen bằng phương pháp ASP-PCR Nguyên lý phƣơng pháp ASP: Phƣơng pháp ASP đƣợc tiến hành trên hai phản ứng PCR song song riêng biệt, mỗi phản ứng sử dụng một cặp mồi đặc hiệu tại đầu 3’ để nhận biết một alen [16]. Cặp mồi sử dụng: Mồi xuôi F: 5’-ggctcttgaatgaaatagga-3’ Mồi ngƣợc phát hiện alen A: Ra:5’–agactatccaagtgcatcaga–3’ Mồi ngƣợc phát hiện alen T: Rt: 5’–agactatccaagtgcatcagt–3’ Chu trình nhiệt của phản ứng PCR như sau: Sản phẩm sau phản ứng PCR đƣợc điện di ở 100v trong 30 phút trên thạch Agarose 2,5%, sử dụng đệm TBE 0,5X. Băng sản phẩm đƣợc nhuộm RedSafe và chụp bằng máy GelDoc (Hình 3.1). Xác định kiểu gen của đối tượng dựa trên kết quả điện di: Có ba trƣờng hợp xảy ra: đồng hợp tử AA, dị hợp tử AT và đồng hợp tử TT.  Trƣờng hợp 1: PCR 1 (+); PCR 2 (-): Kiểu gen là AA (Ví dụ: số 20 trên băng điện di).  Trƣờng hợp 2: PCR 1 (-); PCR 2 (+): Kiểu gen là TT (Ví dụ: số 1,2, 4-10, 12, 13, 16, 18, 19, 21 trên băng điện di).  Trƣờng hợp 3: PCR 1(+); PCR (2) (+): Kiểu gen là AT (Ví dụ: số 3, 11, 14, 15, 17, 22 trên băng diện di). Nếu cả PCR 1 và PCR 2 đều không xuất hiện băng sản phẩm thì cần phải kiểm tra lại. 41 2.3.3.3. Xác định kiểu gen bằng phương pháp RFLP-PCR Kiểm tra ngẫu nhiên 10% số mẫu bằng phƣơng pháp RFLP–PCR để kiểm tra sự chính xác của phƣơng pháp ASP [16]. Phƣơng pháp PRFP–PCR là phƣơng pháp nghiên cứu tính đa hình chiều dài của các phân đoạn ADN dựa trên điểm cắt của các enzyme giới hạn (Restriction Enzyme, RE). Nguyên tắc của kỹ thuật này dựa trên độ đặc hiệu của các enzyme cắt giới hạn đối với vị trí nhận biết của chúng trên ADN bộ gen. Khi ủ với enzyme giới hạn ở dung dịch đệm, pH, nhiệt độ và thời gian thích hợp, đoạn ADN sẽ bị enzyme giới hạn cắt ở vị trí đặc hiệu để tạo ra những phân đoạn ADN với kích thƣớc khác nhau. Dựa vào kích thƣớc các đoạn sau khi cắt để xác định alen và kiểu gen. Trong nghiên cứu này chúng tôi thiết kế phƣơng pháp RFLP–PCR gồm 4 bƣớc sau: Bước 1. Dùng phản ứng nhân gen (PCR) để khuếch đại đoạn gen chứa SNP.  Enzyme cắt giới hạn: FastDigest®ScaI (Fermentas) Vị trí nhận biết của ScaI: 5'... A G T↓A C T...3' 3'....T C A↑T G A...5'  Cặp mồi đƣợc sử dụng:  Mồi xuôi F: 5’ggctcttgaatgaaatagga3’  Mồi ngƣợc R: 5’agagactatccaagtgcagtac3’  Chu trình nhiệt của phản ứng PCR: Điện di 5 µl sản phẩm trên thạch agarose 2,5 %, đệm TBE 0.5x trong 30 phút ở 100v, nhuộm RedSafe và chụp hình để kiểm tra kết quả. 42 Bước 2. Ủ sản phẩm PCR với enzyme đặc hiệu. Những mẫu có băng 170 bp rõ nét đƣợc ủ enzyme giới hạn FastDigest ScaI trong 15 phút với các thành phần gồm: 5 µl sản phẩm PCR, 0,8 µl 10x FastDigest, 0,2 µl enzyme FastDigest ® ScaI, và 4 µl nƣớc tinh sạch. Điện di 10 µl sản phẩm sau khi ủ trên thạch agarose 2,5%, đệm TBE 0,5x trong 40 phút ở 100v, nhuộm RedSafe và chụp hình sản phẩm điện di sau khi ủ enzym cắt giới hạn (Hình 3.2). Bước 3. Nhận định kiểu gen từ sản phẩm  Kiểu gen TT: băng 170 bp ( mẫu số 1-5, 7, 11, 12 và 16)  Kiểu gen AA: băng 150 bp và 20 bp (mẫu số 14)  Kiểu gen AT: băng 170 bp, 150 bp và 20 bp (mẫu số 6 – 8 và 13) Băng sản phẩm 20 bp không xuất hiện do kích thƣớc nhỏ đã chạy ra khỏi bản thạch trong quá trình điện di. So sánh kết quả xác định các kiểu gen bằng phƣơng pháp RFLP-PCR ở 10% mẫu với kết quả xác định SNP bằng phƣơng pháp AS-PCR cho thấy: Tất cả các mẫu đều cho kết quả tƣơng đồng ở cả hai phƣơng pháp. 2.3.4. Phƣơng pháp phân tích thống kê Sử dụng phần mềm phân tích SPSS để phân tích thống kê. Phân loại các biến số lƣợng và biến phân hạng. Các biến số lƣợng đƣợc kiểm tra phân bố theo phân phối chuẩn bằng kiểm định Kolmologov-Smirnov. Tần số của các alen đƣợc kiểm tra phân bố theo định luật cân bằng Hardy – Weinberg bằng kiểm định Khi bình phƣơng (χ2). So sánh giá trị trung bình của các biến theo phân phối chuẩn bằng kiểm định Student T-test. So sánh giá trị trung bình của các biến không theo phân phối chuẩn bằng kiểm định Mann-Whitney. Phân tích mối liên quan của kiểu gen với bệnh đái tháo đƣờng bằng hồi quy logistic đơn biến và hồi quy logistic đa biến. Kiểu gen AA, AT và TT đƣợc mã hóa và đƣa vào các mô hình giả định: Mô hình trội, mô hình cộng hợp trội, mô hình siêu trội, mô hình lặn và m

Các file đính kèm theo tài liệu này:

  • pdfluanvanthacsi_chuaphanloai_238_8363_1870139.pdf
Tài liệu liên quan