Luận văn Sàng lọc đột biến gen Rb1 thể di truyền trên các bệnh nhân ung thư tại Việt Nam

MỞ ĐẦU.1

CHưƠNG 1: TỔNG QUAN TÀI LIỆU.4

1.1. GIỚI THIỆU CHUNG VỀ BỆNH U NGUYÊN BÀO VÕNG MẠC . 4

1.1.1. Tình hình u nguyên bào võng mạc trên thế giới và ở Việt Nam.4

1.1.2. Biểu hiện lâm sàng của UNBVM. .6

1.1.3. Chẩn đoán UNBVM.6

1.1.4. Phân loại UNBVM.8

1.1.5. Điều trị UNBVM.10

1.1.6. Tư vấn di truyền cho bệnh nhân u nguyên bào võng mạc .13

1.1.7. Cơ chế gây bệnh u nguyên bào võng mạc.15

1.1.7.1. t p tron n u n p n.17

1.1.7.2. Hoạt độn t t n N po m r s tron t n p N .17

1.1.7.3. p n t t n n m s t .18

1.2. GIỚI THIỆU VỀ GEN RB1.19

1.3. CÁCH TIẾP CẬN VÀ PHưƠNG PHÁP NGHIÊN CỨU, KỸ THUẬT

SỬ DỤNG NHẰM XÁC ĐỊNH ĐỘT BIẾN GEN RB1 TRÊN THẾ GIỚI VÀ

VIỆT NAM .21

CHưƠNG 2: NGUYÊN VẬT LİỆU VÀ PHưƠNG PHÁP NGHİÊN CỨU.23

2.1. VẬT LİỆU NGHİÊN CỨU .23

2.1.1. Đối tượng nghiên cứu.23

pdf71 trang | Chia sẻ: honganh20 | Ngày: 04/03/2022 | Lượt xem: 77 | Lượt tải: 0download
Bạn đang xem trước 20 trang tài liệu Luận văn Sàng lọc đột biến gen Rb1 thể di truyền trên các bệnh nhân ung thư tại Việt Nam, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
ng của UNBVM, ngƣời ta đƣa ra các giả thuyết về cơ chế phân tử của bệnh: chịu trách nhiệm cho sự hình thành khối u là gen RB1, protein RB (pRB) tác động vào chu kỳ tế bào. Khi gắn với yếu tố phiên mã E2F, pRB ức chế sự sinh sản tế bào. Khi không có pRB, các phôi bào sinh sản bất tận dẫn đến bệnh ung thƣ. Hoạt động tƣơng tác giữa pRB và E2F đƣợc điều hòa bởi các yếu tố nhƣ cyclin D1, cdk4 và p16 [35]. Một alen hoạt động của gen RB1 cũng có khả năng ngăn chặn sinh ung thƣ, do đó, sự chuyển dạng ác tính của các tế bào võng mạc xảy ra khi cả 2 alen của gen RB1 bị đột biến mất chức năng. Phát hiện này củng cố giả thuyết “two hit” của Knudson, cho rằng UNBVM hình thành cần có hai cú hích gây tổn thƣơng di truyền: lần 1 (đột biến dòng mầm tế bào sinh dục) đột biến xảy ra trên các exon của gen RB1, lần 2 (đột biến thể soma) làm sai lệch sinh sản tế bào dẫn đến sự hình thành khối u [36] [37]. Cơ chế bệnh sinh này đƣợc giải thích tốt nhất bằng việc khảo sát sự di truyền của UNBVM. Với bệnh nhân mà gia đình không có tiền sử bệnh: ngay tại hợp tử không mang gen RB1 đột biến, tế bào cần trải qua hai sự kiện đột biến tế bào soma trên 2 alen của cùng một gen RB1 [38]. Đối với bệnh nhân mà gia đình có tiền sử gây 16 bệnh, ngay tại giai đoạn hợp tử bệnh nhân đã mang một gen RB1 đột biến, chỉ cần trải qua một sự kiện đột biến trên tế bào soma là có khả năng gây nên kiểu hình ung thƣ. Bất kể các đột biến ban đầu là do di truyền hay do phát sinh trên tế bào soma, các tế bào võng mạc chỉ trở thành ác tính khi bị mất bản sao bình thƣờng còn lại của RB1. Mất alen RB1 chức năng thứ hai có thể là do một đột biến soma riêng biệt (~30% các khối u), sự methyl hóa quá mức (tỷ lệ nhỏ các khối u), hoặc mất trạng thái dị hợp tử (~70% các khối u). Mất trạng thái dị hợp xảy ra do tái tổ hợp trong nguyên phân bào, phân ly bất thƣờng của nhiễm sắc thể, hoặc mất đoạn lớn [39]. Hình 1.5: Giải th ch về mặt di truyền đột biến mất chức năng gen RB1[40] T đó, ngƣời ta đƣa ra một số giả thuyết gây nên hiện tƣợng đột biến trên gen Rb1 gồm: Tái tổ hợp trong nguyên phân, hoạt động bất thƣờng của DNA polymerase trong tổng hợp DNA và sự phân chia bất thƣờng của nhiễm sắc thể [40]. 17 1.1.7.1. t p tron n u n p n Hai nhiễm sắc thể tƣơng đồng mang 2 alen dị hợp, tại giai đoạn pha S, bộ gen nhân đôi, đồng thời nhiễm sắc thể mang gen đột biến mất chức năng Rb cũng đƣợc nhân đôi; tại pha G2 và M xảy ra hiện tƣợng tái tổ hợp trong nguyên phân một phần của hai nhiễm sắc thể tƣơng đồng. Khi các nhiễm sắc thể sắp xếp trên mặt phẳng x ch đạo của thoi vô sắc, quá trình phân chia nhiễm sắc thể một cách ngẫu nhiên diễn ra và có thể tạo thành dạng tế bào mang đồng thời hai đoạn gen chứa hai alen đột biến của gen RB1 [40]. Hình 1.6: Tái tổ hợp trong nguyên phân [40]. 1.1.7.2. Hoạt độn t t n N po m r s tron t n p DNA Trong quá trình này, enzyme tham gia quá trình tự sao là DNA polymerase nhảy khỏi mạch khuôn ban đầu của nó, chuyển sang mạch khuôn của gen tƣơng đồng và tổng hợp một đoạn. Khi tổng hợp xong, DNA polymerase lại nhảy trở lại mạch khuôn ban đầu và tiếp tục tổng hợp kéo dài mạch bổ sung của nó. Kết quả là sau khi đƣợc sao ch p, mạch mới sẽ mang một phần vật liệu di 18 truyền của cặp tƣơng đồng. Nếu gen ức chế khối u bị đột biến mất chức năng nằm trên đoạn gen này, bộ nhiễm sắc thể sau sao ch p sẽ mang ba alen đột biến và trong quá trình phân ly nhiễm sắc thể về hai cực của tế bào, có khả năng hình thành tế bào mang 2 alen đột biến mất chức năng và sinh ung thƣ [40]. Hình 1.7: Hoạt động bất thƣờng của DNA polymerase trong sao ch p DNA [40]. 1.1.7.3. p n t t n n m s t Trong quá trình này, nhiễm sắc thể của cặp tƣơng đồng vẫn nhân đôi bình thƣờng để chuẩn bị cho quá trình nguyên phân phân chia nhiễm sắc thể về hai tế bào con. Tuy nhiên, quá trình phân chia này diễn ra không chính xác, một tế bào con giữ ba nhiễm sắc thể (triploid – tam bội) của cặp tƣơng đồng, còn một tế bào con chỉ chứa một nhiễm sắc thể. Tế bào chứa ba nhiễm sắc thể tƣơng đồng sẽ có xu hƣớng loại bỏ bớt một nhiễm sắc thể không cần thiết và nếu nhiễm sắc thể đó mang gen có chức năng, hai nhiễm sắc thể đƣợc giữ lại đều mang hai alen đột biến, hiện tƣợng mất trạng thái dị hợp đã diễn ra, có thể dẫn đến ung thƣ [40]. 19 Hình 1.8: Sự phân chia bất thƣờng của nhiễm sắc thể trong nguyên phân [40]. 1.2. GIỚI THIỆU VỀ GEN RB1 Theo thống kê, khoảng 40% ca UNBVM là thể di truyền trong khi 60% số ca còn lại là thể không di truyền. Khi quan sát các trƣờng hợp UNBVM có yếu tố gia đình hoặc không có yếu tố gia đình, ngƣời ta cho rằng tất cả các trƣờng hợp UNBVM là hậu quả của đột biến mất chức năng gen RB1 nằm trên NST13q14 [7]. Gen RB1 có 27 exon và 26 introns với khối lƣợng phân tử là 180kb đƣợc tạo thành t 31-1889 cặp base. Sản phẩm gen là phosphoprotein p110 (có trọng lƣợng phân tử là 110 kDa) có 928 acid amin. Hình 1.9: Vị tr gen RB1 trên nhiễm sắc thể số 13. 20 Hình 1.10: Cấu trúc gen và protein RB1 RB1 mã hóa cho protein RB, protein này hoạt động nhƣ một chất kiềm chế khối u, có nghĩa là nó điều chỉnh sự tăng trƣởng tế bào và giữ cho tế bào không phân chia quá nhanh hoặc theo một cách không kiểm soát đƣợc. Cơ chế gây bệnh: RB1 bị ức chế khi bị phosphoryl hóa bởi các enzyme kinase phụ thuộc cyclin (cyclin dependent kinase) nhƣng sẽ ở trạng thái hoạt động khi không bị phosphoryl hóa một cách tƣơng đối. Ở trạng thái hoạt động, pRB gắn với các thành phần trong phức hệ phiên mã E2F và bất hoạt chúng, phức hệ này có vai trò quan trọng trong việc thúc đẩy tế bào bƣớc vào giai đoạn S, giai đoạn tổng hợp DNA trong chu kỳ tế bào cho nên khi pRb hoạt động sẽ làm đình chỉ quá trình tăng sinh tế bào. Với t nh năng nhƣ vậy bình thƣờng pRb hoạt động nhƣ một cái “hãm” cho hoạt động sinh sản tế bào và khi pRb bị bất hoạt do bị phosphoryl hóa thì hoạt động sinh sản tế bào mới bắt đầu trở lại. Khi xảy ra các đột biến làm mất chức năng của gen RB1 hoặc trong những trƣờng hợp gia tăng sự methyl hóa vùng 5’ của gen này có thể dẫn tới tình trạng bất hoạt thƣờng xuyên của gen, khi đó cơ chế kìm hãm hoạt động sinh sản của tế bào không còn nữa, tế bào sẽ tăng sinh không kiểm soát gây ung thƣ [41]. Knudson đã đƣa ra giả thuyết lần một đột biến xảy ra trên các exon của gen RB1, lần hai đột biến soma làm sai lệch tế bào sinh sản dẫn đến sự hình 21 thành khối u. Các đột biến trong gene RB1 mang t nh chất không đồng nhất và phân bố trên cả vùng promoter cũng nhƣ 27 exon. Hơn hai phần ba các đột biến trong gen RB1 đƣợc dự đoán là tạo nên kết thúc dịch mã sớm-dẫn tới hình thành protein RB không hoàn chỉnh [42]. Một báo cáo năm 2005 đã thống kê đƣợc 16 điểm nóng đột biến của gen RB1 bao gồm các dạng đột biến vô nghĩa, đột biến ảnh hƣởng tới phân cắt mRNA và đột biến sai nghĩa. Phần lớn các đột biến tái phát xảy ra do sự thay đổi C>T trong 11 bộ ba CGA tại các exon 8, 10, 11, 14, 15, 17, 18 và 23 [43]. Cho đến nay, hơn 1700 đột biến đã đƣợc đƣa vào cơ sở dữ liệu đột biến gen RB1 (RB1 Gene Mutation Database). 1.3. CÁCH TIẾP CẬN VÀ PHƢƠNG PHÁP NGHIÊN CỨU, KỸ THUẬT SỬ DỤNG NHẰM XÁC ĐỊNH ĐỘT BIẾN GEN RB1 TRÊN THẾ GIỚI VÀ VIỆT NAM Phƣơng pháp x t nghiệm phân tử để xác định các bệnh nhân UNBVM có phải thuộc dạng di truyền hay không bao gồm các xét nghiệm đơn gen, đối với các bệnh nhân bị UNBVM một bên mắt, 2 bên mắt hoặc bị một bên mắt nhƣng có nhiều khối u. Phân tích trình tự và phân tích mất/lặp đoạn lớn gen RB1 đƣợc thực hiện trên DNA máu ngoại vi. Đối với các bệnh nhân bị UNBVM một bên mắt nhƣng có nhiều khối u và không có tiền sử gia đình, nếu không có mẫu mô khối u, phân tích trình tự và phân tích mất/lặp đoạn lớn gen RB1 đƣợc thực hiện trên DNA máu ngoại vi. Nếu có mẫu mô khối u, phân tích trình tự và phân tích mất/lặp đoạn lớn gen RB1 đƣợc thực hiện trên DNA mẫu mô trƣớc sau đó tiến hành trên DNA t máu để kiểm tra sự có mặt của biến thể này. Phân tích trình tự nhằm phát hiện các đột biến điểm có khả năng gây bệnh hoặc gây bệnh điểm trên vùng promoter, trên các exon và cả vùng nối intron-exon của gen RB1. Biến thể gây bệnh có thể bao gồm các mất/lặp đoạn nhỏ và các biến thể vô nghĩa, sai 22 nghĩa và các điểm cắt nối tạo mRNA; tuy nhiên phƣơng pháp này không phát hiện đƣợc các đột biến mất/lặp đoạn lớn. Các phƣơng pháp phân t ch mất/ lặp đoạn đƣợc sử dụng bao gồm PCR định lƣợng (qPCR), long-range PCR, multiplex ligation-dependent probe amplification (MLPA) và microarray [20]. Bên cạnh đó, một nghiên cứu năm 2016 tại Mỹ đã sử dụng công nghệ giải trình tự thế hệ mới cho ph p xác định đƣợc các đột biến điểm, các indels nhỏ và mất đoạn/lặp đoạn lớn trên toàn bộ gen RB1. Phƣơng pháp này cũng cho ph p xác định đƣợc những đột biến dạng khảm trong mẫu máu [8]. Hiện nay, quy trình thông thƣờng cho xét nghiệm đột biến gen RB1 là kết hợp sàng lọc các vùng mã hóa bằng giải trình tự với các phân tích mất đoạn/lặp đoạn lớn bằng MLPA. Một số kết quả nghiên cứu cho thấy khi kết hợp hai kĩ thuật giải trình tự và MLPA đã làm tăng độ nhạy trong chẩn đoán. Cụ thể, nghiên cứu của nhóm Trung Quốc cho thấy tỉ lệ phát hiện đột biến tăng t 78.6% (sử dụng kĩ thuật giải trình tự) lên 92.3% (kết hợp giải trình tự với MLPA) [44]. Nghiên cứu trên các bệnh nhân ngƣời Malaysia cũng báo cáo tỉ lệ phát hiện đột biến là 52.6% (kết hợp giải trình tự với MLPA)-cao hơn 36.8% (sử dụng kĩ thuật giải trình tự) và 15.8% (sử dụng kĩ thuật MLPA) [45]. Ngoài ra, kĩ thuật MLPA kết hợp với giải trình tự gen cũng đã đƣợc sử dụng trong sàng lọc đột biến gen RB1 trên các bệnh nhân u nguyên bào võng mạc ở Iran, Brazil, Argentina và Singapore [30] [46] [47] [48]. 23 CHƢƠNG 2: NGUYÊN VẬT LİỆU VÀ PHƢƠNG PHÁP NGHİÊN CỨU 2.1. VẬT LİỆU NGHİÊN CỨU 2.1.1. Đối tƣợng nghiên cứu. Đối tƣợng nghiên cứu là ba mƣơi bệnh nhi đã đƣợc chẩn đoán UNBVM trên lâm sàng và cận lâm sàng t năm 2013 đến 2018 tại Bệnh viện Mắt trung ƣơng. Chẩn đoán UNBVM đƣợc thiết lập theo tiêu chuẩn nhãn khoa và mô học. Độ tuổi chẩn đoán là t 3 đến 36 tháng tuổi. Cha mẹ các bệnh nhi đồng ý tham gia nghiên cứu tự nguyện. Mẫu máu ngoại vi của bệnh nhân và ngƣời thân trong gia đình đƣợc thu thập và đƣợc bảo quản ở - 20°C cho đến khi tách chiết DNA. Khi một bệnh nhân đƣợc xác định là có đột biến dòng mầm, cha mẹ và anh chị em của bệnh nhân sẽ đƣợc tƣ vấn di truyền để kiểm tra đột biến ở cùng vị trí nucleotide trên gen RB1. Nghiên cứu này đã đƣợc chấp thuận của Hội đồng Đạo đức trong nghiên cứu Y Sinh học (Institutional Review Board-IRB) của Viện Nghiên cứu hệ gen, Viện Hàn lâm Khoa học và Công nghệ Việt Nam. Phƣơng pháp nghiên cứu phù hợp với các quy định của Tuyên bố Helsinki và Hiệp hội nghiên cứu về thị lực và nhãn khoa (Research in Vision and Ophthalmology- ARVO) trên các đối tƣợng con ngƣời. 2.1.2. Dụng cụ, trang thiết bị Các máy móc, thiết bị phục vụ cho nghiên cứu này thuộc Viện nghiên cứu hệ gen, Viện hàn lâm khoa học và Công nghệ Việt Nam. Các thiết bị sử dụng chính bao gồm: Máy ly tâm Eppendorf (Đức) và máy ly tâm lạnh đa năng 5810R* (Đức); Máy PCR Mastercycler pro S (Đức); Máy soi gel và chụp ảnh tự động DigiDoc-It® Imaging System của Ultra-violet production (Mỹ); Máy đo 24 quang phổ (UV- Vis BioSpectrometer Basic, Đức); Máy đọc trình tự gen ABI 3500 Genetic Analyzer của Applied Biosciences (Mỹ) 2.1.3. Hóa chất *Hó t đ t ết N : Sử dụng kit E.Z.N.A.® Blood DNA Minicủa OMEGA bio-tek, Mỹ. *Hó t đ đ ện d : Agarose của Affymetrix, Cleveland, Mỹ; Dung dịch TAE 1X; Loading Buffer 6X; Ethidium bromide. *Hó t t ện kỹ t uật PCR: Taq 2X Master Mix của New England Biolab, Mỹ; dNTPs, Nƣớc 3D (deionized double distilled (3D) water) và DMSO t bioWORLD, Mỹ; Các đoạn mồi đƣợc đặt hàng t Intergated DNA Technologies (IDT), Mỹ. * Hó t đ t n sạ sản p ẩm PCR: Sử dụng kit Gen JETTM PCR purification của Thermo Scientific, Mỹ. * Hó t ả trìn t n: Ethanol của Merk, Mỹ; Kit giải trình tự Big Dye Terminator v3.1 của Applied Biosciences. * Hó t t ện p ản ứn MLP : Bộ kit SALSA MLPA P047-D1 RB1 Probemix (MRC-Holland, Amsterdam, Hà Lan) 2.2. PHƢƠNG PHÁP NGHİÊN CỨU Quá trình nghiên cứu đƣơc thực hiện theo sơ đồ sau: 25 2.2.1. Phƣơng pháp lấy mẫu Bệnh nhân đƣợc lấy 2 mL máu tĩnh mạch, cho vào ống chứa chất chống đông EDTA với hàm lƣợng 1,5 mg/mL. Quy trình lấy máu đảm bảo vô trùng tuyệt đối và bảo quản ở -20°C cho đến khi tách chiết DNA. 2.2.2. Phương pháp tách chiết DNA genomic Mẫu máu của các đối tƣợng nghiên cứu đƣợc tách chiết DNA tổng số bằng cách sử dụng kit E.Z.N.A Blood DNA mini (Promega) theo hƣớng dẫn của nhà sản xuất. Sản phẩm DNA sau khi tách chiết đƣợc xác định nồng độ bằng kit Qubit Fluorometer BR (Broad-range) DNA. Nguyên lý của phƣơng pháp này là khi hòa hỗn hợp có Qubit dye với DNA tổng số, dye sẽ gắn kết với DNA sợi đôi và đạt trạng thái bão hòa trong 2 phút. Tín hiệu huỳnh quang của dye sẽ tỉ lệ 26 thuận với nồng độ DNA mà dye gắn kết vào. T đó, Qubit Fluorometer thu nhận tín hiệu huỳnh quang và tính nồng độ DNA sợi đôi dựa trên đƣờng chuẩn nồng độ DNA đƣợc xây dựng t hai mẫu chuẩn (đƣợc cung cấp theo bộ kit). 2.2.3. Phƣơng pháp khuếch đại gen (PCR) 2.2.3.1. ết kế mồ o PCR và s qu n n . Cặp mồi nhân vùng điều khiển gen đƣợc thiết kế dựa trên trình tự nhân chuẩn của RB1 mang accession number NM.000321.2 trong ngân hàng GenBank. Các cặp mồi này đều cho ph p nhân đƣợc toàn bộ exon đ ch và 50- 100bp thuộc hai intron liền kề. Bảng 2.1 Các cặp mồi đặc hiệu cho phản ứng PCR Vùng K ch thƣớc(bp) Mồi Trình tự 5’-3’ Promoter 696 Prom F CTGGACCCACGCCAGGTTTC Prom R GTTTTGGGCGGCATGACGCCTT RB exon 1 1F CCGGTTTTTCTCAGGGGACGTTG 1R TTGGCCCCGCCCTACGCACAC RB exon 2 331 2F CTATTGAAACAAGTATGTACTG 2R GGGTAATGGAATTATTATTAGC RB exon 3 281 3F CAGTTTTAACATAGTATCCAG 3R AGCATTTCTCACTAATTCAC RB exon 4 365 4F GTAGTGATTTGATGTAGAGC 4R CCCAGAATCTAATTGTGAAC RB exon 5 194 5F GCATGAGAAAACTACTATGAC 5R CTAACCCTAACTATCAAGATG 27 RB exon 6 222 6F CACCCAAAAGATATATCTGG 6R ATTTAGTCCAAAGGAATGCC RB exon 7 256 7F CCTGCGATTTTTCTCTCATAC 7R ATGTTTGGTACCCACTAGAC RB exon 8 380 8F AGTAGTAGAATGTTACCAAG 8R TACTGCAAAAGAGTTAGCAC RB exon 9 222 9F TGCATTGTTCAAGAGTCAAG 9R AGTTAGACAATTATCCTCCC RB exon 10 291 10F TCTTTAATGAAATCTGTGCC 10R GATATCTAAAGGTCACTAAG RB exon 11 245 11F GAGACAACAGAAGCATTATAC 11R CGTGAACAAATCTGAAACAC RB exon 12 310 12F GGCAGTGTATTTGAAGATAC 12R AACTACATGTTAGATAGGAG RB exon 13 342 13F CTTATGTTCAGTAGTTGTGG 13R TATACGAACTGGAAAGATGC RB exon 14 808 14F GTGATTTTCTAAAATAGCAGG 14R TGCCTTGACCTCCTGATCTG RB exon 15+16 15+16F CAATGCTGACACAAATAAGG 15+16R AGCATTCCTTCTCCTTAACC RB exon 17 339 17F AAAAATACCTAGCTCAAGGG 17R TGTTAAGAAACACCTCTCAC RB exon 18 340 18F TGTACCTGGGAAAATTATGC 28 18R CTTTATTTGGGTCATGTACC RB exon1 9 273 19F ATAATCTGTGATTCTTAGCC 19R AAGAAACATGATTTGAACCC RB exon 20 335 20F AAAGAGTGGTAGAAAAGAGG 20R CAGTTAACAAGTAAGTAGGG RB exon 21 328 21F AAACCTTTCTTTTTTGAGGC 21R TACATAATAAGGTCAGACAG RB exon 22 313 22F TAATATGTGCTTCTTACCAGTC 22R TTTAATGTTTTGGTGGACCC RB exon 23 287 23F ATCTAATGTAATGGGTCCAC 23R CTTGGATCAAAATAATCCCC RB exon 24 273 24F GAATATAGTTTGTCAGTGGTTC 24R GTGTTTGAATAACTGCATTTGG RB exon 25 834 25F GGTTGCTAACTATGAAACAC 25R AGAAATTGGTATAAGCCAGG RB exon 26 26F AGTAAGTCATCGAAAGCATC 26R AACGAAAAGACTTCTTGCAG RB exon 27 237 27F CGCCATCAGTTTGACATGAG 2.2.3.2. P ơn p p PCR  ến àn PCR Tổng phản ứng là 25 µl bao gồm 20 ng DNA genome, 0.4 pmol mồi mỗi loại, và 12.5 µl Taq 2X Master Mix (New England Biolab, Ipswich, MA). 29 Dimethyl sulfoxide (DMSO) đƣợc bổ sung vào phản ứng khuếch đại cho đoạn promoter-exon1. Quá trình khuếch đại đƣợc thực hiện trong các điều kiện sau đây: giai đoạn biến t nh ban đầu là 2 phút ở 95°C, tiếp theo là 35 chu kỳ của giai đoạn biến tính ở 95°C trong 30 giây; nhiệt độ gắn mồi đặc hiệu cho mỗi mồi trong 30 giây; 68°C trong 30 giây đến 1 phút và bƣớc cuối cùng ở 68°C trong 5 phút. Thành phần Thể t ch (μL) Taq 2X Master Mix 12.5 Mồi xuôi (10pmol/ µl) 1 Mồi ngƣợc (10pmol/ µl) 1 DNA (20 ng/µl) 1 Nƣớc cất 9.5 Tổng 25 Sản phẩm PCR đƣợc phát hiện bằng điện di trên gel agarose 1.2 % có nhuộm ethidium bromide và quan sát dƣới ánh sáng UV.  n sạ sản p ẩm PCR Sản phẩm PCR sau đó đƣợc tinh sạch bằng kit Gen JETTM PCR purification (Thermo Scientific) theo hƣớng dẫn của nhà sản xuất.  Bổ sung Binding Buffer vào các ống eppendorf có chứa mẫu với tỷ lệ thể t ch Binding/ mẫu là 1:1 30 Chú ý: Kiểm tra màu sắc của dung dịch. Màu vàng là chỉ thị cho pH tối ƣu của DNA Binding. Nếu dung dịch có màu da cam hoặc tím thì bổ sung 10μL sodium acetate 3M, pH 5.2 và mix đều.  Chuyển hỗn hợp sang cột tinh sạch. Ly tâm 14000rpm trong 1 phút ở 25°C. Sau đó loại bỏ dịch.  Bổ sung 700μL Wash Buffer vào cột tinh sạch. Ly tâm 14000rpm trong 1 phút ở 25°C. Sau đó loại bỏ dịch.  Chuyển cột tinh sạch sang ống eppendorf 1.5mL.  Bổ sung 35μL Elution Buffer vào ch nh giữa cột tinh sạch. Ủ 5 phút ở nhiệt độ phòng. Ly tâm 14000rpm trong 1 phút ở 25°C.  Loại bỏ cột tinh sạch. Thu sản phẩm Bảo quản ở -20°C. Sản phẩm thu đƣợc sẽ đƣợc kiểm tra bằng phƣơng điện di trên gel agarose 2.2.4. Phƣơng pháp giải trình tự gen  PCR cho giải trình tự. Sản phẩm PCR tinh sạch sẽ đƣợc sử dụng làm khuôn cho phản ứng PCR sử dụng bộ kit BigDye Terminator V3.1 theo hai chiều xuôi và ngƣợc cho mỗi đoạn cần đọc. Mỗi phản ứng PCR cho giải trình tự gen bao gồm: 1 µl BigDye sequencing Buffer 5X, 1 µl mồi xuôi hoặc mồi ngƣợc 1.6 pmol/µl, 1 µl Big Dye, 2 µl DNA đã đƣợc tinh sạch, 5.5 µl nƣớc khử ion vô trùng. Kỹ thuật PCR cho giải trình tự gen đƣợc tiến hành trên máy luân nhiệt (MJ Research) với chu trình nhiệt nhƣ sau: biến t nh ban đầu với 96°C trong vòng 1 phút, tiếp theo là 25 chu kỳ của sự biến tính ở 96°C trong 10 giây; 50°C 31 trong 5 giây; 60°C trong 4 phút. Giảm nhiệt nhanh đến 4°C và giữ cho đến khi sử dụng.  Tinh sạch sản phẩm PCR cho sequencing Sau khi PCR cho giải trình tự, 3µl EDTA và 60µl ethanol 100% đƣợc bổ sung vào sản phẩm PCR, tiếp theo tiến hành ly tâm 4000rpm trong 30 phút ở 4ºC và sau đó DNA kết tủa đƣợc sấy khô ở nhiệt độ phòng trong 15 phút.  Biến t nh mẫu Bổ sung 10 μL Hi-Di vào t ng mẫu. Sau đó mix đều mẫu. Tiếp theo mẫu đƣơc biến tính bằng máy PCR ở 95°C trong 2 phút trƣớc khi làm lạnh nhanh bằng đá.  Mẫu đã sẵn sàng cho giải trình tự.  Chạy điện di mao quản trên máy giải trình tự gen ABI 3500 Gentic Analyzer Các nucleotid trên đoạn gen sẽ đƣợc biểu hiện bằng các đỉnh (peak) với 4 màu tƣơng đƣơng với 4 loại nucleotid A, T, G, C. 2.2.5. Phƣơng pháp Multiplex Ligation-dependent Probe Amplification (MLPA) Để xác định mất đoạn/ thêm đoạn trong gen RB1, kĩ thuật MLPA đã đƣợc thực hiện theo hƣớng dẫn của nhà sản xuất bộ kit SALSA MLPA P047-D1 RB1 Probemix. P047-D1 RB1 probemix chứa các đầu dò cho 26 trong số 27 exon RB1. Không có đầu dò nào để kiểm tra sự có mặt của exon 15, bởi vì exon này nằm rất gần với các exon lân cận. Có 5 mẫu dò để kiểm tra exon 1, 2 mẫu dò cho exon 12 và 2 mẫu dò cho exon 27. Hơn nữa, probemix này chứa các mẫu dò 32 ở vùng nối của gen RB1 (ph a trƣớc 48 kb, ph a sau gen 35 kb) cũng nhƣ một mẫu dò cho gen DLEU1 và hai mẫu dò cho gen PCDH8 tƣơng ứng là 1,6 Mb và 4,5 Mb ở phía sau của RB1. Ngoài ra, probemix có 13 mẫu dò tham chiếu, phát hiện một số vị trí khác nhau trên nhiễm sắc thể thƣờng. * Th c hiện phản ứng MLPA Để chuẩn bị cho phản ứng MLPA, DNA tổng số đƣợc pha loãng về nồng độ 10ng/μl trong đệm TE 50ng DNA tổng số với thể t ch 5μl đƣợc sử dụng cho phản ứng MLPA. Các bƣớc đƣợc tiến hành nhƣ sau: Ngày thứ nhất Bƣớc 1: Biến tính DNA Thêm 5μl DNA tổng số (50ng) vào mỗi ống PCR 0.2ml. Biến tính DNA tổng số bằng máy PCR trong 5 phút ở 980C, làm lạnh mẫu xuống 250, sau đó đƣa mẫu ra khỏi máy PCR. Bƣớc 2: Phản ứng lai - Vortex đều MLPA buffer và MLPA probemic trƣớc khi sử dụng, spin down nhẹ các ống mẫu. - Chuẩn bị hỗn hợp phản ứng lai (hybridization mastermix): [1.5 μl MLPA buffer + 1.5 μl probemix]/1 phản ứng lai. Trộn đều hỗn hợp bằng pipetting hoặc vortex. - Thêm 3 μl hỗn hợp phản ứng lai vào mỗi mẫu DNA đã đƣợc biến t nh trƣớc đó, trộn đều bằng pipetting. - Tiếp tục chu trình nhiệt: ủ trong 1phút ở 950C, 16-20 giờ ở 600C. Ngày thứ hai 33 Bƣớc 3: Phản ứng gắn kết - Vortex đều 2 Buffer ligase - Chuẩn bị hỗn hợp Ligase 65: [25 μl DDW + 3 μl Ligase Buffer A + 3 μl Ligase Buffer B]/1 phản ứng. Sau đó thêm 1 μl Ligase 65 enzyme và trộn đều hỗn hợp bằng pipetting (không vortex). Tiếp tục chu trình nhiệt: hạ nhiệt độ t 600 xuống 540 và giữ ở nhiệt độ này. - Khi mẫu đang ở 540C trong máy PCR, thêm 32 μl hỗn hợp ligase 65 vào mỗi ống mẫu, trộn đều bằng pipetting. - Tiếp tục chu trình nhiệt: ủ 15 phút ở 540C (gắn kết hai phần của đầu dò), ủ 5 phút ở 980C (bất hoạt enzyme ligase 65). D ng ở 200C. Lúc này các ống mẫu có thể đƣợc lấy ra khỏi máy PCR. Bƣớc 4: Phản ứng PCR - Vortex Salsa PCR primer mix. Làm ấm Polymerase trong tay 10 giây để giảm độ nhớt. - Chuẩn bị hỗn hợp enzyme polymerase: [7.5 μl DDW + 2 μl Salsa PCR primer + 0.5 μl Salsa polymerase]/ 1 phản ứng. Trộn đều bằng pipetting và giữ hỗn hợp này trên đá. - Khi các ống mẫu ở nhiệt độ phòng, thêm 10 μl hỗn hợp chứa polymerase vào mỗi ống mẫu. Trộn đều bằng pipetting. - Tiếp tục chu trình nhiệt: 35 cycles x (950C: 30 giây, 600C: 30 giây, 720C: 60 giây); 72 0 C: 10 phút; 15 0 C: pause Sản phẩm PCR đƣợc lƣu ở 40 (1 tuần) hoặc -250C (lƣu giữ lâu dài), bọc trong giấy bạc hoặc hộp tối và tránh ánh sáng 34 * Đ ện di mao quản p n t đoạn - 0.7 μl sản phẩm PCR đƣợc sử dụng để điện di mao quản nhằm phân tách các phân đoạn đã đƣợc khuếch đại theo k ch thƣớc. - Chuẩn bị hỗn hợp: [0.7 μl sản phẩm PCR + 0.2 μl sản phẩm PCR LIZ (GS500) + 9 μl HiDi formamide]. Đĩa phản ứng đƣợc làm nóng ở 860C trong 3 phút, sau đó làm lạnh xuống 40C trong 2 phút. Lúc này, hỗn hợp đã sẵn sàng cho điện di mao quản. - Các thông số điện di mao quản đƣợc thiết lập nhƣ sau: Thiết bị Mao quản Cài đặt ABI-3500 8 mao quản- 50cm Run module: Fragment analysis Injecttion voltage: 1.6kV Injection time: 15sec Run voltage: 15kV Run time: 1800s Oven temperature: 60 0 C Polymer: POP 7 2.2.6. Phƣơng pháp phân tích kết quả 2.2.6.1. Phân tích kết quả giải trình t gen So sánh trình tự gen của bệnh nhân với trình tự gen chuẩn của RB1 trong ngân hàng GenBank với mã số NM_000321.2 bằng phần mềm BioEdit để xác định các đa hình, đột biến. 35 Kết hợp các cơ sở dữ liệu database của gen RB1 ( lohmann.de/variants.php?action=search_unique&select_db=RB1) để xác định vai trò của các đa hình/đột biến đối với quá trình hình thành và tiến triển của bệnh. 2.2.6.2. Phân tích kết quả MLPA Phân tích kết quả bằng phần mềm Coffalyzer.net: Sau khi chạy điện di mao quản trên máy ABI 3500, dữ liệu đƣợc phân tích bằng phần mềm Coffalyzer.net. Tín hiệu huỳnh quang đƣợc xác định bởi điện di mao quản không đƣợc sử dụng để trực tiếp tính toán số bản sao, do tín hiệu huỳnh quang này còn bị ảnh hƣởng bởi nhiều biến số. Đầu tiên, giá trị tín hiệu huỳnh quang của mỗi đầu dò sẽ đƣợc chuẩn hóa trong mỗi mẫu. Sau đó, các mẫu khác nhau sẽ đƣợc so sánh với nhau để xác định mẫu nào có số bản sao thay đổi bất thƣờng. Quá trình chuẩn hóa của MLPA bao gồm 2 bƣớc: chuẩn hóa trong 1 mẫu- intrasample normalization (so sánh các đỉnh tín hiệu của các đầu dò khác nhau trong cùng một mẫu) và chuẩn hóa giữa các mẫu-intersample Normalization (so sánh các đỉnh tín hiệu của mỗi đầu dò tƣơng ứng giữa các mẫu khác nhau). Những mẫu không có sự thay đổi nào về bản sao của gen RB1 sẽ cho hình ảnh các đỉnh tín hiệu của các đầu dò giống với hình ảnh kết quả của mẫu đối chứng khỏe mạnh. Tỉ lệ của các đầu dò sau bƣớc chuẩn hóa thứ 2 sẽ là ~ 1. Đối với trƣờng hợp mất đoạn dị hợp tử, tỉ lệ này sẽ là ~ 0.5. Tỉ lệ cuối cùng này còn đƣợc gọi là Dosage Quotient (DQ). Phần mềm Coffalyzer.net sẽ tính toán DQ cho t ng đầu dò và đƣa ra kết quả cuối cùng. 36 CHƢƠNG 3: KẾT QUẢ VÀ THẢO LUẬN 3.1. KẾT QUẢ 3.1.1. Thu thập mẫu nghiên cứu Tổng số có 30 mẫu bệnh nhi mắc UNBVM đã đƣợc chẩn đoán trên lâm sàng và cận lâm sàng và cha mẹ của các bệnh nhi. Trong đó bao gồm 21 nữ (70%) và 9 nam (30%). Có 9 bệnh nhi bị UNBVM một bên mắt (30%) và 21 bệnh nhi bị UNBVM cả hai bên mắt (70%). Xét về tính chất di truyền, có 21 bệnh nhi là trƣờng hợp tự phát (70%) trong khi đó có 9 bệnh nhi thuộc trƣờng hợp thể gia đình (30%). Trong số những ca gia đình, có một bệnh nhân mã số RB15 ban đầu đƣợc chẩn đoán là UNBVM hai mắt thể tự phát nhƣng sau đó đƣợc phân loại lại vào nhóm có tiền sử gia đình do có em gái phát triển UNBVM sau đó. Thông tin lâm s

Các file đính kèm theo tài liệu này:

  • pdfluan_van_sang_loc_dot_bien_gen_rb1_the_di_truyen_tren_cac_be.pdf
Tài liệu liên quan