Luận văn Tạo dòng và biểu hiện gen chitinase từ nấm trichoderma

Cây trồng nông nghiệp bao gồm các loại rau và ngũ cốc như: rau ăn lá, ăn

quả, củ, đậu đỗ, lúa, ngô, khoai, sắn giữ vai trò quan trọng trong bữa ăn

hàng ngày của từng gia đình và là nguồn hàng xuất khẩu có giá trị. Tuy nhiên,

đây là loại cây trồng có những đặc điểm hình thái và sinh trưởng thuận lợi cho

các loại sâu và nấm bệnh sống ký sinh. Sức tàn phá của các loại sâu và nấm

bệnh này nhiều khi rất lớn, gây tổn thất nghiêm trọng về năng suất và chất

lượng của cây trồng [15].

Việt Nam là nước có khí hậu nhiệt đới, vì thế thích hợp cho nhiều loại sâu

và nấm bệnh gây hại cây trồng nông nghiệp phát triển. Các loại nấm bệnh gây

hại thường gặp ở cây trồng như Rhizoctonia gây bệnh thối gốc (lở cổ rễ),

Fusarium gây bệnh héo rũ, thối khô, Alternaria gây bệnh đốm vòng Để hạn

chế tác hại của nấm bệnh, một trong những phương pháp có hiệu quả là sử

dụng hóa chất và thuốc trừ sâu bệnh. Tuy nhiên, việc làm này gây tác hại lâu

dài với môi trường và sức khoẻ của cộng đồng [10]. Hiện nay, công nghệ sinh

học ngày càng phát triển đã mở ra một hướng đi mới trong việc ngăn ngừa tác

hại của sâu và bệnh hại cây trồng nhưng vẫn bảo vệ được môi trường như tạo

ra các cơ thể tái tổ hợp có khả năng kháng lại các loại sâu bệnh [74], [75].

Công nghệ DNA tái tổ hợp (còn gọi là kỹ thuật di truyền hay kỹ thuật gen)

là một bộ phận quan trọng và là công nghệ then chốt của lĩnh vực công nghệ

sinh học. Công nghệ DNA tái tổ hợp ra đời trên cơ sở các thành tựu của sinh

học phân tử và hiện nay đang đóng vai trò cách mạng trong sự phát triển của

sinh học. Các kỹ thuật tái tổ hợp DNA cho phép phân lập và khuếch đại một

gen đơn từ genome của một sinh vật để có thể nghiên cứu, biến đổi và chuyển

nó vào trong một cơ thể sinh vật khác. Cải thiện hoạt tính và khả năng tổng

hợp enzyme bằng kỹ thuật tái tổ hợp DNA hiện đang được ứng dụng rộ ng rãi

[69], trong đó có tạo dòng và sản xuất chitinase [43], [64], [56].

10

Chitinase là một enzyme glycosyl hydrolase xúc tác thủy phân chitin, có

trong nhiều loại cơ thể sống khác nhau bao gồm vi khuẩn, nấm, động vật

không xương sống, thực vật và động vật có xương sống. Chitinase thực vật là

các enzyme xúc tác thủy phân chitin của nấm bệnh. Tuy nhiên, không phải

cây trồng nào cũng có khả năng sản xuất chitinase, hoặc hoạt tính chitinase

của chúng đủ cao để kháng lại nấm bệnh, vì vậy việc tạo ra một chủng sinh

vật có khả năng sản xuất enzyme này với lượng lớn và hoạt tính cao là có ý

nghĩa rất lớn [46].

Đến nay, đã có nhiều công trình nghiên cứu về tạo dòng và biểu hiện gen

chitinase trong Escherichia coli, Saccharomyces cerevisiea và các loại vi

khuẩn khác đã được công bố, như nghiên cứu của Boer và cộng sự (2007) về

biểu hiệu gen chit33 và chit42 của Trichoderma harzianum trong E. coli [32],

biểu hiện gen chitinase của Serratia marcescens trong các chủng

Sinorhizobium fredii USDA191 và S. meliloti RCR2011 (Krishnan và cs

1999), biểu hiện gen chitinase của T. aureoviride trong nấm men S. cerevisiae

(Jinzhu và cs 2005).

Xuất phát từ nhu cầu thực tiễn, chúng tôi thực hiện đề tài: “Tạo dòng và

biểu hiện gen chitinase từ nấm Trichoderma ” nhằm mục đích sản xuất

enzyme này với hiệu suất cao hơn các sinh vật truyền thống, từ đó áp dụng

vào sản xuất nông nghiệp phòng trừ nấm bệnh trên một số cây trồng kinh tế

như rau, quả hoặc các loại ngũ cốc.

pdf59 trang | Chia sẻ: netpro | Lượt xem: 4626 | Lượt tải: 10download
Bạn đang xem trước 20 trang tài liệu Luận văn Tạo dòng và biểu hiện gen chitinase từ nấm trichoderma, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
nh tự chỉ giống 33,4% so với chitinase A và 15,3% so với chitinase B của loài Seratia marcescens [66]. Mã hóa cho protein dài 820 amino acid và có khối lượng phân tử 87 kDa. Chitinase tái tổ hợp này có tính chất tương tự chitinase của chủng Alterromonas sp. mã số 0-7. Trong nông nghiệp, nấm bệnh hại cây là một vấn đề rất được quan tâm vì nó ảnh hưởng đến cuộc sống của người dân cũng như an ninh lương thực của quốc gia đó. Vấn đề sử dụng thuốc hóa học để trừ nấm bệnh đã và đang bị phản đối do nó ảnh hưởng đến môi trường sống và con người (theo FAO, 2004). Vậy nên, việc nghiên cứu các sinh vật đối kháng với nấm bệnh hiện nay được quan tâm nhiều hơn trước. Lin và cs (2004) đã phân lập được gen chitinase của Bacillus thuringiensis có tính đối kháng cao với côn trùng gân hại và tạo dòng vào E. coli [48]. Một nghiên cứu khác của Corona và cs (2003) đã biểu hiện được gen Chitinase chiA74 của cùng đối tượng như trên, 25 vật chủ được sử dụng là E. coli DH5αF’. Enzyme tái tổ hợp có kích thước 676 amino acid và khối lượng là 74 kDa, trình tự amino acid này tương đồng 98% với trình tự CHIB của Bacillus cereus, và 70% với trình tự CHIA71 của Bacillus thuringiensis serovar Pakistani [23]. Chitinase sinh bởi Bacillus subtilis CHU26 được phân lập từ cánh đồng khoai tây ở Đài Loan. Chủng này thể hiện hoạt tính chitinase ngoại bào mạnh trên đĩa agar có bổ sung cơ chất chitin, cho thấy hoạt tính đối kháng với nguồn bệnh thực vật Rhizoctonia solani. Gen mã hóa cho chitinase (chi18) được tạo dòng từ thư viện hệ gen của B. subtilis CHU26. Gen chi18 bao gồm khung đọc mở gồm 1.791 bp và mã hóa cho 595 amino acid với khối lượng phân tử 64 kDa, gần vùng promoter chứa 1 trình tự lặp trực tiếp gồm 9 bp (ATTGATGAA). Trình tự amino acid của chitinase từ B. subtilis CHU26 cho thấy sự tương đồng là 62% so với B. circulans WL-12 và 81% so với B. Licheniformis. Gen chi18 được chuyển vào vector pGEM3Z và pYEP352 để hình thành plasmid tái tổ hợp pGCHI18 và pYCHI18. Hoạt tính chitinase có thể được quan sát trên đĩa thạch có bổ sung chitin đối với các thể E. coli có mang plasmid tái tổ hợp. Dịch nuôi cấy vô tế bào của E. coli chuyển gen có mang pYCHI18 làm giảm hoạt tính gây bệnh củ R. solani hơn 90% trong kiểm tra đối kháng trên các cây củ cải (Raphanus sativus Linn.) [74]. Plasmid pUC19 mang gen mã hóa cho họ gen chitinase 19 của Streptomyces sp. J-13-3 được chuyển vào tế bào E. coli JM109. Chitinase tái tổ hợp được tinh sạch từ dịch chiết tế bào nhờ sắc kí cột trên DEAE- Sepharose, CM- Sepharose, Bio-Gel P-100. Dịch cuối cùng được điện di trên gel polyacrylamide. Khối lượng phân tử của enzyme tinh sạch là 32 kDa. Chitinase tái tổ hợp có khả năng thủy phân N-acetylglucosamine. Sự sinh trưởng của nấm (200 µl dịch nuôi cấy) được xác định bởi độ hấp thụ quang ở 26 bước sóng 595 nm cho thấy rằng chitinase (10 µg) ức chế hoàn toàn và phân nữa sự sinh trưởng của T. reesei và A. niger [75]. Gen mã hóa chitinase từ Aeromonas sp. mã số 10S-24 được tạo dòng trong E. coli DH5a sử dụng pUC19. Khung đọc mở pCA8 gồm 1.482 bp mã hóa cho 494 amino acid có khối lượng phân tử là 51 kDa. Trình tự gen pCA8 tương đồng 30% với chitinase II của Aeromonas sp. mã số 10S-24 và tương đồng 29% với chitinase của Saccharopolyspora erythraea [67]. 1.5. TẠO DÒNG VÀ BIỂU HIỆN GEN TRONG E. coli Theo Baneyx (1999), E. coli là một trong những vật chủ được sử dụng rộng rãi để biểu hiện các sản phẩm protein ngoại lai từ các sinh vật khác [17]. Hiện nay việc tạo dòng và biểu hiện gen trong E. coli được rất nhiều nhà khoa học trên thế giới thực hiện, Guang và cs (2004) đã tạo dòng gen B7-H3 vào vector pGEX-5X-3 và biến nạp vào E. coli để nghiên cứu chức năng sinh học của protein B7-H3 trong việc hoạt hóa tế bào lympho T [28]. Human beta- defensin-4 (hBD4) là một protein có tác dụng chống nhiễm khuẩn ở người, Zhinan và cs (2006) đã thành công trong việc tạo dòng và biểu hiện gene này vào E. coli, sử dụng vector biểu hiện pET32-smhBD4, phân tích sự biểu hiện của gen hBD4 thành protein hBD4 đạt 1,9 g/l và protein này đạt 2,68 g/l khi nuôi E. coli mang vector pET32-smhBD4 trong môi trường MBL ở 340C, cảm ứng IPTG nồng độ 0,4 mM và thu sinh khối phân tích sau 6h nuôi cấy [76]. Jinshu và cs (2006) đưa được gen mã hóa GnRH vào hệ thống biểu hiện dựa trên T7 RNA polymerase trong vector pED-GnRH3, GnRH là hormone điều hòa quá trình tiết hormone kích thích nang trứng (FSH) và hormone kích thích thể vàng (LH), do vậy việc biểu hiện được gen mã hóa GnRH trong E. coli có ý nghĩa rất lớn trong việc điều trị bệnh liên quan đến hormone này [41]. 27 Protein hALR tái tổ hợp đã biểu hiện thành công trong hệ thống biểu hiện pET28a(+) của E. coli BL21, vector pET28a (+)/hALR mang đoạn cDNA đầy đủ của hALR được khuếch đại bằng phương pháp RT-PCR và chứa trình tự mã hóa cho đuôi His, quá trình tiết hALR được cảm ứng bằng IPTG 2h ở 37 0 C [39]. Đoạn gen mã hóa cho enzyme catalase được Yang và cs (2003) phân lập từ Helicobacter pylori bằng PCR sau đó tạo dòng vào vector pET- 22b (+) và được biểu hiện trong E. coli BL21 (DE3), kết quả cho thấy enzyme catalase tái tổ hợp chiếm 24,4% hàm lượng protein tổng số sau khi cảm ứng bằng IPTG trong 3 giờ ở 370C. Như vậy, enzyme này đã có hoạt tính cao khi biểu hiện trong E. coli [73]. Trình tự cDNA mã hóa cho quinone reductase của chuột bị viêm gan được phân lập, tạo dòng trong vector pKK 233.2 và biến nạp vào chủng E. coli JM109. Sau đó, enzyme này được Shiuan và cs phân tích trình tự amino acid, kết quả cho thấy đây là một protein dài 273 amino acid, nó có trình tự tương đồng với protein có chức năng tương tự ở người [62]. Ở một hướng nghiên cứu khác, trình tự RNA đối mã của rpoS với tác dụng ức chế sự biểu hiện của gen rpoS đã được Guozhu và cs (2003) tạo dòng thành công. Kết quả này đã chứng minh rằng việc sử dụng một trình tự làm ức chế sự biểu hiện của gen là hiệu quả, mở ra một hướng mới trong việc tạo ra các tác nhân kháng khuẩn hiệu quả [29]. Wu và cs (2008) cũng chỉ ra rằng việc sử dụng công nghệ DNA tái tổ hợp trong nghiên cứu các tác nhân để kháng bệnh là rất có triển vọng. Gen tương đồng thanatin (th1) mã hóa đoạn peptide dài 20 amino acid được biến nạp vào E. coli nhờ vector pET32a-TH1 đã biểu hiện protein với hàm lượng 0,416 g/L, đem đến một triển vọng lớn trong việc điều trị bệnh bằng sản phẩm của công nghệ DNA [68]. Protein porcine zona pellucida 3β (pZP30 β) được tạo dòng và biểu hiện vào E. coli BL21 (DE3) pLysS sử dụng vector pET-3c. Protein tái tổ hợp 28 được phát hiện bằng phương pháp Western blot, sau khi phân tích hoạt tính cho thấy nó chiếm 10% protein tổng số [70]. Gen gdhA mã hóa cho hexaneric glutamate dehydrogenase (GDH) của Pyrococcus furiosus được tạo dòng bằng vector pET11-d và biểu hiện vào E. coli. Ở hệ thống này enzyme này biểu hiện với lượng chiếm 15% so với protein tổng số [42]. Toxoplasmosis là bệnh gây ra bởi loài kí sinh trùng Toxoplasma gondii, còn biết đến như là hiện tượng nhiễm một loại giun sán ở người nói riêng và các động vật máu nóng nói chung. Bệnh này ảnh hưởng đến sức khỏe của con người và nhất là đối với thai nhi. GRA2 của Toxoplasma gondii gây đáp ứng miễn dịch ở người và chuột làm tăng lượng kháng thể sản sinh ra để chống lại sự phát triển của loài kí sinh trùng này. Majid Golkar và cs (2004) đã nghiên cứu tạo ra được protein GRA2 tái tổ hợp trong chủng E. coli BL21 pLysS. Sau khi phân tích sự biểu hiện của protein này bằng Western blot và xem khả năng gây đáp ứng miễn dịch ở chuột bằng thử nghiệm in vivo trên chuột, kết quả cho thấy lượng kháng thể thuộc loại IgG2a và IgG1 đều tăng lên, có tác dụng chống lại sự có mặt của TRX-GRA2 [52]. 1.6. TẠO DÒNG VÀ BIỂU HIỆN GEN TRONG NẤM MEN Trong việc tạo dòng và biểu hiện gen vào một đối tượng khác thì vật chủ là một yếu tố quyết định đến sự thành công cũng như hiệu suất của quá trình. Bên cạnh những ưu điểm của E. coli như vòng đời ngắn, khả năng sinh trưởng và phát triển mạnh, nó cũng có nhược điểm như không có quá trình hậu dịch mã. Từ đó, việc biểu hiện các gen được phân lập từ sinh vật nhân chuẩn sẽ gặp nhiều khó khăn. Để khắc phục nhược điểm này người ta đã chọn những vật chủ khác có nguồn gốc là sinh vật nhân chuẩn làm vật chủ biểu hiện như nấm men S. cerevisiae hay Pichia pastoris [43]. 29 Một nghiên cứu của Rashed và cs (2010) đã biểu hiện endochitinase, cht2 của Trichoderma virens UKM1 và nấm men Pichia pastoris, gen cht2 và trình tự cDNA của nó được tạo dòng và giải trình tự, kết quả có thể gen cht2 dài 1169 bp, mã hóa cho protein dài 321 amino acid, sau đó trình tự cDNA được tạo dòng vào vector biểu hiện pPICZαC và biến nạp vào nấm men P. pastoris X33 sử dụng promoter cảm ứng methanol, protein tái tổ hợp được sản xuất ra có khối lượng phân tử 35 kDa khi cảm ứng 0,5% methanol. Để phân tích xem enzyme tái tổ hợp có chức năng sinh học hay không, Rashed đã thử hoạt tính phân giải colloidal chitin của enzym này, kết quả cho thấy hoạt độ riêng của enzyme đạt 1,34 U/mg, enzyme hoạt động tốt nhất ở pH 6.0 và nhiệt độ 350C và ổn định trong khoảng pH 5.0 đến 7.0 và nhiệt độ 30 đến 550C [57]. Baccatin III, một chất trung gian của quá trình sinh tổng hợp Taxol, là một tiền chất hữu ích để bán tổng hợp thuốc chống ung thư, được sản xuất từ những loài thủy tùng, thông qua một chuổi của 15 bước xúc tác nhờ enzyme trong quá trình trao đổi chất sơ cấp. Mười gen mã hóa cho những enzyme tham gia vào quá trình này đã được mô tả, từ đó cho phép thiết kế lại các giai đoạn sớm của quá trình trao đổi chất taxane diterpenoid (taxoid) trong vật chủ S. cerevisiae. Tám trong số các gen taxoid này được biểu hiện chức năng trong nấm men từ các vector episome chứa 1 hoặc nhiều cassett liên kết chặt chẽ với với các đuôi epitope khác nhau cho phép giám sát và phân biệt protein của những enzyme có cùng kích thước. Cả tám loại protein tái tổ hợp được phát hiện bằng kĩ thuật immunoblotting sử dụng những kháng thể đơn dòng đặc hiệu và mỗi protein biểu hiện được xác định có chức năng bằng phân tích enzyme in vitro, hoạt độ có sự khác nhau đáng kể giữa các loại enzyme. Các bước phân tích chỉ ra rằng, những tiền chất isoprenoid từ nấm men có thể được sử dụng trong con đường cấu thành lại bởi vì các sản phẩm tích lũy từ 2 30 giai đoạn đầu của quá trình thiết kế (dẫn đến việc chuyển thành taxadiene trung gian) [40]. Gen mã hóa Isoamylase (iso) của Pseudomonas amyloderamosa được khuếch đại bằng PCR và được tạo dòng vào vector S. cerevisiae dưới sự điều khiển của gen mã hóa alcohol dehydrogenase và promoter glyceraldehyde-3- phosphate dehydrogenase. Trình tự tín hiệu của gen iso cũng được thay thế bằng gen mã hóa α-amylase Schwanniomyces occidentalis. Hoạt độ isoamylase ngoại bào của S. cerevisiae đạt đến 86 U/ml sau khi nuôi 4 ngày. Nghiên cứu này mô tả cấu trúc của plasmid chứa gen iso từ Pseudomonas amyloderamosa và sự biểu hiện chức năng của isoamylase trong S. Cerevisiae [55]. Hiện nay, có nhu cầu về việc tiêu thụ rượu chứa độ cồn và các chất bảo quản hóa học thấp. Trong nghiên cứu này, các tác giả biểu hiện gen mã hóa 1 glucose oxidase (GOX; β-D-glucose: oxygen oxidoreductase, EC 1.1.3.4) của A. niger trong S. cerevisiae và đánh giá khả năng sản xuất rượu có nồng độ cồn thấp và sự ức chế các sinh vật làm hỏng rượu của chủng biến nạp. Gen cấu trúc GOX được tạo dòng vào vector Yip5 chứa trình tự tín hiệu MFa1S, promoter phosphoglycerate-kinase-1(PGK1P) và terminator PGK1T. Cassette PGK1P-MFa1S-gox-PGK1T có ở chủng S. cerevisiae S1278. Các kết quả phân tích cho thấy, glucose oxidase tái tổ hợp có hoạt tính và được sản suất sớm và ổn định ở pha sinh trưởng. Nấm men biến nạp cũng cho hoạt tính kháng vi sinh vật và rượu chứa lượng cồn thấp hơn 1,8–2,0% [53]. Sự dung hợp giữa gen cấu trúc a-factor trong nấm men và gen mã hóa protein tương tự ở người đã được thiết kế. Những protein lai bao gồm 89 amino acid đầu tiên của tiền chất a-factor, hoạt động dung hợp với protein ngoại lai có khối lượng nhỏ (j8-endorphin, 31 amino acids) hoặc protein lai có khối lượng lớn (a-interferon,166 amino acids). Promoter a-factor được sử dụng để điều khiển sự phiên mã gen dung hợp trong S. cerevisiae, protein 31 ngoại lai được tiết ra môi trường nuôi cấy một cách có hiệu quả. Sự phân cắt protein liên quan đến sự trưởng thành của những peptide a-factor từ tiền chất hoạt động cũng xuất hiện chính xác trong protein lai. Sự phân cắt xuất hiện ở vị trí carboxyl của 2 lysine nằm trong peptide 6-endorphin [19]. Gen mã hóa xylanase (xynA) của Aureobasidium pullulans được biểu hiện trong S. cerevisiae và sản phẩm của nó được tiết vào trong môi trường. Khung đọc mở của xynA được tạo dòng trong S. cerevisiae, bao gồm phần mã hóa peptide tín hiệu. Sản phẩm biểu hiện có hoạt độ xylanase 6,7 U/ml trong phân đoạn liên kết tế bào và 26,2 U/ml trong môi trường nuôi cấy sau 4h cảm ứng với galactose. Kết quả cho thấy rằng, peptide tín hiệu xynA hỗ trợ cho quá trình hậu dịch mã của sản phẩm xynA và xylase hoạt động từ nấm men tiết một cách hiệu quả vào môi trường nuôi cấy (gấp 3 lần so với A. pullulans) [71]. Gen mã hóa chitinase ech42 được lấy từ T. aureoviride M và được khuếch đại bằng PCR, sau đó được phân tích trình tự. Kết quả cho thấy, khung đọc mở của ech42 có kích thước 1.447 bp, mã hóa cho 421 amino acid và có 3 vùng intron được tìm thấy trong trình tự. Vector tạo dòng pMD18-T và vật chủ E. coli DH5α được sử dụng để tạo thành DH5α/ech42 . Gen ech42 được chèn vào pYES2, kết quả tạo ra vector tái tổ hợp pYES2/ech42. Chitinase biểu hiện bởi pYES2/ech42 được cảm ứng bằng galactose trong môi trường lên men lỏng, sau 36 giờ có hoạt độ cao nhất là 0,5 U/ml [63]. 32 Chƣơng 2. ĐỐI TƢỢNG VÀ PHƢƠNG PHÁP NGHIÊN CỨU 2.1. ĐỐI TƢỢNG NGHIÊN CỨU - Gen chitinase của các chủng nấm đối kháng Trichoderma được phân lập từ đất ở Quảng Điền, Thừa Thiên Huế và Cam Lộ, Quảng Trị 2.2. PHƢƠNG PHÁP NGHIÊN CỨU 2.2.1. Xác định chủng Trichoderma sinh chitinase ngoại bào mạnh Chủng Trichoderma sinh chitinase ngoại bào mạnh được tuyển chọn bằng phương pháp khếch tán đĩa thạch. Cấy nấm Trichoderma vào đĩa petri chứa môi trường Czapeck-Dox với glucose được thay bằng colloidal chitin 1% (w/v) để cảm ứng tổng hợp chitinase, ủ ở nhiệt độ 28oC trong 36 giờ, sau đó nhuộm màu với thuốc thử lugol và đo đường kính vòng phân giải (Orpin, 1977). 2.2.2. Xác định hoạt tính chitinase Hoạt độ của chitinase được xác định dựa theo phương pháp của Tsuijbo và Hatano (1998) với para-nitrophenyl-β-N-acetylglucosaminidase (pNp- GlcNAc) làm cơ chất. Cho 70 µL enzyme thô vào 140 µL dung dịch pNp- GlcNAc 2,5 mM trong đệm acetate 50 mM (pH 5), phản ứng được tiến hành ở 50 0C trong 30 phút. Sau đó ngừng phản ứng bằng 1,4 ml Na2CO3 0,2 M. Do độ hấp phụ màu của sản phẩm tạo thành ở bước sóng 420 nm. Hoạt độ chitinase được định nghĩa là lượng enzyme có khả năng xúc tác chuyển hóa 1 nmol cơ chất pNp-GlcNAc thành p-nitrophenyl trong thời gian 1 phút. Tính toán hàm lượng p-nitrophenyl theo đường chuẩn y = 0,673x (R2 = 0,99) với x là OD, y là nồng độ p-nitrophenyl. 33 Protein hòa tan tổng số được đo bằng phương pháp Bradford đo ở bước sóng 595 nm. Hoạt độ riêng của enzyme chitinase được tính bằng cách chia hoạt độ chung (U/ ml) cho protein tổng số (mg/ ml) [48]. 2.2.3. Tách chiết chitinase Bào tử nấm Trichoderma được thu từ đĩa petri bằng nước cất vô trùng và cấy trong môi trường lỏng Czapeck-Dox, pha loãng mẫu đến 107 bào tử/ml, cấy 2 ml dịch bào tử nấm Trichoderma vào 100 ml môi trường lỏng Czapeck- Dox. Mẫu được nuôi ở 28oC trong 96 giờ với tốc độ lắc 180 vòng/phút. Sợi nấm được rửa sạch bằng MgCl2 và nước cất vô trùng. Sau đó, nuôi trong môi trường Czapeck-Dox bổ sung 1% colloidal chitin (không có glucose) ở 280C trong 48 giờ với tốc độ lắc 100 vòng/phút. Dịch nổi được kết tủa bằng (NH4)2SO4 70% bảo hòa ở 4 0 C trong 2 giờ. Hòa tan kết tủa bằng đệm acetate 0,1 M (pH 5).Thẩm tích và làm sạch dịch chiết chitinase trong đệm acetate 0,05 M (pH 5). 2.2.4. Xác định khối lƣợng phân tử của chitinase Protein ngoại bào tổng số sau khi tách chiết được phân tách trên điện di trên gel polyacrylamide (SDS-PAGE) theo phương pháp của Laemmli (1970) với separating gel 12 % và stacking gel 5 %. Khối lượng phân tử của chitinase được xác định bằng phương pháp điện di không biến tính trên gel polyacrylamide có bổ sung colloidal chitin với nồng độ 0,1%, điện di được tiến hành ở 40C trong 3 giờ, sau đó ủ trong đệm acetate 100 mM ở 370C trong 2 giờ có bổ sung 1% (v/v) Triton X-100 (Trudel, Asselin, 1989). Gel cơ chất được nhuộm bằng dung dịch lugol. 34 2.2.5. Định danh chủng nấm Trichoderma 2.2.5.1. Tách chiết genomic DNA DNA tổng số của các chủng nấm có hoạt độ chitinase cao được tách chiết theo phương pháp sử dụng phenol-chloroform (Siddiquee và cs. 2007). Sợi nấm sau khi nuôi trên đĩa môi trương 1/5 PDA được cấy chuyển sang môi trường lỏng 1/5 PDA, nuôi 2 ngày ở 280C, sinh khối sợi nấm được thu và rửa 3 lần với nước cất sau đó sử dụng để tách chiết DNA. 1 g sinh khối sợi nấm được đồng nhất trong 500 µL DNA extration buffer 0,2 M có bổ sung 10% SDS và ủ ở 650C trong 2 giờ, sử dụng hỗn hợp phenol : chloroform : isoamylalcohol để kết tủa các thành phần không phải DNA. Dịch nổi chứa DNA được kết tủa bằng ethanol 100% lạnh và rửa lại bằng ethanol 70%. Quá trình tinh sạch sử dụng máy ly tâm với tốc độ 10.000 vòng/phút ở 40C. 2.2.5.2. Tạo dòng trình tự ITS Cặp mồi ITS1F (5’TCCGTAGGTGAACCTGCGG3’) và ITS4R (5’TCCTCCGCTTATTGATATGC3’) được sử dụng để khuếch đại vùng trình tự ITS của rRNA gen (White và CS, 1990). Hỗn hợp phản ứng PCR bao gồm 10 pmol mồi xuôi, 10 pmol mồi ngược, 4 mM MgCl2, 0,2 mM dNTP mỗi loại, 0,625 đơn vị Taq DNA polymerase (PCR Master Mix 2×, Fermentas, Canada), 25 ng DNA khuôn mẫu với tổng thể tích phản ứng là 25 µL. Quy trình khuếch đại PCR bao gồm: biến tính 950C/5 phút; 30 chu kỳ: 95 0 C/1 phút, 55 0 C/ 1 phút, 72 0C/2 phút và cuối cùng là 720C/10 phút. Sản phẩm PCR được điện di trên agarose gel 0,8% và nhuộm bằng Ethidium bromide 0,05 %. Hình ảnh điện di được thu nhận bằng hệ thống thu nhận hình ảnh Gel Documentation và phân tích bằng phần mềm Quantity one 4.5 (Bio- Rad, Mỹ). 35 Sản phẩm PCR được tinh sạch bằng kit tinh sạch (Wizard SV Gel and PCR Clean-Up System) của hãng Promega. Sau đó, được gắn vào vector pCR ® 2.1 trong 10 µL thể tích phản ứng gồm: 10 ng sản phẩm PCR, 50 ng vector, 1 µL T4 ligase và 1 µL đệm phản ứng 10× T4 ligase. Phản ứng được thực hiện ở 140C qua đêm. Vector pCR® 2.1 mang gen chitinase được biến nạp vào chủng E. coli TOP10 bằng phương pháp shock nhiệt. Trình tự các đoạn ITS được xác định bằng máy giải trình tự tự động (Sequencing Office, First BASE Laboratories, Singapore). So sánh các trình tự này với dữ liệu trên ngân hàng gen bằng công cụ blast trên NCBI ( 2.2.5.3. Tạo dòng và biểu hiện gen chitinase Trình tự mồi C42F (5’GGATCCATGTTGGGCTTCCTCGAAAATCC3’), C42R (5’GAATTCCTAGTTGAGACCGCTTCGGA3’) được thiết kế dựa trên gen ech42 của chủng T. harzianum CB-Pin-01 (accession nember: DQ166036), mồi có thêm 2 trình tự nhận biết điểm cắt cho enzyme cắt hạn chế EcoRI và BamHI (phần gạch chân). Quá trình khếch đại gen bằng PCR, điện di kiểm tra và tinh sạch tiến hành tương tự như với trình tự ITS. Sản phẩm PCR và vector pYES2/NT A được cắt lần lượt bằng EcoRI và BamHI với thể tích phản ứng 20 µL gồm: 0,5 µg sản phẩm PCR hoặc vector, 2 µL buffer 10×, 2 đơn vị enzyme và nước cất vô trùng. Sản phẩm PCR và vector sau khi cắt được gắn trong 20 µL thể tích phản ứng gồm: 80 ng sản phẩm PCR, 60 ng vector, 4 đơn vị T4 ligase và 2 µL đệm phản ứng 10× T4 ligase. Phản ứng được thực hiện ở 140C qua đêm. Vector mang gen chitinase được biến nạp vào chủng E. coli TOP10 bằng phương pháp shock nhiệt. Đoạn gen chitinase được giải trình tự và so sánh dữ liệu trên ngân hàng gen tương tự như thực hiện với trình tự ITS. 36 Sau đó, vector pYES2/NT A mang gen chitinase được biến nạp vào chủng S. cerevisiae INVSc1 theo phương pháp sốc nhiệt sử dụng Lithium Acetate (Invitrogen). Sự hiện diện của gen chitinase trong S. cerevisiae tái tổ hợp được phân tích bằng kỹ thuật PCR. Tế bào nấm men tái tổ hợp được nuôi cấy trên môi trường YPD gồm 1 % dịch chiết nấm men, 2 % peptone, 2 % D glucose, cảm ứng với galactose 2% để tổng hợp chitinase, mẫu được thu 12 giờ một lần để phân tích hoạt tính. 2.2.6. Các phƣơng pháp thống kê sinh học - Tính trung bình mẫu và sai số chuẩn của ít nhất 3 lần lặp lại. - Phân tích ANOVA các số liệu thực nghiệm về đặc tính của chitinase tái tổ hợp. 37 3. KẾT QUẢ VÀ THẢO LUẬN 3.1. Tuyển chọn các chủng nấm Trichoderma sinh chitinase ngoại bào mạnh Dựa trên nguồn nấm Trichoderma đã được Phạm Thanh Hòa (2009) thu thập và phân lập [5]. Chúng tôi tiến hành tuyển chọn chủng có hoạt độ enzyme chitinase mạnh, vòng phân giải chitin được xác định sau 96 giờ nuôi cấy ở 280C. Kết quả cho thấy hầu hết 43 chủng nấm đều có khả năng sinh tổng hợp chitinase với mức độ khác nhau. Trong đó, chúng tôi tuyển chọn được 5 chủng Trichoderma spp. có hoạt độ chitinase cao nhất dựa vào đường kính và độ sáng của vòng phân giải chitin (bảng 3.1). Bảng 3.1. Đƣờng kính vòng phân giải chitin của Trichoderma trên môi trƣờng cảm ứng Chủng Trichoderma spp. Đường kính vòng phân giải chitin(cm) CH2 3,20 b SH16 2,50 c PQ34 4,07 a TN41 1,70 d TN42 2,07 cd Ghi chú : Các chữ cái khác nhau trong cột biểu thị sự sai khác có ý nghĩa thống kê với p <0,05 . 38 Kết quả trên bảng 3.1 cho thấy khả năng phân giải cơ chất giữa các chủng Trichoderma spp. là khác nhau. Hầu hết các chủng đều có đường kính vòng phân giải chitin trên 2 cm. Trong đó, đáng chú ý là chủng CH2 có đường kính trên 3 cm và chủng PQ34 đường kính trên 4 cm. Các chủng CH2, SH16, PQ34, TN41 và TN42 là những chủng có hoạt tính mạnh được chọn lọc và tiếp tục khảo sát hoạt độ (Hình 3.1). Hình 3.1. Vòng phân giải chitin của các chủng nấmTrichoderma spp. 3.2. Xác định hoạt độ chitinase Chủng SH16 có hoạt độ chung cao nhất, chủng CH2 có hoạt độ chung thấp nhất. Hoạt độ chung các chủng PQ34, TN41 và TN42 sai khác không có ý nghĩa thống kê. CH2 SH16 PQ34 TN41 TN42 ĐC 39 Bảng 3.2. Hoạt độ chitinase của các chủng Trichoderma spp. Chủng Trichoderma Hoạt độ chung (u/ml) Hoạt độ riêng (u/mg) CH2 0,042 c 0,209 b SH16 0,559 a 0,748 ab PQ34 0,450 ab 1,307 a TN41 0,179 bc 0,659 ab TN42 0,439 ab 0,964 ab Kết quả bảng 3.1 và 3.2 thấy có sự sai khác, chủng SH16 có đường kính vòng phân giải thấp nhưng hoạt độ riêng cao, ngược lại với chủng CH2 hoạt độ riêng thấp trong khi đường kính vòng phân giải cao. Có thể giữa các chủng khác nhau hoạt tính chitinase biểu hiện ở các mức độ khác nhau. Tuy nhiên khả năng tiết chitinase và hoạt tính chitinase giữa các chủng tuyển chọn không có sự sai khác lớn. So sánh hoạt tính chitinase của các chủng Trichoderma với kết quả nghiên cứu hoạt độ chitinase ở thực vật, những chủng nấm Trichoderma chúng tôi khảo sát có hoạt độ cao hơn (Nguyễn Thị Ngân Hà, 2008) [4]. 40 3.3. Xác định khối lƣợng phân tử của enzyme chitinase Việc xác định được khối lượng phân tử của chitinase là cơ sở cho việc thiết kế mồi đặc hiệu cho gen này. Kết quả điện di xuất hiện nhiều băng tương đối rõ. Điều này chứng tỏ hàm lượng protein tổng số ở hầu hết các chủng tương đối nhiều. Hình 3.2. Điện di SDS và điện di cơ chất Để xác định khối lượng phân tử của chitinase, chúng tôi tiếp tục tiến hành điện di cơ chất và nhuộm bằng thuốc thử Lugol để phát hiện băng có hoạt tính chitinase. Sau khi nhuộm, thuốc thử Lugol bắt màu với chitin tạo màu trên gel điện di. Tại những băng có hoạt tính chitinase, chitin ở đó bị phân giải. Do vậy, tại những băng đó không xuất hiện màu mà xuất hiện một vệt sáng, trong suốt. Kết quả điện di cơ chất được trình bày ở hình 3.2 cho thấy tất cả các chủng đều xuất hiện băng không có màu tương ứng với vị trí khoảng 42 kDa. Như vậy, các chủng CH2, SH16, PQ34, TN41 và TN42 đã sản xuất ra chitinase khối lượng 42 kDa (Chit42 ). Khi nuôi các chủng Trichoderma spp. trong môi trường gồm chitin và một số loại muối khoáng, để sử dụng được nguồn dinh M CH2 SH16 PQ34 TN41 TN42 M CH2 SH16 PQ34 TN41 TN42 ~ 42 kDa 41 dưỡng chitin, bắt buộc chúng phải tiết ra chitinase phân hủy cơ chất này tạo nguồn dinh dưỡng dễ tiêu. 3.4. Định danh chủng nấm PCR được thực hiện với DNA khuôn mẫu là bộ gen nấm tách chiết được. Sản phẩm được điện di trên gel được trình bày ở hình 3.3 Hình 3.3 cho thấy sản phẩm của PCR là đặc hiệu, cặp mồi ITS1 và ITS4 đã khuếch đại được vùng ITS của nấm Trichoderma, sản phẩm có kích t

Các file đính kèm theo tài liệu này:

  • pdfTạo dòng và biểu hiện gen chitinase từ nấm trichoderma.pdf
Tài liệu liên quan