Tóm tắt Luận án Nghiên cứu hoàn thiện bộ kit PCR 16 gen gắn huỳnh quang ứng dụng trong nghiên cứu dân tộc học và giám định gen

CHƢƠNG 2. ĐỐI TƢỢNG VÀ PHƢƠNG PHÁP NGHIÊN CỨU

2.1. Đối tƣợng nghiên cứu

2.1.1.Nguồn mẫu sử dụng cho nghiên cứu8

 Nguồn mẫu dùng cho tối ưu phản ứng PCR đa mồi: Mẫu ADN chuẩn 9947A (10ng/l) của

hãng Promega (Code: DD1001).

 Nguồn sử dụng cho nghiên cứu khảo sát tần suất alen: 514 mẫu máu của 514 cá thể khác

nhau thuộc ba dân tộc nghiên cứu là: người Kinh (300 mẫu gồm 122 nam và 178 nữ) sống ở

khu vực Hà Nội và thành phố Hồ Chí Minh; người Mường (104 mẫu gồm 63 nam và 41 nữ)

sống ở tỉnh Hòa Bình và người Khmer (110 gồm 60 nam và 50 nữ) sống ở tỉnh Sóc Trăng,Việt Nam.

 Nguồn mẫu sử dụng cho ứng dụng phân tích ADN nhận dạng cá thể người (giám địnhADN)

+ Các mẫu sinh phẩm thu được tại hiện trường của một số vụ án do Phòng Kỹ thuật

Hình sự (PC54) - Công an thành phố (CATP) Hải Phòng cung cấp, bao gồm: mẫu dấu vết máu,

mẫu tinh trùng và răng của tử thi.

+ Ba mươi mẫu dấu vết ADN (9 mẫu tăm bông thu trên miệng cốc uống nước; 5 mẫu

ống hút dùng để uống nước; 3 mẫu bàn chải đánh răng; 9 mẫu đầu mẩu thuốc lá và 4 mẫu dao

cạo râu) thu được từ 10 đối tượng cần KSAN do Phòng 4 - Cục Bảo vệ Chính trị VI (A67) - Bộ

Công an cung cấp.

+ Một nghìn mẫu máu của 1.000 cá thể thuộc các nhóm đối tượng mà có nghề nghiệp

tiềm ẩn nguy cơ rủi do cao như phi công, tiếp viên hàng không và ngư dân (trong đó, đã bao

gồm cả 300 mẫu của người Kinh được lựa chọn cho nghiên cứu khảo sát tần suất alen).

Tất cả các mẫu sinh phẩm này đều được lưu giữ ở -20oC, tại PTN Công nghệ gen và Vi

sinh, Viện Kỹ thuật Hóa-Sinh và Tài liệu nghiệp vụ, Bộ Công an.

2.1.2. Bộ 16 locus nghiên cứu

Bộ 16 locus nghiên cứu bao gồm 15 locus STR nằm trên NST thường (D3S1358, TH01,

D21S11, D18S51, Penta E, D5S818, D13S317, D7S820, D16S539, CSF1PO, Penta D, vWA,

D8S1179, TPOX và FGA) và locus Amelogenin để xác định giới tính

pdf22 trang | Chia sẻ: lavie11 | Lượt xem: 450 | Lượt tải: 0download
Bạn đang xem trước 20 trang tài liệu Tóm tắt Luận án Nghiên cứu hoàn thiện bộ kit PCR 16 gen gắn huỳnh quang ứng dụng trong nghiên cứu dân tộc học và giám định gen, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
n bội các locus STR tương ứng sẽ tạo các sản phẩm PCR được đánh dấu [85]. Các sản phẩm PCR này, được điện di phân tách trên hệ thống điện di mao quản. Hai sợi ADN được phân tách ra trong quá trình điện di và chỉ sợi ADN được đánh dấu sẽ được phát hiện bằng thiết bị phát hiện huỳnh quang chuyên dụng [35] (xem Hình 1.7). 1.3. Luận giải các vấn đề nghiên cứu của luận án Qua các bằng chứng và cơ sở khoa học đã được phân tích ở trên cho thấy, các locus STR trên NST thường ở người có một vai trò rất quan trọng trong nghiên cứu di truyền quần thể và phân tích ADN hình sự (giám định ADN) trên thế giới. Bên cạnh đó, ở thời điểm hiện nay, công nghệ phân tích STR bằng kỹ thuật đánh dấu huỳnh quang-điện di mao quản đã được Hỗn hợp các sản phẩm PCR đã được đánh dấu huỳnh quang từ phản ứng PCR đa mồi CCD Panel (với các kính lọc) Argon ion LASER (488 nm) Phân tách các màu Huỳnh quang ABI Prism spectrograph Phân tách theo kích thước Phân tích bằng phần mềm GeneMapper ID 2. Lấy mẫu vào mao quản 3. Phân tách mẫu 4. Phát hiện mẫu 5. Phân tích kết quả 1. Chuẩn bị mẫu Mao quản (chứa dung dịch polymer) Hình 1.7. Sơ đồ mô tả các bước phân tách và phát hiện các alen STR với hệ thống máy điện di mao quản của hãng Applied Biosystems [35]. 7 nghiên cứu hoàn thiện, được sử dụng rộng rãi trong cộng đồng phân tích ADN hình sự trên thế giới và có nhiều ưu việt hơn so với các công nghệ phân tích khác. Chính vì vậy, trong luận án này đã lựa chọn 15 locus STR trên NST thường (D3S1358, TH01, D21S11, D18S51, Penta E, D5S818, D13S317, D7S820, D16S539, CSF1PO, Penta D, vWA, D8S1179, TPOX và FGA) và locus Amelogenin xác định giới tính để nghiên cứu. Công nghệ được sử dụng trong luận án để phân tách và phát hiện các alen STR này là đánh dấu huỳnh quang-điện di mao quản trên hệ thống máy 3130 Genetic Analyzer (Applied Biosystems, Foster City, CA) đang được sử dụng phổ biến ở các PTN phân tích ADN tại Việt Nam. Trong luận án này, vấn đề nghiên cứu thứ nhất được đặt ra: Nghiên cứu chế tạo bộ kit PCR 16 locus gắn huỳnh quang trên hệ thông điện di mao quản. Để giải quyết được vấn đề nghiên cứu thứ nhất này, các nội dung công việc đã được thực hiện, bao gồm: Tối ưu điều kiện PCR đa mồi cho 16 cặp mồi gắn huỳnh quang; Xây dựng thang alen cho 16 locus nghiên cứu và Nghiên cứu chế tạo bộ kit PCR 16 locus gắn huỳnh trên hệ thống điện di mao quản. Sau khi vấn đề nghiên cứu thứ nhất được giải quyết, vấn đề nghiên cứu thứ hai của luận án được đặt ra là: Ứng dụng bộ kit PCR 16 locus gắn huỳnh quang trong nghiên cứu di truyền quần thể ở ba dân tộc người Việt Nam. Ba dân tộc được lựa chọn trong nghiên cứu này là người Kinh sống ở khu vực Hà Nội (6.370.244 người) [126] và thành phố Hồ Chí Minh (6.699.124 người) [126]; người Mường sống ở tỉnh Hòa Bình (501.956 người) [126] và người Khmer sống ở tỉnh Sóc Trăng (397.014 người) [126]. Lý do để lựa chọn ba dân tộc nghiên cứu là: (1) Xuất phát từ nhiệm vụ của đơn vị; (2) Ba dân tộc nghiên cứu đều là các dân tộc chính và có dân số lớn ở Việt Nam (người Kinh có dân số 73.594.427 người, người Mường có dân số 1.268.963 người và người Khmer có dân số 1.260.640 người [126]); (3) Hiện nay, dựa trên ngôn ngữ sử dụng, 54 dân tộc anh em đang sinh sống trên lãnh thổ Việt Nam được chia thành 8 nhóm dân tộc chính, trong đó người Kinh và người Mường đều thuộc nhóm Việt- Mường (Vietic) còn người Khmer thuộc nhóm Môn-Khmer (Austroasiatic) [127, 128]. Điều này cũng cần phải được kiểm chứng dựa trên các bằng chứng khoa học khác. Các nội dung nghiên cứu đã được thực hiện để giải quyết vấn đề nghiên cứu thứ hai này, bao gồm: Khảo sát tần suất alen cho 15 locus STR nghiên cứu trong ba quần thể người Kinh, người Mường và người Khmer bằng bộ kit PCR 16 locus gắn huỳnh quang và So sánh mối quan hệ di truyền giữa ba quần thể nghiên cứu với một số quần thể tham khảo khác nhau trên thế giới bằng cây phả hệ di truyền. Sau khi vấn đề thứ hai được giải quyết, vấn đề nghiên cứu thứ ba còn lại của luận án đƣợc đặt ra là: Ứng dụng bộ kit PCR 16 locus gắn huỳnh quang trong phân tích ADN nhận cá thể người (giám định ADN) tại Việt Nam. Để giải quyết được vấn đề thứ ba còn lại này, các nội dung nghiên cứu đã được thực hiện như sau: Ứng dụng bộ kit PCR 16 locus gắn huỳnh quang trong một số vụ án; Phân tích một số loại dấu vết ADN thu được từ một số đối tượng cần KSAN và Làm thẻ ADN cá nhân phục vụ công tác an ninh và dân sinh. CHƢƠNG 2. ĐỐI TƢỢNG VÀ PHƢƠNG PHÁP NGHIÊN CỨU 2.1. Đối tƣợng nghiên cứu 2.1.1.Nguồn mẫu sử dụng cho nghiên cứu 8  Nguồn mẫu dùng cho tối ưu phản ứng PCR đa mồi: Mẫu ADN chuẩn 9947A (10ng/l) của hãng Promega (Code: DD1001).  Nguồn sử dụng cho nghiên cứu khảo sát tần suất alen: 514 mẫu máu của 514 cá thể khác nhau thuộc ba dân tộc nghiên cứu là: người Kinh (300 mẫu gồm 122 nam và 178 nữ) sống ở khu vực Hà Nội và thành phố Hồ Chí Minh; người Mường (104 mẫu gồm 63 nam và 41 nữ) sống ở tỉnh Hòa Bình và người Khmer (110 gồm 60 nam và 50 nữ) sống ở tỉnh Sóc Trăng, Việt Nam.  Nguồn mẫu sử dụng cho ứng dụng phân tích ADN nhận dạng cá thể người (giám định ADN) + Các mẫu sinh phẩm thu được tại hiện trường của một số vụ án do Phòng Kỹ thuật Hình sự (PC54) - Công an thành phố (CATP) Hải Phòng cung cấp, bao gồm: mẫu dấu vết máu, mẫu tinh trùng và răng của tử thi. + Ba mươi mẫu dấu vết ADN (9 mẫu tăm bông thu trên miệng cốc uống nước; 5 mẫu ống hút dùng để uống nước; 3 mẫu bàn chải đánh răng; 9 mẫu đầu mẩu thuốc lá và 4 mẫu dao cạo râu) thu được từ 10 đối tượng cần KSAN do Phòng 4 - Cục Bảo vệ Chính trị VI (A67) - Bộ Công an cung cấp. + Một nghìn mẫu máu của 1.000 cá thể thuộc các nhóm đối tượng mà có nghề nghiệp tiềm ẩn nguy cơ rủi do cao như phi công, tiếp viên hàng không và ngư dân (trong đó, đã bao gồm cả 300 mẫu của người Kinh được lựa chọn cho nghiên cứu khảo sát tần suất alen). Tất cả các mẫu sinh phẩm này đều được lưu giữ ở -20oC, tại PTN Công nghệ gen và Vi sinh, Viện Kỹ thuật Hóa-Sinh và Tài liệu nghiệp vụ, Bộ Công an. 2.1.2. Bộ 16 locus nghiên cứu Bộ 16 locus nghiên cứu bao gồm 15 locus STR nằm trên NST thường (D3S1358, TH01, D21S11, D18S51, Penta E, D5S818, D13S317, D7S820, D16S539, CSF1PO, Penta D, vWA, D8S1179, TPOX và FGA) và locus Amelogenin để xác định giới tính. 2.1.3. Bộ 16 cặp mồi PCR gắn huỳnh quang Được nêu ở Bảng 2.1 như sau: Bảng 2.1. Kết quả đặt tổng hợp 16 cặp mồi PCR gắn huỳnh quang [83] (Nguồn: IDT, 2012). Mồi Trình tự nucleotide (5’>>>>>>>3’) GC (%) Tm ( o C) Đầu 5’ Tinh sạch OD260 Nồng độ (nmol) MW (g/mol) D3_F ACTGCAGTCCAATCTGGGT 52,6 56,4 OH HPLC 8,2 40,3 5.803 D3_R ATGAAATCAACAGAGGCTTGC 42,8 53,7 FL HPLC 5,5 23,5 7.000 TH_F GTGATTCCCATTGGCCTGTTC 52,3 56,5 FL HPLC 5,8 28,1 6.916 TH_R ATTCCTGTGGGCTGAAAAGCTC 50,0 57,8 OH HPLC 7,6 31,7 6.750 D21_F ATATGTGAGTCAATTCCCCAAG 40.9 52,5 OH HPLC 9,7 39,2 6.718 D21_R TGTATTAGTCAATGTTCTCCAGAGAC 38,4 54,2 FL HPLC 4,7 17,2 8.497 D18_F TTCTTGAGCCCAGAAGGTTA 45,0 53,4 FL HPLC 4,2 19,6 6.669 D18_R ATTCTACCAGCAACAACACAAATAAAC 33.3 54,6 OH HPLC 14,2 45,3 8.182 PeE_F ATTACCAACATGAAAGGGTACCAATA 34,4 54,4 OH HPLC 11,7 37,1 7.980 PeE_R TGGGTTATTAATTGAGAAAACTCCTTACA ATTT 27,2 55,8 FL HPLC 5,9 17,0 10.678 D5_F GGTGATTTTCCTCTTTGGTATCC 43,5 53,5 OH HPLC 7,2 31,7 7.002 D5_R AGCCACAGTTTACAACATTTGTATCT 34,6 55,1 JOE HPLC 3,4 12,6 8.570 D13_F ATTACAGAAGTCTGGGATGTGGAGGA 42,6 59,0 OH HPLC 12,0 38,7 8.139 D13_R GGCAGCCCAAAAAGACAGA 52,6 55,8 JOE HPLC 3,0 13,5 6.515 D7_F ATGTTGGTCAGGCTGACTATG 47,6 54,6 JOE HPLC 4,8 21,3 7.158 Bảng .1. Tiếp theo... Mồi Trình tự nucleotide (5’>>>>>>>3’) GC (%) Tm ( o C) Đầu 5’ Tinh sạch OD260 Nồng độ (nmol) MW (g/mol) D7_R GATTCCACATTTATCCTCATTGAC 37,5 51,9 OH HPLC 10,3 41,0 7.237 D16_F GGGGGTCTAAGAGCTTGTAAAAAG 45,8 55,5 OH HPLC 10,4 35,9 7.505 D16_R GTTTGTGTGTGCATCTGTAAGCATGTATC 41,3 58,2 JOE HPLC 3,3 11,1 9.611 CSF_F CCGGAGGTAAAGGTGTCTTAAAGT 45,8 56,4 JOE HPLC 4,2 15,9 8.123 CSF_R ATTTCCTGTGTCAGACCCTGTT 45,5 56,3 OH HPLC 7,9 35,8 6.667 PeD_F GAAGGTCGAAGCTGAAGTG 52,6 53,3 JOE HPLC 2,5 11,4 6.608 PeD_R ATTAGAATTCTTTAATCTGGACACAAG 29,6 51,7 OH HPLC 12,0 38,3 8.281 9 2.2. Phƣơng pháp nghiên cứu Luận án đã sử dụng 2 nhóm phương pháp nghiên cứu chính như sau: 2.2.1. Các phương pháp sinh học phân tử 2.2.1.1. Tách chiết ADN hệ gen người bằng Chelex [118] 2.2.1.2. Tách chiết ADN hệ gen người bằng phương pháp “salting out” 2.2.1.3. Tách chiết ADN hệ gen người từ mẫu xương bằng kit DNA IQ Systems 2.2.1.4. Định lượng ADN bằng máy quang phổ Nanodrop 2.2.1.5. Phương pháp tối ưu phản ứng PCR đa mồi [81, 83, 89] 2.2.1.6. Phương pháp xây dựng thang alen bằng PCR đa mồi 2.2.1.7. Phương pháp chế tạo kit PCR 16 locus gắn huỳnh quang trên hệ thống điện di mao quản 2.2.1.8. Phương pháp PCR sử dụng kit PCR 16 locus gắn huỳnh quang 2.2.1.9. Kỹ thuật điện di mao quản trên hệ thống máy 3130 Gentic Analyzer 2.2.2. Các phương pháp tin sinh học và xử lý số liệu bằng phần mềm 2.2.2.1. Kiểm tra mồi bằng phần mềm FastPCR, OligoAnalyzer và BLAST 2.2.2.2. Phân tích kiểu gen bằng phần mềm GenMapper® ID 2.2.2.3. Xử lý dữ liệu thống kê bằng phần mềm EasyDNA_PopuData 2.2.2.4. Xây dựng cây phả hệ di truyền bằng phần mềm POPTREE 2 CHƢƠNG 3. KẾT QUẢ NGHIÊN CỨU VÀ THẢO LUẬN 3.1. Kết quả nghiên cứu chế tạo bộ kit PCR 16 locus gắn huỳnh trên hệ thống điện di mao quản 3.1.1. Kết quả tối ưu điều kiện PCR đa mồi cho 16 cặp mồi gắn huỳnh quang 3.1.1.1. Kết quả tối ưu thành phần PCR đa mồi Từ các kết quả tối ưu thành phần tham gia phản ứng PCR đa mồi cho 16 cặp mồi gắn huỳnh quang, luận án đã lựa chọn được các thành phần tối ưu được nêu trong Bảng 3.1 như sau: Bảng 3.1. Thành phần tối ưu được lựa chọn cho PCR đa mồi của 16 cặp mồi nghiên cứu Thành phần Thể tích cần lấy (l) Nồng độ tối ƣu (cuối cùng) Colorless GoTaq® Flexi Buffer (5X) 4,8 1,2X dNTP (10mM) 0,5 250M 10 MgCl2 (25mM) 1,4 1,75mM HQ 16 plex 10X Primer Mix 2,0 1,0X GoTaq® Hot Start polymerase (5unit/l) 0,6 3,0 unit ADN 9947A (0,2 - 2,0 ng) 1,0 0,2 - 2,0 ng Nước deion-không có nuclease 9,7 - Tổng thể tích (l) 20,0 3.1.1.2. Kết quả tối ưu chu trình nhiệt PCR đa mồi Từ các kết quả tối chu trình nhiệt cho phản ứng PCR đa mồi cho 16 cặp mồi gắn huỳnh quang, luận án đã lựa chọn được chu trình nhiệt tối ưu là: 96 oC - 2 phút; (94 oC - 1 phút; 60 oC - 1 phút; 72 oC - 1 phút) x 30 chu kỳ; 60 oC - 30 phút và giữ ở 15 oC. 3.1.2. Kết quả xây dựng thang alen cho 16 locus nghiên cứu Sau khi xây dựng được thang alen cho 16 locus nghiên cứu (thực hiện theo phương pháp được nêu ở Mục 2.2.1.6), chất lượng thang alen được kiểm tra bằng cách như sau: Lấy 1,5l thang alen tinh sạch và 0,5 l ILS-600 trộn với 10,0l Hi-Di Formamide. Hỗn hợp này được biến tính bằng máy GenAmpPCR System 9700 ở 95oC trong 3 phút và giữ ở 4oC trong 5 phút. Sau đó, hỗn hợp này được điện di trên hệ thống máy 3130 Gentic Analyzer. Kết quả điện di được phân tích bằng phần mềm GenMapper® software v.3.2.1 và được nêu trong Hình 3.1 như sau: 3.1.3. Kết quả chế tạo bộ kit PCR 16 locus gắn huỳnh quang Thang alen sau khi tinh sạch Thang alen chưa tinh sạch Thang alen chưa tinh sạch Thang alen chưa tinh sạch Hình 3.1. Kết quả xây dựng thang alen 16 locus nghiên cứu bằng phương pháp PCR đa mồi, được điện di trên hệ thống máy 3130 Gentic Analyzer và phân tích bằng phần mềm GenMapper ® software v.3.2.1. Nhóm 6 locus đánh dấu JOE (D5S818, D13S317, D7S820, D16S539, CSF1PO và Penta D) 11 Bộ kit PCR 16 locus gắn huỳnh quang chế tạo thành công được mô tả ở Hình 3.2 như sau: Bộ kit PCR 16 locus gắn huỳnh quang này, đã được gửi đi thử nghiệm đánh giá tại 02 PTN phân tích ADN của Viện Khoa Học Hình Sự - Bộ Công an và Viện Pháp Y Quân Đội - Bộ Quốc phòng. Kết quả thử nghiệm đánh giá cho thấy: Bộ kit PCR 16 locus gắn huỳnh quang (có ký hiệu KIT PCR HQ 16 plex) có chất lượng tốt với độ nhạy, độ đặc hiệu cao, có thể sử dụng tốt cho việc giám định ADN theo công nghệ đánh dấu huỳnh quang-điện di mao quản, cụ thể như sau: - KIT PCR HQ 16 plex có nhạy và độ đặc hiệu tương đương với các bộ kit thương mại cùng loại đang được sử dụng ở Việt Nam hiện nay (PowerPlex 16 HS System và AmpFlSTR Identifiler PCR amplification) trên cùng mẫu ADN thử nghiệm là 9947A với dải nồng độ: 0,2 - 0,5 - 1,0 - 2,0 (ng/20l phản ứng). - Khả năng sử dụng của KIT PCR HQ 16 plex trong phân tích kiểu gen nhận dạng cá thể người được thử nghiệm đối với 5 mẫu ADN có nồng độ từ 0,5 đến 1,0 (ng/l) và 2 mẫu đối chứng (chứng dương sử dụng 9947A và chứng âm sử dụng nước deion diH2O) đều cho kết quả phân tích kiểu gen chính xác. - Bộ KIT PCR HQ 16 plex hoàn toàn tương thích với hệ thống máy 3130 Genetic Analyzer và phân tích kiểu gen bằng phần mềm phân tích kết quả GeneMapper ID v3.2.1 của hãng Applied Biosystems. 3.2. Kết quả ứng dụng bộ kit PCR 16 locus gắn huỳnh quang trong nghiên cứu di truyền quần thể ở ba dân tộc ngƣời Việt Nam 3.2.1. Kết quả khảo sát tần suất alen của 15 locus STR trên NST thường ở ba quần thể người Kinh, người Mường và người Khmer Sau khi chế tạo thành công bộ kit PCR 16 locus gắn huỳnh quang, đã được ứng dụng để khảo sát tần suất alen ở ba quần thể nghiên cứu là người Kinh (N=300) sống ở khu vực Hà Nội và thành phố Hồ Chí Minh; người Mường (N=104) sống ở tỉnh Hòa Bình và người Khmer (N=110) sống ở tỉnh Sóc Trăng, Việt Nam. Kết quả phân tích thống kê bằng phần mềm EasyDNA_PopuData [60] cho 15 locus STR nghiên cứu được nêu trong Bảng 3.4, Bảng 3.5 và Bảng 3.6 như sau: Hình 3.2. Mô tả thành phần bộ kit PCR 16 locus gắn huỳnh quang 12 Bảng 3.4. Tần suất alen và các chỉ số thống kê của 15 locus STR trên NST thường ở quần thể người Kinh (N=300) Alen D3S1358 TH01 D21S11 D18S51 Penta_E D5S818 D13S317 D7S820 D16S539 CSF1P0 Penta_D vWA D8S1179 TPOX FGA 5 --- 0,002 --- --- 0,057 --- --- --- --- --- 0,002 --- --- --- --- 6 --- 0,135 --- --- --- --- --- --- --- --- 0,002 --- --- --- --- 7 --- 0,31 --- --- 0,002 0,037 0,003 0,01 --- 0,01 0,03 --- --- 0,003 --- 8 --- 0,073 --- --- 0,002 0,002 0,315 0,138 0,002 0,002 0,087 --- 0,002 0,55 --- 9 --- 0,397 --- 0,002 0,015 0,048 0,127 0,05 0,225 0,04 0,307 --- 0,003 0,115 --- 9.1 --- --- --- --- --- --- --- 0,005 --- --- --- --- --- --- --- 9.3 --- 0,04 --- --- --- --- --- --- --- --- --- --- --- --- --- 10 --- 0,04 --- 0,002 0,037 0,241 0,147 0,165 0,132 0,202 0,155 --- 0,17 0,032 --- 11 --- 0,003 --- 0,005 0,252 0,305 0,211 0,393 0,288 0,302 0,158 --- 0,145 0,278 --- 12 --- --- --- 0,055 0,123 0,217 0,157 0,207 0,222 0,352 0,142 0,002 0,11 0,02 --- 13 0,003 --- --- 0,137 0,063 0,135 0,03 0,028 0,098 0,08 0,075 0,002 0,137 0,002 0,002 13.2 --- --- --- 0,017 --- --- --- --- --- --- --- --- --- --- --- 14 0,018 --- --- 0,204 0,078 0,013 0,01 0,002 0,03 0,007 0,027 0,295 0,157 --- --- 15 0,352 --- --- 0,202 0,095 0,002 --- 0,002 0,003 0,003 0,005 0,025 0,178 --- --- 16 0,345 --- --- 0,166 0,057 --- --- --- --- 0,002 0,008 0,128 0,082 --- 0,002 17 0,210 --- --- 0,077 0,067 --- --- --- --- --- 0,002 0,257 0,015 --- 0,003 18 0,060 --- --- 0,037 0,048 --- --- --- --- --- --- 0,173 0,002 --- 0,017 19 0,012 --- --- 0,037 0,04 --- --- --- --- --- --- 0,095 --- --- 0,092 20 --- --- --- 0,025 0,02 --- --- --- --- --- --- 0,02 --- --- 0,053 21 --- --- --- 0,017 0,015 --- --- --- --- --- --- 0,003 --- --- 0,122 21.2 --- --- --- --- --- --- --- --- --- --- --- --- --- --- 0,012 22 --- --- --- 0,005 0,012 --- --- --- --- --- --- --- --- --- 0,17 22.2 --- --- --- --- --- --- --- --- --- --- --- --- --- --- 0,012 23 --- --- --- 0,007 0,008 --- --- --- --- --- --- --- --- --- 0,131 23.2 --- --- --- --- --- --- --- --- --- --- --- --- --- --- 0,022 24 --- --- --- 0,002 0,007 --- --- --- --- --- --- --- --- --- 0,151 24.2 --- --- --- --- --- --- --- --- --- --- --- --- --- --- 0,017 25 --- --- --- 0,003 0,002 --- --- --- --- --- --- --- --- --- 0,085 25.2 --- --- --- --- --- --- --- --- --- --- --- --- --- --- 0,007 26 --- --- 0,002 --- --- --- --- --- --- --- --- --- --- --- 0,075 27 --- --- 0,002 --- --- --- --- --- --- --- --- --- --- --- 0,022 27.2 --- --- --- --- --- --- --- --- --- --- --- --- --- --- 0,002 28 --- --- 0,055 --- --- --- --- --- --- --- --- --- --- --- 0,002 28.2 --- --- 0,005 --- --- --- --- --- --- --- --- --- --- --- --- 29 --- --- 0,268 --- --- --- --- --- --- --- --- --- --- --- --- 30 --- --- 0,231 --- --- --- --- --- --- --- --- --- --- --- --- 30.2 --- --- 0,02 --- --- --- --- --- --- --- --- --- --- --- --- 31 --- --- 0,077 --- --- --- --- --- --- --- --- --- --- --- --- 31.2 --- --- 0,065 --- --- --- --- --- --- --- --- --- --- --- --- 32 --- --- 0,012 --- --- --- --- --- --- --- --- --- --- --- --- 32.2 --- --- 0,193 --- --- --- --- --- --- --- --- --- --- --- --- 33 --- --- 0,007 --- --- --- --- --- --- --- --- --- --- --- --- 33.2 --- --- 0,055 --- --- --- --- --- --- --- --- --- --- --- --- 34.2 --- --- 0,008 --- --- --- --- --- --- --- --- --- --- --- --- OH 0,670 0,74 0,803 0,823 0,897 0,77 0,797 0,75 0,797 0,763 0,813 0,803 0,847 0,593 0,867 EH 0,709 0,72 0,82 0,857 0,885 0,78 0,793 0,753 0,789 0,734 0,821 0,791 0,856 0,605 0,889 EH_SE 0,026 0,026 0,022 0,02 0,018 0,024 0,023 0,025 0,024 0,026 0,022 0,023 0,02 0,028 0,018 PD 0,862 0,877 0,945 0,964 0,978 0,917 0,927 0,905 0,923 0,885 0,947 0,925 0,962 0,786 0,978 PE 0,450 0,474 0,65 0,719 0,774 0,574 0,599 0,532 0,591 0,494 0,653 0,594 0,716 0,308 0,78 CHI 5,18 3,36 3,48 6,43 11,35 2,42 5,84 6,6 5,44 1,4 12,32 12,69 14,41 1,46 18,49 CHI(c) 7,81 7,81 7,81 12,59 12,59 12,59 18,31 12,59 18,31 7,81 18,31 18,31 32,67 7,81 25 p1 0,498 0,936 0,199 0,099 0,171 0,200 0,269 0,167 0,939 0,818 0,343 0,195 0,541 0,691 0,376 Bảng 3.5. Tần suất alen và các chỉ số thống kê của 15 locus STR trên NST thường ở quần thể người Mường (N=104) Alen D3S1358 TH01 D21S11 D18S51 Penta_E D5S818 D13S317 D7S820 D16S539 CSF1P0 Penta_D vWA D8S1179 TPOX FGA 5 --- --- --- --- 0,029 --- --- --- --- --- --- --- --- --- --- 6 --- 0,106 --- --- --- --- --- --- --- --- --- --- --- --- --- 7 --- 0,365 --- --- --- 0,014 --- 0,019 --- 0,029 0,024 --- --- 0,005 --- 8 --- 0,029 --- --- --- --- 0,403 0,154 --- --- 0,072 --- --- 0,602 --- 9 --- 0,385 --- --- --- 0,043 0,082 0,043 0,188 0,010 0,289 --- --- 0,072 --- 13 Bảng 3.6. Tần suất alen và các chỉ số thống kê của 15 locus STR trên NST thường ở quần thể người Khmer (N=110) Alen D3S1358 TH01 D21S11 D18S51 Penta_E D5S818 D13S317 D7S820 D16S539 CSF1P0 Penta_D vWA D8S1179 TPOX FGA 5 --- --- --- --- 0,027 --- --- --- --- --- --- --- --- 0,005 --- 6 --- 0,105 --- --- --- --- --- --- --- --- --- --- --- --- --- 7 --- 0,286 --- --- 0,018 0,023 --- 0,005 --- 0,005 0,018 --- --- --- --- 8 --- 0,055 --- --- --- 0,005 0,382 0,141 0,014 --- 0,082 --- --- 0,564 --- 9 --- 0,359 --- --- 0,009 0,036 0,077 0,05 0,186 0,014 0,332 --- --- 0,114 --- 9.1 --- --- --- --- --- --- --- 0,005 --- --- --- --- --- --- --- 9.3 --- 0,109 --- --- --- --- --- --- --- --- --- --- --- --- --- 10 --- 0,086 --- --- 0,032 0,286 0,118 0,217 0,132 0,281 0,132 --- 0,095 0,068 --- 10.1 --- --- --- --- --- --- --- 0,005 --- --- --- --- --- --- --- 14 Tóm lại: Bằng việc sử dụng bộ kit PCR 16 locus gắn huỳnh, luận án đã tiến hành khảo sát thành công sự phân bố tần suất alen cho 15 locus STR (D3S1358, TH01, D21S11, D18S51, Penta E, D5S818, D13S317, D7S820, D16S539, CSF1PO, Penta D, vWA, D8S1179, TPOX và FGA) ở ba quần thể nghiên cứu: người Kinh (N=300) sống ở khu vực Hà Nội và thành phố Hồ Chí Minh, khảo sát thu được 173 alen/15 locus; người Mường (N=104) sống ở tỉnh Hòa Bình, khảo sát thu được 132 alen/15 locus và người Khmer (N=110) sống ở tỉnh Sóc Trăng, khảo sát thu được 145 alen/15 locus. Kết quả nghiên cứu này, đã bổ sung vào CSDL tần suất alen 15 15 locus STR nghiên cứu ở quần thể người Việt Nam là 32 alen mới so với nghiên cứu trước đây của tác giả Shimada và các đồng nghiệp [103]. Các giá trị tần suất alen và các chỉ số thống kê cho thấy 15 locus STR sử dụng trong nghiên cứu này đều là các locus STR có tính đa hình cao, có thể sử dụng tốt trong phân tích ADN nhận dạng cá thể, xác định huyết thống và trong nghiên cứu di truyền quần thể. Sự phân bố tần suất alen của 15 locus STR nghiên cứu thu được từ thực nghiệm hoàn toàn phù hợp với định luật Hardy-Weinberg ở trạng thái cân bằng theo tiêu chuẩn 2 với độ tin cậy 95%. Điều này được thể hiện ở các giá trị CHI tính toán từ thực nghiệm của 15 locus STR này ở mỗi quần thể nghiên cứu đều nhỏ hơn các giá trị CHI(c) tương ứng. Ngoài ra, giá trị xác suất trong kiểm định theo định luật Hardy-Weinberg của mỗi locus (p1) cũng được xác định (xem Bảng 3.4; 3.5 và 3.6). 3.2.2. Mối quan hệ di truyền giữa ba quần thể nghiên cứu với một số quần thể khác trên thế giới Từ dữ liệu tần suất alen 13 locus STR thuộc bộ CODIS (do FBI-Mỹ lựa chọn) của ba quần thể nghiên cứu (người Kinh; người Mường và người Khmer) và 14 quần thể tham khảo [26, 52, 71, 72, 84, 98, 103, 119, 121, 122], đã xây dựng được cây phả hệ di truyền theo phương pháp neighbor-joining bằng phần mềm POPTREE2 [109]. Cây phả hệ di truyền này, đã phản ánh được mối quan hệ di truyền giữa 3 quần thể nghiên cứu với 14 quần thể tham khảo dựa trên các giá trị khoảng cách di truyền chuẩn của Nei (DST) giữa các quần thể với nhau (xem Hình 3.19). Kết quả nghiên cứu này đã đáp ứng được mục đích mong đợi và cho thấy rằng từ dữ liệu tần suất alen của các locus STR nằm trên NST thường có thể sử dụng tốt cho các nghiên cứu về mối quan hệ di truyền giữa các quần thể người khác nhau trên trên thế giới (mặc dù các quần thể này hoàn toàn cách ly về địa lý) hoặc các quần thể phân nhỏ (các quần thể người dân tộc) cùng sống trên lãnh thổ của một quốc gia. Hình 3.19. Cây phả hệ di truyền giữa ba quần thể nghiên cứu với 14 quần thể Iraqi-Iraq African-USA Caucasian-USA Hispanic-USA Kinh-VN Muong-VN Vietnamese Thai Malay-Sing Khmer-VN Manchu-TQ Chinese-Sing Han-TQ Hui-TQ Japanese Korean Indian-Sing 0.01 16 3.3. Kết quả ứng dụng bộ kit PCR 16 locus gắn huỳnh quang trong phân tích ADN nhận dạng cá thể ngƣời 3.3.1. Kết quả ứng dụng bộ kit PCR 16 locus gắn huỳnh quang trong một số vụ án Việc ứng dụng bộ kit PCR 16 locus gắn huỳnh quang để truy nguyên cá thể và truy tìm tung tích nạn nhân từ các mẫu dấu vết sinh phẩm thu được từ hiện trường của một số vụ án tiêu biểu do Phòng PC54 - CATP Hải Phòng cung cấp như sau:  Trường hợp 01 (vụ án mạng): Mẫu phân tích do Phòng PC54 - CATP Hải Phòng cung cấp bao gồm: (1) Dấu vết máu dính trên dao bàu (DV_MÁU_DAO) và (2) mẫu máu của nạn nhân (MÁU_NN). Kết quả phân tích được thể hiện ở Bảng 3.8 như sau: Bảng 3.8. Kết quả phân tích ADN từ mẫu DV_MÁU_DAO và mẫu MÁU_NN trong một vụ án mạng xảy ra tại quận Lê Chân, Tp. Hải Phòng bằng bộ kit PCR 16 locus gắn huỳnh quang. LOCUS DV_MÁU_DAO MÁU_NN TẦN SUẤT KIỂU GEN (2pq hoặc p2 hoặc q2) (Tính theo dữ liệu tần suất alen của người Kinh, N=300) D3S1358 16 17 16 17 0,1449 TH01 7 9 7 9 0,2461 D21S11 30 32.2 30 32.2 0,0892 D18S51 13 21 13 21 0,0047 Penta E 11 16 11 16 0,0287 D5S818 11 13 11 13 0,0824 D13S317 11 13 11 13 0,0127 D7S820 11 12 11 12 0,1627 D16S539 11 13 11 13 0,0564 CSF1PO 10 12 10 12 0,1422 Penta D 9 10 9 10 0,0952 Amelogenin X Y X Y 1,0000 vWA 16 16 16 16 0,0164 D8S1179 12 15 12 15 0,0392 TPOX 8 11 8 11 0,3058 FGA 24.2 24.2 24.2 24.2 0,0003 TẦN SUẤT KIỂU GEN KẾT HỢP 16 LOCUS: 0,0000000000000000000031 17 ĐỘ TIN CẬY (CI): 99,99999999999999999969% Từ kết quả được nêu trong Bảng 3.8 cho thấy: Mẫu DV_MÁU_DAO và MÁU_NN là của cùng một người với độ tin cậy là 99,99999999999999999969%. Điều này có nghĩa là dao bàu chính là hung khí mà đối tượng đã sử dụng để gây án. Từ kết quả này, qua công tác nghiệp vụ điều tra, cơ quan Cảnh sát Điều tra của quận Lê Chân đã bắt được đối tượng gây án chịu tội trước pháp luật.  Trường hợp 02 (vụ án hiếp dâm trẻ em): Mẫu phân tích do Phòng PC54 - CATP Hải Phòng cung cấp bao gồm: (1) Dấu vết tinh dịch thu được trên quần lót của nạn nhân (DV_Q. LÓT_NN); (2) mẫu máu của đối tượng nghi vấn 01 (MÁU_ĐT_01); (3) mẫu máu của đối tượng nghi vấn 02 (MÁU_ĐT_02) và (4) mẫu máu của nạn nhân (MÁU_NN). Kết quả phân tích được thể hiện ở Bảng 3.9 như sau: Bảng 3.9. Kết quả phân tích ADN từ mẫu DV_Q. LÓT_NN và mẫu MÁU_ĐT_01 trong một vụ án hiếp dâm xảy ra tại quận Dương Kinh, Tp. Hải Phòng bằng bộ kit PCR 16 locus gắn huỳnh quang. LOCUS DV_Q. LÓT_NN MÁU_ĐT_01 TẦN SUẤT KIỂU GEN (2pq hoặc p2 hoặc q2) (Tính theo dữ liệu tần suất alen của người Kinh, N=300) D3S1358 16 16 16 16 0,1190 TH01

Các file đính kèm theo tài liệu này:

  • pdftt_nghien_cuu_hoan_thien_bo_kit_pcr_16_gen_gan_huynh_quang_ung_dung_trong_nghien_cuu_dan_toc_hoc_va.pdf
Tài liệu liên quan