Tóm tắt Luận án Nghiên cứu một số đặc tính của vi khuẩn Escherichia coli (nhóm VTEC) phân lập từ bò, lợn được giết mổ tại Hà Nộ

Thành phố Hà Nội đã xây dựng được 14 cơ sở giết mổ gia súc, gia cầm tập

trung. Tuy nhiên cho đến nay đã có nhiều cơ sở giết mổ không còn hoạt động,

một số chỉ hoạt động cầm chừng, hoặc có cơ sở giết mổ lợn công nghiệp nhưng

lại tổ chức giết mổ thủ công khoảng 10 con lợn/ngày để cung cấp cho các siêu

thị, bếp ăn tập thể.

Do địa bàn quản lý rộng, các điểm, hộ giết mổ gia súc, gia cầm nhỏ lẻ ở

các huyện ngoại thành chiếm 50% số lượng sản phẩm gia súc, gia cầm trên địa

bàn Hà Nội. Vì vậy, việc quản lý giết mổ gặp nhiều khó khăn, không kiểm soát

được. Nguồn thực phẩm này không đảm bảo các điều kiện vệ sinh thú y, an toàn

thực phẩm, không được cơ quan thú y kiểm soát theo quy định nhưng lại là

nguồn cung cấp chính thực phẩm cho Thành phố Hà Nội.

pdf27 trang | Chia sẻ: lavie11 | Lượt xem: 416 | Lượt tải: 0download
Bạn đang xem trước 20 trang tài liệu Tóm tắt Luận án Nghiên cứu một số đặc tính của vi khuẩn Escherichia coli (nhóm VTEC) phân lập từ bò, lợn được giết mổ tại Hà Nộ, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
ểm giết mổ và phương tiện vận chuyển của các điểm giết mổ trên địa bàn Hà Nội 6 - Thực trạng vệ sinh tại khu giết mổ gia súc, gia cầm trên địa bàn Hà Nội - Thực trạng điều kiện vệ sinh thú y tại cơ sở kinh doanh, chợ, tiêu thụ sản phẩm thịt gia súc, gia cầm 2.1.2 Thiết lập và chuẩn hóa phương pháp PCR dùng để xác định vi khuẩn VTEC - Lựa chọn giữa PCR đơn mồi và Multiplex - PCR - Lựa chọn môi trường nuôi cấy thích hợp để tách chiết DNA mẫu - Thực hiện phản ứng PCR với các chủng vi khuẩn đối chứng - Xác định độ nhạy và độ đặc hiệu của phản ứng PCR dùng để xác định VTEC trong môi trường nhân tạo - Xác định độ nhạy và độ đặc hiệu của phản ứng PCR dùng để xác định VTEC trong mẫu thịt sạch - Xây dựng quy trình xác định sự có mặt của vi khuẩn VTEC trong các mẫu thịt 2.1.3 Tỷ lệ nhiễm và một số đặc tính cơ bản của những chủng VTEC phân lập được - Tỷ lệ nhiễm trong phân - Tỷ lệ nhiễm trong thân thịt và mẫu lau thân thịt - Xác định các yếu tố độc lực cơ bản + Độc tố VT1 + Độc tố VT2 + Yếu tố bám dính intimin - Xác định serotyp - Xác định sự đa dạng di truyền của các VTEC có nguồn gốc phân lập khác nhau 2.3 Đối t ợng nghiên cứu - Các chủng vi khuẩn E. coli nhóm VTEC phân lập được - Các chủng vi khuẩn E. coli đối chứng dương và âm 2.4 Nguyên liệu nghiên cứu Các môi trường nuôi cấy, hóa chất, sinh phẩm do hãng Merck, Oxoid cung cấp. Các chủng vi khuẩn E. coli đối chứng do một số phòng tham chiếu E. coli cung cấp. Các loại dụng cụ, trang thiết bị, máy móc phòng thí nghiệm. 2.5 Ph ơng pháp nghiên cứu 2.5.1 Phương pháp lấy mẫu - Lấy mẫu thịt tươi: mẫu thịt lợn, bò được mua ngẫu nhiên tại một số chợ và siêu thị trên địa bàn Hà Nội. Mẫu được lấy vào buổi sáng (6 - 7 giờ). Mỗi mẫu được đựng riêng rẽ vào 1 túi nilon sạch, có ghi rõ ký hiệu. - Lấy mẫu lau thân thịt: dùng gạc tiệt trùng lau trên thân thịt sau khi đã 7 được giết mổ, tách toàn bộ nội tạng, mỗi thân thịt lau tại 3 vị trí, 100 cm2/vị trí. Sau khi lau, gạc được đặt vào lọ có chứa 20ml môi trường mTSB. 2.5.2 Phương pháp xác định số lượng vi khuẩn trong canh khuẩn nuôi cấy Canh khuẩn sau khi nuôi cấy được pha loãng trong dung dịch PBS thành các nồng độ 10-1, 10-2, , 10-8. Lấy 0,1ml dung dịch ở các nồng độ pha loãng 10-6, 10 -7 , 10 -8 nhỏ và dàn đều trên bề mặt thạch máu, bồi dưỡng ở 370C trong 24 giờ. Mỗi nồng độ pha loãng dùng 03 đĩa thạch. Đếm số khuẩn lạc mọc trên đĩa thạch, rồi tính trung bình cho mỗi nồng độ. 2.5.3 Phương pháp tiến hành phản ứng PCR Trình tự các mồi, kích cỡ sản phẩm, thành phần các chất và chu kỳ nhiệt của phản ứng PCR được trình bày ở các bảng 2.1, 2.2, 2.3. Bảng 2.1. Trình tự mồi ùng để xác định các gen VT1, VT2 và eae Gen đích Ký hiệu primers Chuỗi primers (5 ’- 3 ’) Kích cỡ sản phẩm (bp) VT1 VT1-F 5’ - CAGTTAATGTGGTGGCGAAG - 3’ 894 VT1-R 5’ - CTGCTAATAGTTCTGCGCATG - 3’ VT2 VT2-F 5’ - CTTCGGTATCCTATTCCCGG - 3’ 481 VT2-R 5’ - GGATGCATCTCTGGTCATTG - 3’ eae eae-F 5’ - ACGTTGCAGCATGGGTAACTC - 3’ 816 eae-R 5’ - GATCGGCAACAGTTTCACCTG - 3’ Bảng 2.2. Thành phần các chất trong phản ứng PCR ùng để xác định các gen VT1, VT2 và eae Thành phần Thể tích (l) Nồng độ Mồi xuôi 3 3,2 M /l Mồi ngược 3 3,2 M /l Dung dịch đệm AMP x 5 (Fermentas) gồm: + 750 mM Tris - HCl (pH=8) + 200 mM (NH4)2SO4 + 0,1% (v/v) Tween 20 + dNTPs + 2 mM MgCl2 5 - Taq - polymerase (Fermentas) 0,62 l 500 UI (1 U/1 l) DNA mẫu thích hợp Nước khử ion vừa đủ 25 l - Tổng cộng 25 l - 8 Bảng 2.3. Các chu kỳ nhiệt của phản ứng PCR ùng để xác định gen VT1, VT2 và eae Các giai đoạn của phản ứng Nhiệt độ (oC) Th i gian (phút) Số chu kỳ Giai đoạn tiền biến tính 94 5 1 Giai đoạn biến tính Giai đoạn bắt cặp Giai đoạn tổng hợp 94 50 72 1 1 1 30 Giai đoạn kéo dài 72 7 1 Giữ ở 40C 2.5.4 Phương pháp xác định độ đặc hiệu của phản ứng PCR Độ đặc hiệu của phản ứng PCR được xác định bằng cách kiểm tra với 10 chủng VTEC đối chứng dương và 10 chủng đối chứng âm với các thông tin về đặc tính của một số yếu tố gây bệnh đã được công bố. 2.5.5 Phương pháp xác định độ nhạy của phản ứng PCR Dùng phản ứng PCR để xác định VTEC trong môi trường nhân tạo, trong các mẫu thịt sạch 2.5.6 Phương pháp phân lập và giám định vi khuẩn VTEC Tiến hành phân lập và giám định vi khuẩn VTEC theo quy trình tham khảo của FDA (US Food and Drug Administration) và Phòng Thí nghiệm tham chiếu vi khuẩn E. coli của OIE, Canada (Universite’ de Montre’al, Canada). 2.5.7 Phương pháp xác định serotyp kháng nguyên O của các chủng vi khuẩn phân lập được Phương pháp xác định serotyp kháng nguyên O của vi khuẩn E. coli bằng phương pháp ngưng kết nhanh trên phiến kính. Các chủng vi khuẩn được tiến hành xác định nhóm với huyết thanh đa giá trước, sau đó đến các huyết thanh đơn giá trong nhóm 2.5.8 Xác định sự đa dạng di truyền của các chủng VTEC có nguồn gốc khác nhau bằng phản ứng PFGE ( Pulsed-field gel electrophoresis) Sự tương đồng hệ gen của một số chủng vi khuẩn E. coli phân lập được xác định bằng phương pháp PFGE tại phòng thí nghiệm Vi khuẩn, Viện vệ sinh dịch tễ Trung ương. Quy trình chuẩn bị mẫu DNA và thực hiện phản ứng dựa theo Helgerson và cs. (2006) [39]. 2.5.9 Xử lý số liệu Số liệu thu thập được xử lý bằng phần mềm MS Excel 2003 để tính. Sự sai khác giữa các giá trị được xem là có ý nghĩa thống kê khi P < 0,05. 9 Ch ơng 3 KẾT QUẢ VÀ THẢO LUẬN 3.1 Thực trạng công tác kiểm soát giết mổ, vệ sinh thú y trên địa bàn Hà Nội Theo số liệu thống kê, Hà Nội có khoảng 245.000 con trâu bò, 1.670.000 con lợn và gần 16 triệu con gia cầm. Trung bình mỗi ngày Hà Nội tiêu thụ khoảng 500 – 600 tấn thịt gia súc, gia cầm. Trong đó Hà Nội tự sản xuất khoảng 60%, phần còn lại do các địa phương khác cung cấp hoặc nhập khẩu từ nước ngoài. Bao gồm: gia súc, gia cầm sống, thân thịt gia súc, gia cầm sau khi giết mổ và thịt mảnh các loại. Vì vậy, thị trường thực phẩm tươi sống có nguồn gốc động vật ở Hà Nội rất phong phú đa dạng. 3.1.1 Thực trạng công tác kiểm soát giết mổ tại các điểm giết mổ gia súc, gia cầm trên địa bàn Hà Nội Bảng 3.1. Số l ợng các điểm giết mổ trên địa bàn Hà Nội STT Quận, Huyện Loại gia súc Tổng số điểm giết mổ Lợn Trâu, bò Gia cầm 1 Ba Vì 2 4 6 2 Ch ơng Mỹ 5 1 3 9 3 Đan Ph ợng 4 4 4 Đông Anh 4 9 2 15 5 Gia lâm 2 3 3 8 6 Hà Đông 3 1 4 7 Hoàng Mai 4 4 8 Hoài Đức 1 4 1 6 9 Mê Linh 21 5 3 29 10 Mỹ Đức 41 12 12 65 11 Phú Xuyên 33 1 34 12 Phúc Thọ 23 3 8 34 13 Quốc Oai 3 3 14 Sóc Sơn 3 1 4 15 Sơn Tây 6 6 16 Tây Hồ 2 2 17 Thanh Oai 2 24 26 18 Thạch Thất 59 1 3 63 19 Thanh Trì 10 10 20 Th ng Tín 7 2 102 111 21 Từ Liêm 9 9 22 Ứng Hòa 15 15 Tổng số 199 89 179 467 (Nguồn: Chi cục Thú y Hà Nội) 10 Thành phố Hà Nội đã xây dựng được 14 cơ sở giết mổ gia súc, gia cầm tập trung. Tuy nhiên cho đến nay đã có nhiều cơ sở giết mổ không còn hoạt động, một số chỉ hoạt động cầm chừng, hoặc có cơ sở giết mổ lợn công nghiệp nhưng lại tổ chức giết mổ thủ công khoảng 10 con lợn/ngày để cung cấp cho các siêu thị, bếp ăn tập thể. Do địa bàn quản lý rộng, các điểm, hộ giết mổ gia súc, gia cầm nhỏ lẻ ở các huyện ngoại thành chiếm 50% số lượng sản phẩm gia súc, gia cầm trên địa bàn Hà Nội. Vì vậy, việc quản lý giết mổ gặp nhiều khó khăn, không kiểm soát được. Nguồn thực phẩm này không đảm bảo các điều kiện vệ sinh thú y, an toàn thực phẩm, không được cơ quan thú y kiểm soát theo quy định nhưng lại là nguồn cung cấp chính thực phẩm cho Thành phố Hà Nội. 3.1.2 Kết quả điều tra điều kiện điểm giết mổ và phương tiện vận chuyển của các điểm giết mổ trên địa bàn Hà Nội Bảng 3.2: Kết quả điều tra điều kiện điểm giết mổ và ph ơng tiện vận chuyển của các điểm giết mổ trên địa bàn Hà Nội TT Đối t ợng giết mổ Số l ợng các điểm giết mổ Điều kiện điểm giết mổ Phương tiện vận chuyển Đ ợc phân thành khu riêng biệt Giết mổ trên bàn, bệ Giết mổ trên sàn nhà Có khu khám thân thịt, phủ tạng Ôtô Xe máy Bao gói khi vận chuyển 1 Lợn 199 02 04 191 02 20 179 0 2 Trâu, bò 89 0 0 89 0 05 84 0 3 Gia cầm 179 02 05 172 0 15 164 0 Tổng 467 04 09 452 02 40 427 0 Tỷ lệ % 0,9 1,9 96,8 0,4 8,6 91,4 0 - Trong 467 điểm giết mổ chỉ có 02 điểm giết mổ gia cầm, 02 điểm giết mổ lợn được phân thành khu riêng biệt, chiếm tỷ lệ 0,9%; 02 điểm có khu khám thân thịt, phủ tạng riêng, chiếm tỷ lệ 0,4%; 09 điểm giết mổ trên bàn, bệ, chiếm 1,9% và nhiều nhất là 452 điểm giết mổ trên sàn nhà, chiếm tỷ lệ 96,8%. - Về vệ sinh tiêu độc nhà xưởng, trang thiết bị, dụng cụ giết mổ trước và sau khi giết mổ cũng như việc vệ sinh tiêu độc định kỳ có ý nghĩa rất quan trọng trong khâu vệ sinh giết mổ nhằm tiêu diệt các vi sinh vật gây ô nhiễm lưu trú trên nền, sàn, bàn bệ và các vật dụng khác. Thực trạng hiện nay hầu hết các điểm giết mổ trên địa bàn Hà Nội đều không quan tâm đến vệ sinh tiêu độc. - Các phương tiện vận chuyển thịt, gia súc và gia cầm sống ở các điểm giết mổ trên thường không phải là các phương tiện vận chuyển chuyên dụng, chúng 11 có thể được sử dụng với nhiều mục đích khác nhau không đảm bảo vệ sinh theo quy định của Pháp lệnh thú y. Vì thế thịt và các sản phẩm từ thịt có thể bị ô nhiễm trong quá trình vận chuyển hoặc ô nhiễm từ các phương tiện này. Việc vận chuyển gia súc, gia cầm sống như trên cũng là nguyên nhân làm lây lan dịch bệnh, gieo rắc mầm bệnh ra môi trường xung quanh và gây ô nhiễm môi trường. 3.1.3 Thực trạng vệ sinh tại khu giết mổ gia súc, gia cầm trên địa bàn Hà Nội Bảng 3.3: Thực trạng vệ sinh của các điểm giết mổ gia súc, gia cầm thuộc địa bàn Hà Nội STT Đối t ợng giết mổ Số l ợng điểm giết mổ Nguồn n c sử ụng trong GM(*) Ph ơng pháp xử lý chất thải Vệ sinh tiêu độc N c máy N c giếng khoan N c giếng khơi Hầm chứa, hồ sinh học Biogas Thải tự do VSTĐ(**) ụng cụ GM VSTĐ tr c, sau khi GM VSTĐ định kỳ khu GM 1 Lợn 199 58 141 0 29 0 170 41 16 28 2 Trâu, bò 89 27 62 0 18 0 71 21 15 14 3 Gia cầm 179 73 106 0 27 0 152 29 21 24 Tổng hợp 467 158 309 0 74 0 393 91 52 66 Tỷ lệ (%) 33,8 66,2 0,0 15,8 0,0 84,2 19,5 11,1 14,1 Ghi chú: (*)GM: Giết mổ (**) VSTĐ: Vệ sinh tiêu độc - Đối với nước sử dụng trong quá trình giết mổ: Có tới 309 điểm trong tổng số 467 điểm giết mổ sử dụng nước giếng khoan, chiếm tỷ lệ 66,2%. Trong khi đó chỉ có 158 điểm có sử dụng nước máy (đạt tiêu chuẩn vệ sinh), chiếm tỷ lệ 33,8%. - Về việc xử lý chất thải tại các điểm giết mổ: Qua điều tra 467 điểm giết mổ trên địa bàn Hà Nội chúng tôi thấy: có 393/467 điểm giết mổ (chiếm tỷ lệ 84,2%), chất thải được thải tự do ra môi trường. Chỉ có 74 điểm chiếm tỷ lệ 15,8%, có sử dụng hầm chứa, hồ sinh học để xử lý chất thải. - Vệ sinh tiêu độc nơi giết mổ: Thực trạng hiện nay hầu hết các điểm giết mổ tư nhân trên địa bàn Hà Nội đều không quan tâm đến vệ sinh tiêu độc. Hơn nữa các điểm giết mổ gia súc, gia cầm phần lớn không chịu sự quản lý, kiểm tra, giám sát của trạm thú y, nên các điểm giết mổ tiến hành giết mổ một cách tự do không thực hiện theo quy trình vệ sinh thú y. Cách giết mổ tùy tiện này đã làm cho hệ vi sinh vật phát triển và tồn tại trên nền, sàn khu giết mổ, tường nhà và các vật dụng tham gia vào quá trình giết mổ sau đó gây ô nhiễm vào thịt. 12 3.1.4 Thực trạng điều kiện vệ sinh thú y tại cơ sở kinh doanh, chợ, tiêu thụ sản phẩm gia súc, gia cầm Có khoảng 300 chợ có hoạt động kinh doanh sản phẩm gia súc, gia cầm không bao gồm cả chợ cóc, chợ tạm. Ý thức chấp hành quy định của pháp luật về kiểm dịch, kiểm soát giết mổ, kiểm tra vệ sinh thú y của người kinh doanh, buôn bán sản phẩm gia súc, gia cầm thấp. Hầu hết thịt gia súc bày bán ở chợ được vận chuyển bằng xe máy, không được che đậy. Thịt gia súc, gia cầm bày bán ở các chợ cóc, chợ tạm thường không qua kiểm soát thú y, không có dấu kiểm soát giết mổ, tem kiểm tra vệ sinh thú y theo đúng quy định. 3.2 Thiết lập và chuẩn hóa ph ơng pháp PCR ùng để xác định vi khuẩn VTEC 3.2.1 Lựa chọn giữa PCR đơn mồi và Multiplex - PCR Trong nghiên cứu này, chúng tôi đã xây dựng một phương pháp Multiplex – PCR nhằm xác định 3 loại gen độc lực của các chủng VTEC đối chứng, từ đó áp dụng đối với các chủng phân lập được, lần lượt là gen VT1 mã hóa cho độc tố VT1, gen VT2 mã hóa cho độc tố VT2 và gen eae mã hóa cho yếu tố intimin. Thí nghiệm tiến hành với 2 chủng vi khuẩn E. coli đối chứng dương (FD523, FD636) và 1 chủng vi khuẩn E. coli đối chứng âm (C-600). DNA mẫu là lượng nhỏ khuẩn lạc nuôi cấy trên thạch máu cừu. Kết quả cho thấy: Phản ứng Multiplex -PCR với cả 3 loại cặp mồi đều cho các sản phẩm riêng biệt và ổn định như trong phản ứng với từng cặp mồi riêng biệt. Ngoài ra, Multiplex - PCR còn thể hiện một số ưu điểm khác: tiết kiệm thời gian, công lao động và đặc biệt là tiêu hao vật tư, hóa chất. Bảng 3.4: Kết quả thử nghiệm phản ứng PCR đơn và Multiplex – PCR để phát hiện một số gen độc lực của VTEC Các chủng vi khuẩn kiểm tra PCR đơn mồi Multiplex - PCR VT1 VT2 eae VT1 VT2 eae E. coli FD523 + + - + + - E. coli FD636 + + + + + + E. coli C-600 - - - - - - 3.2.2 Lựa chọn môi trường nuôi cấy thích hợp để tách chiết DNA mẫu Thí nghiệm được tiến hành với 2 chủng VTEC, gồm 2 đối chứng dương (FD523, FD636) và 1 đối chứng âm (C-600). Vi khuẩn được nuôi cấy trên 5 loại môi trường lỏng (LB, m-TSB, BHI, BPW và NB) và thạch máu. Ủ ở tủ ấm 370C qua đêm. Sau đó, phản ứng PCR được tiến hành như đã trình bày, kết quả như sau: 13 Như vậy, có thể thấy: cả 5 loại môi trường lỏng đều không gây ảnh hưởng đến chất lượng và kết quả của phản ứng PCR. Chúng tôi đã quyết định lựa chọn môi trường m-TSB là môi trường tăng sinh thích hợp ban đầu cho việc kiểm tra sự có mặt của nhóm vi khuẩn VTEC đối với các mẫu thịt tươi. Bảng 3.5. Kết quả xác định môi tr ng thích hợp nuôi cấy vi khuẩn E. coli để chiết tách DNA cho phản ứng PCR Số lần thí nghiệm Loại môi tr ng nuôi cấy Kết quả phản ứng PCR Chủng đối chứng ơng Chủng đối chứng âm FD523 FD636 C-600 2 LB + + - m-TSB + + - BHI + + - BPW + + - NB + + - 3.2.3 Kết quả thực hiện phản ứng PCR với các chủng vi khuẩn E.coli tham chiếu Thực hiện phản ứng Multiplex - PCR đã được chuẩn hóa dùng để xác định 3 gen (VT1, VT2 và eae) với 10 chủng đối chứng dương và 10 chủng đối chứng âm. So sánh kết quả với các thông tin về đặc tính của một số yếu tố gây bệnh của các chủng đối chứng được công bố, thì kết quả hoàn toàn phù hợp. Như vậy, phản ứng PCR đã được chuẩn hóa trong nghiên cứu này dùng để xác định 3 loại gen có độ đặc hiệu là 100% khi được xem xét thử nghiệm trên các chủng đối chứng. Bảng 3.6a: Kết quả thực hiện phản ứng Multiplex - PCR để phát hiện các chủng vi khuẩn đối chứng ơng Ký hiệu chủng Một số yếu tố gây bệnh VT1 VT2 eae Đối chứng dương E. coli FD523 + + - E. coli FD526 + - - E. coli FD528 - + - E. coli FD635 + + + E. coli FD636 + + + E. coli BDL9.1 - + - E. coli BKT29.1 - + - E. coli E4 + + - E. coli E7 + + - E. coli E41 + + - 14 Bảng 3.6b: Kết quả thực hiện phản ứng Multiplex - PCR v i các chủng vi khuẩn đối chứng âm Ký hiệu chủng Một số yếu tố gây bệnh VT1 VT2 eae Đối chứng âm E. coli (C-600) (K-12) - - - E. coli FV847a - - - E. coli FV2289 - - - E. coli FV2586 - - - E. coli FV2593 - - - S. typhymurium (FD675) - - - P. multocida (PM-VT3) - - - S. suis (HN-25) - - - S. aureus (FD231) - - - C. perfringens (BCD6) - - - 3.2.4 Kết quả xác định độ nhạy và độ đặc hiệu của phản ứng PCR dùng để xác định VTEC trong môi trường nhân tạo Để xác định độ nhạy và độ đặc hiệu của phản ứng PCR, trước hết cần xác định được số lượng vi khuẩn trên một số môi trường nuôi cấy, từ đó lựa chọn được môi trường thích hợp để nhân số lượng vi khuẩn và tách DNA cho phản ứng PCR. Bảng 3.7 Kết quả nuôi cấy hai chủng vi khuẩn đối chứng ơng trên một số môi tr ng nuôi cấy Số lần TN Môi tr ng nuôi cấy Số l ợng CFU (x 106) Giá trị P Chủng FD523 Chủng FD636 3 BHI 2375,2 2508,3 P > 0,05 LB 622,5 570,4 P > 0,05 m-TSB 660,3 657,5 P > 0,05 Các số liệu được xử lý thống kê, sự sai khác này không có ý nghĩa thống kê (P>0,05). Như vậy, số lượng hai chủng vi khuẩn đối chứng là tương đương nhau ở cả 3 loại môi trương. Trong đó môi trường BHI cho kết quả cao nhất (2.300-2.500 x 10 6 CFU/ml). Điều này chứng tỏ BHI là môi trường có dinh dưỡng tốt nhất cho nuôi cấy vi khuẩn VTEC. Tuy nhiên, khi tiến hành so sánh và phân tích thêm một số chỉ tiêu khác (chất lượng môi trường ảnh hưởng tới mức độ tăng sinh của vi khuẩn, giá thành, tác động tới môi trường, ...), chúng tôi đã quyết định lựa chọn môi trường m-TSB là môi trường tăng sinh thích hợp ban đầu cho việc kiểm tra sự có mặt của nhóm vi khuẩn VTEC đối với các mẫu thịt tươi. Như vậy: - Về độ đặc hiệu của phản ứng: DNA được tách ra từ 3 loại môi trường nuôi cấy đều cho phản ứng PCR dương tính với độ đặc hiệu là 100% với cả 3 loại gen VT1, VT2 và eae. 15 Bảng 3.8: Kết quả xác định độ nhạy và độ đặc hiệu của phản ứng PCR khi xác định VTEC trên môi tr ng nuôi cấy Nồng độ pha loãng Số lần TN Kết quả của phản ứng PCR Đánh giá độ đặc hiệu (%) Chủng FD523 Chủng FD636 LB (6,2x10 8 CFU/ml) m-TSB (6,6x10 8 CFU/ml) BHI (23,7x10 8 CFU/ml) LB (5,7x10 8 CFU/ml) m-TSB (6,5x10 8 CFU/ml) BHI (25,1x10 8 CFU/ml) CKBĐ 2/2 + + + + + + 100 10 -1 2/2 + + + + + + 10 -2 2/2 + + + + + + 10 -3 2/2 + + + + + + 10 -4 2/2 + + + + + + 10 -5 2/2 - - + - - + 10 -6 2/2 - - - - - - 10 -7 2/2 - - - - - - 10 -8 2/2 - - - - - - Ghi chú CKBĐ: Canh khuẩn ban đầu + Phản ứng dương tính với cả 3 loại gen VT1, VT2 và eae - Phản ứng âm tính với cả 3 loại gen VT1, VT2 và eae - Về độ nhạy của phản ứng: Ngưỡng giới hạn dưới (Lower limit) về số lượng của vi khuẩn VTEC để có thể phát hiện được trong một số môi trường nuôi cấy như sau: + Môi trường LB: 5,7 - 6,26 x 104 CFU/ml + Môi trường m-TSB: 6,5 - 6,6 x 104 CFU/ml + Môi trường BHI: 23,75 – 25,08 x 104 CFU/ml Có thể thấy: ở cả 3 loại môi trường, ngưỡng giới hạn dưới hay mật độ của vi khuẩn để từ đó có thể dùng để phát hiện được VTEC bằng phản ứng PCR là tương đương nhau, khoảng 5,7 – 25,08 x 104 CFU/ml. 3.2.5 Kết quả xác định độ nhạy và độ đặc hiệu của phương pháp PCR dùng để xác định VTEC trong mẫu thịt sạch Như vậy, có thể kết luận độ nhạy và độ đặc hiệu của phản ứng PCR như sau: + Về độ đặc hiệu của phản ứng: DNA được tách ra từ môi trường m-TSB có các mẫu thịt đều cho các phản ứng PCR dương tính, tương đương độ đặc hiệu 100% với cả 3 loại gen VT1, VT2 và eae. + Về độ nhạy của phản ứng: Với cả 3 loại thịt, ngưỡng giới hạn dưới (Lower limit) về số lượng của vi khuẩn VTEC để có thể phát hiện được trong môi trường có các mẫu thịt và đã được gây nhiễm với số vi khuẩn đạt nồng độ cuối cùng là 6,6 x 10 6 CFU/ml đối với chủng FD523 và 6,2 x 106 CFU/ml đối với chủng FD636. Hay nói cách khác, số lượng vi khuẩn VTEC nhiễm trong 25 g thịt tươi phải đạt ở mức ~ 6,2 - 6,6 x 10 6 CFU thì mới có thể xác định được bằng phương pháp PCR như đã được chuẩn hóa trong nghiên cứu này. 16 Bảng 3.9. Kết quả xác định độ nhạy và độ đặc hiệu của phản ứng PCR trong m u thịt sạch Nồng độ pha loãng (m-TSB) Số lần TN Kết quả của phản ứng PCR Đánh giá độ đặc hiệu (%) FD523 (6,6 x 10 8 CFU/ml) FD636 (6,2 x 10 8 CFU/ml) Lợn Bò Lợn Bò CKBĐ 2/2 + + + + 100 10 -1 2/2 + + + + 10 -2 2/2 + + + + 10 -3 2/2 - - - - 10 -4 2/2 - - - - 10 -5 2/2 - - - - 10 -6 2/2 - - - - 10 -7 2/2 - - - - 10 -8 2/2 - - - - Ghi chú: CKBĐ: Canh khuẩn ban đầu +: Phản ứng dương tính với cả 3 loại gen VT1, VT2 và eae -: Phản ứng âm tính với cả 3 loại gen VT1, VT2 và eae 3.2.6 Quy trình xác định sự có mặt của vi khuẩn VTEC trong các m u thịt Mẫu thịt (25g, cắt nhỏ) 225 ml môi trường m-TSB 0,1 ml + 5 ml TPB Thạch MacConkey Dương tính Âm tính 2-3 khuẩn lạc Lactose (+) PCR (VT1, VT2, eae) Xác định serotyp PCR (VT1, VT2, eae) Dương tính Âm tính PCR (VT1, VT2, eae) từng khuẩn lạc 37 0C/6 giờ/ lắc 37 0C/24 giờ 17 Sau khi tiến hành thiết lập và chuẩn hóa phương pháp PCR, chúng tôi đã xây dựng được một quy trình nhằm xác định sự có mặt của vi khuẩn VTEC trong các mẫu thịt 3.3 Xác định tỷ lệ nhiểm VTEC của bò, lợn tại điểm giết mổ và chợ trên địa bàn Hà Nội 3.3.1 Thu thập mẫu Từ thực trạng công tác kiểm soát giết mổ, vệ sinh thú y tại các cơ sở giết mổ và chợ trên địa bàn Hà Nội. Để làm rõ hơn tình hình an toàn thực phẩn, chúng tôi tiến hành lấy mẫu phân tại các điểm giết mổ, mẫu thịt tại các điểm giết mổ và chợ trên địa bàn Hà Nội để kiểm tra. Chúng tôi đã tiến hành nghiên cứu với một số mẫu mẫu phân và mẫu lau thân thịt thu thập từ lò mổ, được trình bày bảng 3.10. Bảng 3.10: Tổng hợp số l ợng và chủng loại m u thu thập đ ợc tại một số điểm giết mổ trên địa bàn Hà Nội TT Địa điểm M u lau thân thịt M u phân Tổng số m u thu thập Thịt lợn Thịt bò Lợn Bò 1 Trung Văn 15 0 15 0 30 2 Minh Hiền 20 0 15 0 35 3 Hoàng Mai 0 15 0 0 15 4 Bình Đà 0 15 0 0 15 5 Đông Anh 0 15 0 0 15 6 Long Biên 0 0 0 20 20 7 Thanh Trì 0 0 0 20 20 8 Đông Anh 0 0 0 20 20 Tổng 35 45 30 60 170 Đồng thời, chúng tôi tiến hành lấy mẫu thịt lợn, bò tại một số chợ trên địa bàn Hà Nội. Tổng hợp số lượng mẫu được trình bày bảng 3.11 Bảng 3.11: Tổng hợp số l ợng m u thu thịt thu thập đ ợc tại một số chợ trên địa bàn Hà Nội TT Địa điểm Loại m u và số l ợng m u Tổng số Thịt lợn Thịt bò 1 Chợ Hôm 10 10 20 2 Chợ Cầu Giấy 5 10 15 3 Chợ Tựu Liệt 10 5 15 4 Chợ Bách Khoa 10 10 20 5 Chợ Hòe Nhai 5 10 15 6 Chợ Châu Long 10 5 15 7 Siêu thị Unimart 10 5 15 Tổng 60 55 115 18 3.3.2 Phân lập và giám định đặc tính sinh vật hóa học của các chủng E. coli Chúng tôi đã phân lập được 570 chủng E. coli từ 285 mẫu phân, thịt lấy ở lò mổ và chợ. Bảng 3.12: Kết quả phân lập chủng E. coli từ các m u ban đâu TT Nguồn gốc m u Số l ợng m u ban đầu Số l ợng chủng E. coli phân lập đ ợc Tổng số chủng Lợn Bò Lợn Bò 1 Phân 30 60 60 120 180 2 Lau thân thịt ở lò mổ 35 45 70 90 160 3 Thịt ở chợ, siêu thị 60 55 120 110 230 Tổng 125 160 250 320 570 Năm 2004, các nhà nghiên cứu Việt – Úc đã tiến hành nghiên cứu tần số hiện diện của E.coli trong thực phẩm (Thi Thu Thao Van, 2007) [89]. Trong nghiên cứu này 180 mẫu thịt bò, thịt lợn, thịt gà, hải sản được lấy từ các chợ ở Thành phố Hồ Chí Minh. Kết quả phát hiện trên 90% các mẫu thịt, hải sản chứa E. coli, nhưng chưa xác định được cụ thể là loại E. coli nào. Như vậy, kết quả phân lập các chủng E. coli từ mẫu phân, mẫu lau thân thịt, mẫu thịt tại các điểm giết mổ và chợ của chúng tôi hoàn toàn phù hợp Kết quả giám định các đặc tính sinh vật hóa học của các chủng này được trình bày ở bảng 3.13. Bảng 3.13. Kết quả kiểm tra các đặc tính của vi khuẩn E. coli phân lập đ ợc TT Loại phản ứng Số chủng ơng tính Tỷ lệ (%) 1 Gram âm 570 100 2 Di động 570 100 3 Indol 570 100 4 MR 570 100 5 VP 0 0 6 H2S 0 0 7 Citrat 0 0 Đặc tính lên men đường 8 Lactose 570 100 9 Mannit 570 100 10 Manitol 570 100 11 Glucose 570 100 12 Xylose 570 100 13 Galactose 570 100 14 Fructose 570 100 15 Sorbitol 570 100 16 Saccarose 214 37,5 17 Arabinose 0 0 19 Kết quả kiểm tra cho thấy tất cả các chủng E. coli phân lập được đều có các đặc tính sinh vật hóa học giống như các tài liệu trong và ngoài nước đã mô tả, như bắt mầu Gram âm, Indol dương tính, H2S âm tính, có khả năng di động, lên men một số loại đường như Lactose, Glucose, Mannit, Manitol, Sorbitol, không lên men đường Arabinose, 3.3.3 Kết quả phân lập VTEC trong thịt Các số liệu so sánh về VTEC trong thực phẩm hiện nay còn rất hạn chế do một số nguyên nhân nhất định. Trước hết là do việc sử dụng các phương pháp nghiên cứu khác nhau với từng loại sản phẩm khác nhau. Thứ 2 là do quy trình phân lập và giám định vi khuẩn khác nhau và không thống nhất giữa các phòng thí nghiệm. Thứ 3, do hầu hết các nghiên cứu đều tập trung vào E. coli O157:H7 và bỏ qua các chủng vi khuẩn VTEC không thuộc nhóm O157 (Jorge Blanco và cs., 2007) [44]. Mặc dù vậy, với mục đích xác định tỷ lệ VTEC trên thịt, chúng tôi đã thu thập mẫu tại chợ và tiến hành thí nghiệm Bảng 3.14. Tỷ lệ phân lập vi khuẩn VTEC từ m u thịt Loại thịt Số m u xét nghiệm Số chủng E.coli Số m u d ơng tính Tỷ lệ % Thịt lợn 60 120 24 40,0 Thịt bò 55 110 13 23,6 Tổng 115 230 37 32,2 Kết quả bảng 3.14 cho thấy, số mẫu thịt lợn phân lập được VTEC là 24 mẫu, chiếm tỷ lệ 40,0%

Các file đính kèm theo tài liệu này:

  • pdfvsvhty_ttla_nguyen_thi_thanh_thuy_7065_2005319.pdf
Tài liệu liên quan