Tóm tắt Luận án Nghiên cứu tạo Gelatinase tái tổ hợp và ứng dụng trong thủy phân Gelatin da cá tra

Ảnh hưởng của nhiệt độ đến biểu hiện rGEL

Trong thí nghiệm này, chủng E.coli tái tổ hợp được nuôi cấy ở 37oC đến khi OD600 đạt

0,5 ÷ 0,8. Sau đó tế bào được cảm ứng bằng IPTG 0,4 mM và tiếp tục được nuôi ở 25, 28,

34 và 37oC trong 16 giờ. Mức độ biểu hiện rGEL ở 25oC, 28oC, 34oC và 37oC đều cho một

vệt protein rõ nét trong khoảng 46 kDa và không khác nhau đáng kể. Tuy nhiên, hoạt tính

rGEL thu được tại các nhiệt độ này là khác nhau, cụ thể ở nhiệt độ 25oC thì sau 10 giờ hoạt

tính GEL đạt cao nhất là 2 U/ml; 28oC thì sau 6 giờ hoạt tính đạt cao nhất là 2,18 U/ml;

34oC đạt 2,53 U/ml tại thời điểm 5 giờ và ở nhiệt độ 37oC đạt 2,89 U/ml ở thời điểm 3 giờ

(Hình 3.16)

Để kiểm tra khả năng biểu hiện protein ở 37oC, điện di kiểm tra protein hòa tan thu

được khi phá tế bào E. coli tái tổ hợp và phần xác tế bào không tan sau khi biểu hiện (Hình

3.17).

(a) (b)

Hình 3.17 Điện di đồ GEL biểu hiện ở 37oC (a) và 34oC trên gel SDS-PAGE (b). Hình (a)

biểu hiện ở 37oC: Giếng M: Thang protein chuẩn, Giếng 1: Protein tan, Giếng 2: Protein

không tan từ xác tế bào; Hình (b) biểu hiện ở 34oC: Giếng M: Thang protein chuẩn, Giếng

1: Protein không tan từ xác tế bào, Giếng 2: Protein tan.

Theo kết quả trên hình 3.17a, cho thấy băng 2 (protein không tan chạy từ xác tế bào)

cũng có một vệt protein đậm và rõ (Hình 3.17a) có khối lượng khoảng 46 kDa tương ứng

như trên băng 1 (protein hòa tan thu được khi phá tế bào E. coli tái tổ hợp). Như vậy, ở 37oC

tế bào có khả năng biểu hiện protein ngoại lai với hiệu suất cao nhưng một phần protein

ngoại không được đóng gói để tiết ra ngoài môi trường mà được giữ bên trong tế bào. Do

vậy, nhiệt độ 37oC là không tốt đối với GEL trong quá trình biểu hiện.14

Tương tự, chúng tôi đã tiến hành kiểm tra khả năng biểu hiện của GEL ở 34oC (Hình

3.17b). Khi biểu hiện ở 34oC thì đa số protein tái tổ hợp đều ở dạng tan (Giếng 2).

pdf27 trang | Chia sẻ: trungkhoi17 | Lượt xem: 411 | Lượt tải: 0download
Bạn đang xem trước 20 trang tài liệu Tóm tắt Luận án Nghiên cứu tạo Gelatinase tái tổ hợp và ứng dụng trong thủy phân Gelatin da cá tra, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
*Phân loại chủng tuyển chọn dựa trên phân tích trình tự 16S rDNA 2.4.2. Phương pháp tạo chủng tái tổ hợp 2.4.2.1. Thiết kế mồi khuếch đại gen gel E. faecalis MD4 2.4.2.2. Nhân dòng gen gelE mã hóa gelatinase 2.4.2.3. Giải trình tự và phân tích gen gelE 2.4.2.4. Tạo chủng E. coli tái tổ hợp mang gen gelE * Chuẩn bị tế bào khả biến * Chuyển gen gelE vào vector tách dòng * Biến nạp vào tế bào khả biến E. coli (Sambrook và Russell, 2001). *Tách chiết plasmid *Điện di DNA trên gel agarose 2.4.2.5. Thiết kế vector tái tổ hợp cho biểu hiện gen gelE trong E. coli 5 2.4.2.6. Phương pháp kiểm tra protein tái tổ hợp *Điện di protein trên gel polyacryalmide SDS – PAGE ( Laemmli, 1970). *Định lượng protein (Bradford, 1976) 2.4.3. Phương pháp nghiên cứu điều kiện biểu hiện rGEL 2.4.3.1. Nuôi cấy E. coli tái tổ hợp 2.4.3.2. Thu nhận GEL từ E. coli tái tổ hợp 2.4.3.3. Ảnh hưởng của các điều kiện biểu hiện: pH, nhiệt độ. IPTG, thời gian thu hồi 2.4.4. Phương pháp thu hồi, tinh sạch và đặc tính của rGEL 2.4.4.1. Thu hồi và tinh sạch rGEL 2.4.4.2. Ảnh hưởng của nhiệt độ và độ bền nhiệt của rGEL 2.4.4.3. Ảnh hưởng của pH và độ bền pH của rGEL 2.4.4.4. Ảnh hưởng của ion kim loại 2.4.4.5. Ảnh hưởng của chất tẩy rửa 2.4.4.6. Động học của rGEL với cơ chất gelatin 2.4.5. Ứng dụng rGEL thủy phân gelatin da các tra 2.4.5.1. Phương pháp nghiên cứu thủy phân gelatin da cá Tra bằng rGEL *Phương pháp xử lý mẫu da cá Tra *Phương pháp trích ly gelatin *Phương pháp khảo sát điều kiện thủy phân gelatin da cá Tra bằng rGEL * Phương pháp xác định mức độ thủy phân * Phương pháp định lượng axit amin trong sản phẩm thủy phân 2.4.5.2. Đánh giá hiệu quả bổ sung chế phẩm axit amin vào thức ăn ương cá Mú chấm đen * Phương pháp bổ sung chế phẩm vào thức ăn công nghiệp: *Phương pháp xác định tăng trưởng của cá Mú thí nghiệm: định kỳ 7 ngày kiểm tra một lần về khối lượng, chiều dài thân cá, từ đó đánh giá tốc độ tăng trưởng trung bình ngày (ADG), tốc độ tăng trưởng đặc trưng (SGR). Cuối đợt thí nghiệm đánh giá hệ số sử dụng thức ăn (FCR). Xác định hệ số phân đàn (CV): Đánh giá tại thời điểm thả cá và thời điểm kết thúc thí nghiệm. CV (%) = Độ lệch chuẩn/ giá trị trung bình x 100. Xác định tỷ lệ sống của cá Mú ương . 2.4.6. Phương pháp thu thập và xử lý số liệu Toàn bộ số liệu được thu thập trong quá trình thí nghiệm và được xử lý bằng phương pháp thống kê sinh học trên phần mềm Excell 2007, SPSS 16.0. Dùng phép kiểm định Duncan, LSD0,05. 6 CHƯƠNG 3. KẾT QUẢ VÀ THẢO LUẬN 3.1. SÀNG LỌC NGUỒN GEN MÃ HÓA GELATINASE 3.1.1. Tuyển chọn các chủng vi khuẩn sinh tổng hợp gelatinase cao Từ bộ sưu tập giống gồm 216 chủng vi sinh vật có khả năng sinh enzym thủy phân gelatin phân lập từ các mẫu mẫu cá nước ngọt bị bệnh lở loét, xuất huyết, đốm đỏ, tuột nhớt, tuột vẩy tại các hồ nuôi cá ở Hà Nội tại phòng thí nghiệm công nghệ sinh học – Viện Đại học Mở Hà Nội, chúng tôi tiến hành sàng lọc và tuyển chọn chủng có khả năng sinh gelatinase cao để tìm nguồn gen mã hóa gelatinase tạo chủng tái tổ hợp. Bảng 3.1. Hoạt tính phân giải gelatin của dịch lên men 11 chủng vi khuẩn phân lập phân lập từ các mẫu cá nước ngọt bị bệnh sau 48 giờ nuôi cấy. STT Ký hiệu chủng Đường kính vòng phân giải gelatin (D-d, mm) Hoạt tính gelatinase (U/ml) 1 MD1 20,50 ± 0,01 0,34±0,12 2 MD2 26,51 ± 0,03 0,40±0,10 3 MD3 24,60 ±0,11 0,40±0,16 4 MD4 28,21 ± 0,16 0,64±0,11 5 MD5 23,02 ±0,13 0,43±0,15 6 MD6 21,01 ±0,21 0,38±0,10 7 MD7 25,00 ±0,12 0,41±0,16 8 MD8 25,02 ±0,15 0,39±0,12 9 MD9 22,02 ±0,05 0,30±0,12 10 MD10 25,01 ±0,15 0,33±0,10 11 MD11 23,00 ±0,02 0,31±0,18 Ghi chú: D: Đường kính vòng phân giải (mm), d: Đường kính lỗ thạch (mm) Trong số 11 chủng trên, chủng MD4 cho hoạt tính cao nhất, đạt 0,64±0,11 U/ml (Bảng 3.1) và có khả năng hóa lỏng thạch gelatin 7,5g/L (Hình 3.1) được lựa chọn là chủng cung cấp nguồn gen mã hóa gelatinase cho các nghiên cứu tiếp theo. 3.1.2. Đặc điểm sinh học, sinh lý, sinh hóa và định tên của chủng vi khuẩn lựa chọn * Nghiên cứu đặc điểm sinh lý, sinh hóa của chủng vi khuẩn Ở nhiệt độ 30oC sau 24 giờ khuẩn lạc vi khuẩn có kích thước không đều, bề mặt bóng, mặt cắt hình lồi nhọn, mép khuẩn lạc dạng rễ hình răng cưa, cấu trúc dạng sợi, bề mặt nhớt, vi khuẩn bắt màu xanh tím khi nhuộm Gram, soi trên kính hiển vi với vật kính x100 thấy hình dạng vi khuẩn là hình cầu hoặc bầu dục, liên kết thành cặp hoặc chuỗi kích thước tế bào từ 0,5 µm đến 0,7µm. 7 a. Khuẩn lạc MD4 trên môi trường MPA b. Hình ảnh tế bào MD4 dưới KHV điện tử quét (x 10.000) c. Nhuộm Gram (x100 lần) Hình 3.3. Hình ảnh khuẩn lạc trên môi trường MPA (a), tế bào MD4 dưới kính hiển vi điện tử quét (b) và nhuộm Gram (c) Chủng MD4 Khả năng đồng hoá nguồn carbon và nitơ và đặc điểm sinh trưởng của chủng MD4 sau 2 ngày nuôi cấy ở 37°C ở bảng 3.2. Bảng 3.2. Khả năng đồng hoá nguồn carbon và nitơ và đặc điểm sinh trưởng của chủng MD4 sau 2 ngày nuôi cấy ở 37°C. Nguồn Nito (1,0%, w/v) Khả năng sinh trưởng Nguồn đường (1,0%, w/v) Khả năng sinh trưởng L-Asparagin monohydrate - D glucose + L-Histidine monohydrate - Arabinose + L-Phenylalanin + Mannose + L-Leucin - Manitol + L-Tryptophan + N-acetyl glucosamine + L-Arginin + Maltose - L-Isoleucin - Gluconate + L-Valin + Caprate - L-Methionin - Adipate - L-Lysin - Malate + L-Threonin + Citrate + Đối chứng âm (MPA) - Đối chứng âm - Khoảng nhiệt độ sinh trưởng: 20 ÷45°C (nhiệt độ tối ưu: 37°C) Nồng độ muối: 0÷5% pH 4÷10 ( pH thích hợp 7) Khả năng phân giải: Tinh bột Casein Gelatin + + + Ghi chú: (+) Phát triển tốt bằng hoặc tốt hơn đối chứng dương (D-Glucose); (-) Không phát triển hoặc phát triển yếu hơn đối chứng âm (khoáng); (++) Phát triển rất tốt 8 * Phân loại dựa trên xác định trình tự gen mã hoá 16S rDNA - Khuếch đại gen 16S rDNA Hình 3.4. Điện di đồ sản phẩm PCR khuếch đại gen 16S rDNA trên gel agarose 1,0% Giếng M: Thang DNA chuẩn 1kb (Thermo scientific, Mỹ); Giếng 1: Sản phẩm PCR khuếch đại gen 16S rDNA của chủng MD4 Kết quả khuếch đại gen 16S rDNA của chủng MD4 cho thấy, sản phẩm PCR cho một băng rất rõ nét và duy nhất có kích thước khoảng 1,4kb (Hình 3.4). Như vậy, sản phẩm PCR thu được là đặc hiệu, đáp ứng yêu cầu cho tinh sạch và giải trình tự gen 16S rDNA. - Phân tích trình tự gen 16S rRNA Bảng 3.3. Độ tương đồng trình tự gen 16S rRNA của vi khuẩn MD4 với trình tự gen tương ứng của các chủng được đăng ký trên Genbank (NCBI) Trình tự gene 16S rDNA của chủng vi khuẩn được so sánh Mã số truy cập trên GenBank Độ tương đồng (%) Enterococcus faecalis UFLA WFC616 KY660402.1 99 Enterococcus faecalis NBRC 100480 NR_113901.1 99 Enterococcus faecalis subsp. SJYF 14 KJ174472.1 99 Enterococcus faecalis ATCC 19433 NR_115765.1 99 Enterococcus dispar LMG 13521 NR_114781.2 98 Enterococcus lactis BT159 NR_117562.1 98 Từ cơ sở dữ liệu trên, Cây phát sinh chủng loại được thiết lập trên cơ sở khoảng cách di truyền theo Kimura, bằng việc sử dụng phương pháp Neighbor-joining. Phân tích giá trị Bootstrap của cây phát sinh chủng loại được tính với 1000 mẫu thử (Hình 3.5). 9 Hình 3.5. Cây phát sinh chủng loại dựa trên việc so sánh trình tự gen 16S rRNA của chủng MD4 với các trình tự gen tương ứng của các chủng khác trên GenBank. Giá trị bootstrap (%) thể hiện sự sai khác về mặt di truyền. Kết quả phân tích trình tự 16S rDNA và so sánh với trình tự gene đã công bố trên Genbank bằng công cụ BLAST (NCBI) cho thấy chủng MD4 có trình tự tương đồng cao với chủng Enterococcus faecalis UFLA WFC616 (99%), chủng Enterococcus faecalis NBRC 100480 (99%) (Bảng 3.3 và Hình 3.5). Dựa vào kết quả nghiên cứu về đặc điểm hình thái, sinh lý-sinh hóa và phân tích trình tự gen 16S rDNA, chủng vi khuẩn MD4 được định danh là Enterococcus faecalis MD4. Trình tự gen 16S rRNA của chủng MD4 được đăng ký trên GenBank (NCBI) dưới mã số MG982575.1. 3.2. TẠO CHỦNG TÁI TỔ HỢP 3.2.1. Thiết kế mồi khuếch đại gen gelE mã hóa gelatinase từ chủng E. faecalis MD4 Mồi xuôi TTATATG↓TCGACATGAAGGGAAATAAAATTTTATACATTTTAGG SalI Mồi ngược AATATTA↓AGCTTTTCATTGACCAGAACAGATTCACT HindIII 3.2.2. Nhân dòng gen gelE mã hóa gelatinase Đoạn gen mã hóa gelE của E. faecalis MD4 được khuếch đại bằng PCR từ khuôn DNA bằng cặp mồi EF-F1 và EF-R1. Trên băng 1 xuất hiện một vệt sáng đậm rõ nét khoảng 1,5 kb (Hình 3.6), tương ứng với kích thước mong đợi khi thiết kế mồi khuếch đại gen gelE của E. faecalis MD4. Như vậy, sản phẩm PCR nhận được là đặc hiệu cho quá trình khuếch đại gen gelE của E. faecalis MD4. Hình 3.6. Điện di đồ sản phẩm khuếch đại gen gelE từ DNA của E. faecalis MD4. Giếng L: thang DNA chuẩn; Giếng 1: sản phẩm của PCR khuếch đại gen gelE từ DNA của E. faecalis MD4 Sản phẩm PCR được tinh sạch và xử lý bằng enzyme cắt đầu bằng DNA Blunting Enzym và ghép nối vào vector pJet1.2/Blunt, biến nạp vào E. coli DH5α và điện di kiểm tra kích thước plasmid tái tổ hợp so với plasmid gốc pJet1.2/Blunt (Hình 3.7). Kb 10 Hình 3.7. Điện di đồ kiểm tra plasmid đã mang gen. Giếng 1: thang DNA chuẩn; Giếng 2: Plasmid mang gen gelE; Giếng 3: plasmid pJet1.2/Blunt Hình 3.8. Điện di đồ sản phẩm cắt plasmid tách dòng bằng enzym giới hạn. Giếng M: thang DNA chuẩn; Giếng 1 và 2: plasmid pJet1.2::gelE được cắt đồng thời bởi SalI và HindIII. Kết quả cho thấy plasmid tái tổ hợp có chứa gen gelE (sau đây ký hiệu là pJet1.2:gelE) khi mở vòng có kích thước 4,4 kb, tương ứng với kích thước vector tách dòng pJet1.2 (2,9 kb) và gen gelE (1,5 kb). Khi cắt plasmid tái tổ hợp pJet1.2:gelE bởi hai enzyme giới hạn SalI và HindIII cho hai băng tách biệt gồm: một băng tương ứng với kích thước gen gelE là 1,5kb và một băng 2,9 kb của vector pJet1.2 (Hình 3.8). Các kết quả phân tích cho thấy đã tách dòng thành công gen gelE trong vector tách dòng pJet1.2. 3.2.3. Giải trình tự và phân tích gen gelE Bảng 3.5. Mức độ tương đồng trình tự nucleotit của gen gelE của chủng E. faecalis MD4 với các gen gelE tương ứng cả các vi khuẩn được đăng kí trên GenBank Trình tự gen gelE MD4 M37185.1 D85393.1 EF105504.1 EU862241.3 MD4 100 a M37185.1 99 100 D85393.1 99 99 100 EF105504.1 99 99 100 100 EU862241.3 99 99 99 99 100 Trình tự gen gelE khuếch đại từ DNA của chủng E. faecalis MD4 có tương đồng cao (99%) so với các gen gelE khuếch đại từ mRNA của các chủng E. faecalis khác (Bảng 3.5). Trình tự nucleotide của gen gelE trong nghiên cứu có độ tương đồng gần 99% so với trình Kb Kb Kb Kb 11 tự của gen gelE tương ứng có mã số truy cập M37185.1, D85393.1, EF105504.1, EU862241.3 chỉ có một vài vị trí khác biệt. Trình tự axít amin suy diễn của chủng E. faecalis MD4 có tương đồng cao (99%) so với các gen gelE khuếch đại từ các chủng E. faecalis khác (Hình 3.10). Hình 3.10: Trình tự axit amin suy diễn của gelE của chủng E. faecalis MD4 3.2.4. Thiết kế vector tái tổ hợp cho biểu hiện gen gelE trong E. coli BL21(DE3) Để gắn gen gelE vào vector biểu hiện pET-22b(+) đúng chiều, đúng khung đọc, cả pJet1.2: gelE và pET22b(+) được cắt bằng SalI và HindIII tạo ra gen gelE và pET-22b(+) có hai đầu dính tương ứng. a) Thu gen gelE có hai đầu dính của hai enzym HindIII và SalI Thu vùng agarose chứa vệt DNA mong đợi và tinh sạch thu lấy đoạn gen này bằng kit Invitrogen. Sản phẩm gen gelE sau tinh sạch được kiểm tra bằng điện di trên gel agarose 1%. Gen gelE tinh sạch cho một vệt có kích thước 1,5 kb. Như vậy, chúng tôi đã có gen gelE với hai đầu bổ sung được tạo bởi hai enzym HindIII và SalI. b) Tạo 2 đầu dính cho vector pET-22b(+): Plasmid pET-22b(+) cũng được xử lý với hai enzym giới hạn trên. Sản phẩm cắt được điện di trên gel agarose 1%. Kết quả cho thấy vector đã được mở vòng hoàn toàn đảm bảo cho việc gắn gen tạo vector biểu hiện. Sau khi điện di, phần agarose chứa vector pET-22b(+) được thu lại và xử lý qua kit tinh sạch DNA (Invitrogen). Như vậy, chúng tôi đã có sẵn nguyên liệu cho việc tạo vector biểu hiện. c) Gắn gen gelE vào vector pET-22b(+) Dưới tác dụng của T4-ligase, gen gelE được gắn vào vector biểu hiện tạo thành hệ thống biểu hiện hoàn chỉnh. Sau phản ứng ghép nối gen, sản phẩm ghép nối được biến nạp vào tế bào E. coli DH5 để tạo dòng gen. (a) (b) Hình 3.12. Điện di đồ DNA plasmid từ thể biến nạp (a) và plasmid tái tổ hợp được xử lý bằng HindIII và SalI (b). Ghi chú: Giếng 1 (Hình a): pET22b(+) đối chứng, Giếng 2 ÷ 5 (Hình a): pET22b(+) mang đoạn chèn; Giếng 1 (Hình b): Thang DNA chuẩn, Giếng 2 12 (Hình b): pET 22b-gelE được cắt bằng HindIII và SalI. Các plasmid tái tổ hợp đều có kích thước lớn hơn vector pET22b(+) (Hình 3.12a). Sau khi được xử lý với HindIII và SalI, sản phẩm cắt các plasmid tái tổ hợp đều cho hai đoạn gen có kích thước tương đương với pET22b(+) (5,5 kb) và gen gelE (1,5 kb) tương ứng (Hình 3.12b). Plasmid pET22b(+) mang gen gelE được đặt tên là pET22b-gelE. 3.2.5. Tạo chủng E. coli tái tổ hợp mang gen gelE Mẫu cảm ứng bằng IPTG có một vệt protein mới khác biệt so với các mẫu không cảm ứng (Hình 3.13) và có kích thước khoảng 46 kDa, tương đương với kích thước theo tính toán của phân tử protein tái tổ hợp như mong đợi. Hình 3.13. Điện di đồ protein tái tổ hợp trên SDS-PAGE . Ghi chú: Giếng M: Thang protein chuẩn; Giếng 1 và 2: Protein tổng số từ E. coli tái tổ hợp được cảm ứng bởi 0,4 mM IPTG và protein tổng số từ tế bào E. coli tái tổ hợp không được cảm ứng bởi IPTG. Enzym GEL tái tổ hợp tạo ra một vệt rõ nét hơn các vệt protein khác chứng tỏ quá trình biểu hiện được thực hiện tốt. Hoạt tính của chủng tái tổ hợp đạt 2,45 U/ml dịch lên men, cao hơn hoạt tính của chủng gốc 6 lần. 3.3. ĐIỀU KIỆN BIỂU HIỆN rGEL 3.3.1. Ảnh hưởng của pH đến biểu hiện rGEL Để lựa chọn được pH thích hợp cho chủng tái tổ hợp sinh trưởng và biểu hiện protein, chủng E. coli tái tổ hợp được nuôi cấy trên nền môi trường LB có các pH thay đổi từ 5÷ 8 với các điều kiện công nghệ được giữ như trên. Mẫu được thu sau 3 giờ cảm ứng, xác định hoạt tính và protein. Hình 3.15. Ảnh hưởng của pH đến biểu hiện gelE tái tổ hợp Hình 3.16. Ảnh hưởng của nhiệt độ đến biểu hiện gelE tái tổ hợp 13 Chủng E. coli BL21[pET22(b)-gelE] biểu hiện gelE thích hợp nhất ở vùng pH trung tính 6,5 ÷ 7 (Hình 3.15). Khoảng pH này cũng phù hợp cho sinh trưởng của E. coli nói chung. 3.3.2. Ảnh hưởng của nhiệt độ đến biểu hiện rGEL Trong thí nghiệm này, chủng E.coli tái tổ hợp được nuôi cấy ở 37oC đến khi OD600 đạt 0,5 ÷ 0,8. Sau đó tế bào được cảm ứng bằng IPTG 0,4 mM và tiếp tục được nuôi ở 25, 28, 34 và 37oC trong 16 giờ. Mức độ biểu hiện rGEL ở 25oC, 28oC, 34oC và 37oC đều cho một vệt protein rõ nét trong khoảng 46 kDa và không khác nhau đáng kể. Tuy nhiên, hoạt tính rGEL thu được tại các nhiệt độ này là khác nhau, cụ thể ở nhiệt độ 25oC thì sau 10 giờ hoạt tính GEL đạt cao nhất là 2 U/ml; 28oC thì sau 6 giờ hoạt tính đạt cao nhất là 2,18 U/ml; 34oC đạt 2,53 U/ml tại thời điểm 5 giờ và ở nhiệt độ 37oC đạt 2,89 U/ml ở thời điểm 3 giờ (Hình 3.16) Để kiểm tra khả năng biểu hiện protein ở 37oC, điện di kiểm tra protein hòa tan thu được khi phá tế bào E. coli tái tổ hợp và phần xác tế bào không tan sau khi biểu hiện (Hình 3.17). (a) (b) Hình 3.17 Điện di đồ GEL biểu hiện ở 37oC (a) và 34oC trên gel SDS-PAGE (b). Hình (a) biểu hiện ở 37oC: Giếng M: Thang protein chuẩn, Giếng 1: Protein tan, Giếng 2: Protein không tan từ xác tế bào; Hình (b) biểu hiện ở 34oC: Giếng M: Thang protein chuẩn, Giếng 1: Protein không tan từ xác tế bào, Giếng 2: Protein tan. Theo kết quả trên hình 3.17a, cho thấy băng 2 (protein không tan chạy từ xác tế bào) cũng có một vệt protein đậm và rõ (Hình 3.17a) có khối lượng khoảng 46 kDa tương ứng như trên băng 1 (protein hòa tan thu được khi phá tế bào E. coli tái tổ hợp). Như vậy, ở 37oC tế bào có khả năng biểu hiện protein ngoại lai với hiệu suất cao nhưng một phần protein ngoại không được đóng gói để tiết ra ngoài môi trường mà được giữ bên trong tế bào. Do vậy, nhiệt độ 37oC là không tốt đối với GEL trong quá trình biểu hiện. 14 Tương tự, chúng tôi đã tiến hành kiểm tra khả năng biểu hiện của GEL ở 34oC (Hình 3.17b). Khi biểu hiện ở 34oC thì đa số protein tái tổ hợp đều ở dạng tan (Giếng 2). 3.3.3. Ảnh hưởng của IPTG đến biểu hiện rGEL Bảng 3.6. Ảnh hưởng của nồng độ chất cảm ứng đến sinh trưởng và biểu hiện GEL Nồng độ IPTG (mM) Mật độ quang, OD600nm cuối Hoạt tính (U/ml) 0 3,82 ± 0,04 0 0,01 3,55 ± 0,11 1,21 ± 0,05 0,02 3,33 ± 0,22 1,75 ± 0,13 0,05 3,21 ± 0,13 2,86 ± 0,09 0,1 3,10 ± 0,12 2,69 ± 0,05 0,2 3,01 ± 0,24 2,29 ± 0,16 0,3 3,06 ± 0,02 2,05 ± 0,14 0,4 3,11 ± 0,42 1,98 ± 0,12 0,5 3,16 ± 0,05 1,85 ± 0,04 Ghi chú: ± sai số giữa các thí nghiệm, số thí nghiệm n=3. Nồng độ IPTG càng cao thì sinh trưởng của chủng càng giảm (Bảng 3.6). Hoạt tính GEL trong mẫu cảm ứng với nồng độ IPTG 0,05 mM là cao nhất, đạt 2,86 U/ml dịch lên men. Với nồng độ IPTG càng cao thì hoạt tính GEL thu được càng giảm, đặc biệt ở nồng độ IPTG 0,5 mM hoạt tính giảm khoảng 1,39 lần so với ở nồng độ IPTG 0,05 mM. 3.3.4. Động thái quá trình lên men sinh tổng hợp gelE tái tổ hợp Hình 3.19. Động thái quá trình lên men sinh tổng hợp gelatinase tái tổ hợp Kết quả nghiên cứu động thái của quá trình lên men cho thấy chủng sinh trưởng nhanh sau 2 giờ lên men và đạt cực đại tại giờ thứ 10. Trong khi đó, GEL bắt đầu được sinh tổng hợp sau khi cảm ứng, tăng dần theo thời gian lên men và đạt cao nhất sau 8,5 giờ (hoạt tính đạt khoảng 2,89 U/ml sau khi sinh trưởng đạt cực đại). Sau thời điểm này, hoạt tính 15 enzym không tăng lên nữa mà giảm dần. Như vậy, thời điểm thu hồi protein tái tổ hợp thích hợp là sau 8,5 giờ lên men. 3.4. THU HỒI, TINH SẠCH VÀ ĐẶC TÍNH CỦA rGEL 3.4.1. Thu hồi và tinh sạch rGEL Bảng 3.7. Hiệu suất tinh sạch của GEL tái tổ hợp Mẫu Hoạt độ tổng (U) Protein tổng (mg) Hoạt độ riêng (U/mg) Tinh sạch (số lần) Hiệu suất thu hồi (%) Dịch chiết enzym thô 72,25 23,24 3,11 1 100 Mẫu sau tinh sạch 60,89 2,78 21,90 7,04 84,27 Hình 3.20 Điện di đồ protein tái tổ hợp trước và sau tinh sạch GEL bằng cột sắc ký ái lực M: Thang protein chuẩn, 1: Mẫu protein tổng trước khi tinh sạch, 2: Sản phẩm protein tinh sạch. Kết quả điện di sản phẩm protein thu được sau quá trình tinh sạch cho thấy, trên băng hai chỉ xuất hiện một vệt protein đậm, có trọng lượng xấp xỉ 46 kDa, tương ứng với trọng lượng enzym tái tổ hợp trong mẫu protein tổng trước khi tinh sạch. Protein tinh sạch có hoạt độ riêng 21,9 U/mg protein, tăng 7,04 lần với ban đầu và hiệu suất thu hồi enzym là 84,27 % (Bảng 3.7). 3.4.2. Đặc tính của rGEL 3.4.2.1. Ảnh hưởng của nhiệt độ và độ bền nhiệt Hình 3.22. Ảnh hưởng của nhiệt độ đến hoạt tính của rGEL Hình 3.23. Độ bền nhiệt của rGEL 16 Sự biến thiên hoạt tính của rGEL cho thấy, hoạt tính tăng dần theo sự tăng của nhiệt độ từ 20 ÷ 55oC và đạt giá trị cao nhất ở 40oC , giảm nhẹ từ 45 ÷ 55oC và chỉ còn 60% hoạt tính xúc tác tại 55oC. Như vậy, nhiệt độ xúc tác của GEL dao động 37 ÷ 45oC. Từ kết quả thu được ở trên cho thấy hoạt tính gelatinase tái tổ hợp tương đối ổn định trong 2 giờ đầu (giữ được trên 97%), sau đó thời gian ủ càng lâu thì hoạt tính càng giảm. Đến 6 giờ thì khả năng thủy phân gelatin chỉ còn đạt 39,8% so với hoạt tính ban đầu ở mức nhiệt độ 45oC, tiếp đến là 46,9% ở mức nhiệt độ 40oC và cuối cùng là đạt 70,2% ở nhiệt độ 37oC. 3.4.2.2 Ảnh hưởng của pH và độ bền pH Hình 3.24. Ảnh hưởng của pH tới hoạt động xúc tác của GEL Hình 3.25. Ảnh hưởng của pH đến độ bền của GEL tái tổ hợp Kết quả cho thấy, GEL có thể xúc tác trong dải pH kiềm với biên độ khá rộng, từ 7,5 ÷ 11, hoạt động tốt nhất ở pH 7 ÷ 7,5. Sau thời gian ủ là 2 giờ ở nhiệt độ 40oC ở pH 7 và pH7,5 hoạt tính GEL vẫn được duy trì ở mức xấp xỉ 97÷100%, sau đó hoạt tính enzym giảm dần và đến 6 giờ hoạt tính gelatinase còn 75%; 73% so với ban đầu (p>0,05). Đối với pH 8,5 thì hoạt tính chỉ tương đối ổn định trong 1 giờ đầu sau đó hoạt tính giảm dần ở các giờ tiếp theo, đến 6 giờ thì hoạt tính GEL đạt 58,9% so với ban đầu. Mặt khác, ở pH5 thì sau 2 giờ hoạt tính enzym chỉ còn 83,1%, đến 6 giờ chỉ còn lại có 25% hoạt tính GEL. Còn pH7 và pH7,5 hoạt tính GEL duy trì ổn định trong 3 giờ, điều này cung cấp thông tin cơ sở cho thí nghiệm thủy phân gelatin sau này. 3.4.2.3. Ảnh hưởng của ion kim loại Bảng 3.8. Ảnh hưởng của các ion kim loại và hóa chất đến hoạt tính của GEL tái tổ hợp STT Ion bổ sung Hoạt tính tương đối (%) Không bổ sung ion 5 mM 1 Ca2+ 100 115 ± 1,2 2 Fe2+ 100 95 ± 1,5 17 3 Co2+ 100 92 ± 3,0 4 Mn2+ 100 97 ± 2,0 5 Cu2+ 100 104 ± 4,6 6 Mg2+ 100 100 ± 2,5 7 EDTA 100 0,0 ± 5,0 8 β-mercaptoetanol 100 0,0 ± 4,9 Kết quả nghiên trên cho thấy sự có mặt của Ca2+ làm tăng hoạt tính GEL cao nhất, xấp xỉ 15 ± 1,2%, trong khi đó các ion Mg2+, Cu2+ không làm ảnh hưởng mà còn làm tăng nhẹ hoạt tính của GEL, hoạt tính tương đối lần lượt là 100%, 104 ± 4,6%. Trong khi đó các ion như: Fe2+, Co2+, Mn2+ gây ức chế hoạt tính của enzym. EDTA và β-mercaptoetanol thì gây kìm hãm rất mạnh đối với hoạt tính của rGEL, ở hàm lượng 5 mM, cả hai chất này ức chế hoàn toàn hoạt động của enzym. 3.4.2.4. Ảnh hưởng của chất tẩy rửa Một số chất tẩy rửa có hoạt tính bề mặt như Tween 20, Triton X-100, SDS gây ảnh hưởng đến hoạt tính của gelatinase. Tween 20 nồng độ <1 % hầu như không ảnh hưởng đến hoạt tính của gelatinase. Hoạt tính của GEL tái tổ hợp vẫn giữ được 90 ±1,7 ÷ 97±2,4% sau khi ủ enzym cùng với Tween 20 trong 1 giờ ở 45oC. Triton X-100 ở nồng độ 1% có ảnh hưởng nhẹ đến hoạt tính của rGEL, tại nồng độ này thì hoạt tính của gelatinase còn 16±1,2 % so với hoạt tính ban đầu. Ở nồng độ thấp hơn thì rGEL hầu như không bị ảnh hưởng và hoạt tính vẫn còn duy trì ở mức 97±2,8÷ 97±1,1%. Đối với SDS thì hoạt tính của GEL bị ảnh hưởng rõ rệt, nồng độ SDS càng cao thì hoạt tính GEL càng thấp, ở nồng độ 0,3% thì hoạt tính của GEL chỉ còn 67±2,1%, ở nồng độ 1% hoạt tính còn 5±2,1%. 3.4.2.5. Động học của rGEL với cơ chất gelatin 0 10 20 30 40 50 0 2 4 6 8 V ận t ố c p h ản ứ n g (U /m l. S) Nồng độ gelatin (g/L) y = 0.0545x + 0.017 R² = 0.9969 0 0.02 0.04 0.06 0.08 0 0.5 1 1.5 1 /v 1/[S] Hình 3.27. Biến đổi vận tốc phản ứng theo nồng độ gelatinase (a) và đồ thị Lineaweaver - Burk của gelatinase tái tổ hợp với cơ chất gelatin (b). 18 Tốc độ phản ứng Vmax và hằng số Michaelis Km của gelatinase tái tổ hợp được thể hiện trên Hình 3.27. Giá trị Vmax và Km thu được lần lượt là 18,34 (µmol/L. phút) và 3,21 mM. 3.5. ỨNG DỤNG rGEL THỦY PHÂN GELATIN DA CÁ TRA 3.5.1. Kết quả xác định các điều kiện thủy phân gelatin da cá Tra bằng rGEL 3.5.1.1. Khảo sát tỷ lệ nước Bảng 3.9. Ảnh hưởng của tỷ lệ nước khảo sát đến hiệu suất thủy phân Tỷ lệ nước khảo sát(%) Hiệu suất thủy phân (%) 0 41,11c 30 76,48a 50 62,37b 70 56,82b 100 51,12b (Ghi chú: Trong cùng một hàng ngang, các giá trị trung bình không cùng mẫu tự thì khác biệt ởmức ý nghĩa 95%) Từ kết quả ở bảng 3.9 cho thấy hiệu suất thủy phân gelatin da cá Tra bằng enzyme gelatinase tái tổ hợp đạt cao nhất với tỷ lệ nước khảo sát là 30% so với các tỷ lệ khác (p<0,05), còn các tỷ lệ nước khảo sát 50, 70 và 100% không có sự sai khác về hiệu suất thủy phân (p>0,05). 3.5.1.2. Kết quả khảo sát ảnh hưởng của nồng độ enzyme đến quá trình thủy phân Hình 3.28. Hiệu quả thủy phân gelatin ở các nồng độ rGEL khác nhau Hiệu suất thủy phân tăng chậm khi tăng nồng độ enzyme từ 25 UI lên 50 UI. Tuy nhiên, hiệu suất thủy phân tăng nhanh và đạt cao nhất ở nồng độ 75 UI gelatinase, đạt 76,12%. Khi tăng nồng độ enzyme lên đến 100 UI và 125 UI thì hiệu suất thủy phân tăng không đáng kể, chỉ đạt 75,79% và 76,12%. Kết quả này cho thấy, nồng độ 75 UI là phù hợp để thủy phân 100g cơ chất gelatin da cá Tra, với tỷ lệ nước khảo sát là 30%, đây cũng 19 chính là nồng độ bão hòa của enzyme. 3.5.1.3. Kết quả khảo sát ảnh hưởng của nhiệt độ đến quá trình thủy phân Kết quả thí nghiệm trong hình 3 cho thấy khoảng nhiệt độ 50÷55oC cho hiệu quả thủy phân cao nhất, đạt 75,68% và 74,54%. Ở điều kiện gia nhiệt 40÷450C, hiệu suất chỉ đạt 41,83÷48,60%. Trong điều kiện nhiệt độ 60oC, enzym bị giảm hoạt tính nên hiệu suất thủy phân thấp, đạt 38,25%. Hình 3.29.. Hiệu suất thủy phân gelatin bằng rGEL ở các mức nhiệt độ khác nhau 3.5.1.4. Kết quả khảo sát ảnh hưởng của thời gian Hiệu suất thủy phân tăng dần từ 2 giờ đến 12 giờ và đạt giá trị cao nhất (75,21%) sau đó giảm nhẹ trong 6 giờ tiếp theo. Sau 24 giờ, hiệu suất thủy phân giảm mạnh, đạt 21,69%. Gelatinase hoạt động mạnh nhất ở điều kiện pH=7 ở 500C trong 12 giờ, như

Các file đính kèm theo tài liệu này:

  • pdftom_tat_luan_an_nghien_cuu_tao_gelatinase_tai_to_hop_va_ung.pdf
Tài liệu liên quan