Tóm tắt Luận án Nghiên cứu tích hợp gen kháng bệnh bạc lá vào một số dòng/giống lúa phục vụ chọn tạo giống

Tạo nguồn vật liệu mang đa gen/gen ứng viên kháng bệnh bạc lá

- Dựa vào kết quả tầm soát và nhận dạng các gen ứng viên, mức độ

kháng hiệu quả với các isolate vi khuẩn gây bệnh bạc lá đã phân lập, sự chênh

lệch thời gian sinh trưởng của các giống bố, mẹ và mức độ cảm quang của các

giống bản địa, chúng tôi đã thiết kế 05 tổ hợp lai khác nhau (DT39/Chấn

thơm, Thủ đô 1/Chấn thơm, An Dân 11/Hom râu, Thủ đô 1/IRBB62 và

Bắc thơm số 7/IRBB62) và ứng dụng chỉ thị phân tử, lai trở lại đến thế hệ

BC3F1, sau đó tự thụ đến thế hệ BC3F4 để chọn tạo ra các dòng/giống mang đa

gen kháng;

- Kết quả kiểm tra gen ứng viên mục tiêu của 05 tổ hợp lai ở thế hệ

BC1F1, BC2F1, BC3F1 cho thấy: các tổ hợp lai đều thu được các con lai mang

các gen/gen ứng viên ở trạng thái dị hợp, cụ thể: tổ hợp lai DT39/Chấn

thơm thu được các con lai mang 2 gen ứng viên Xa4+xa5 và Xa4+Xa7,

Thủ đô 1/Chấn thơm thu được các con lai mang gen ứng viên Xa4+xa5,

An Dân 11/Hom râu thu được các con lai mang 3 gen ứng viên

xa5+Xa7+Xa21, Thủ đô 1/IRBB62 và Bắc thơm số 7/IRBB62 thu được

các con lai mang 3 gen Xa4 +Xa7+Xa21. Dựa vào đặc điểm hình thái, các

cá thể ưu tú đã được lựa chọn để lai trở lại và tự thụ, tạo thế hệ BC3F2.

- Các cá thể BC3F2 được gieo cấy, theo dõi và đánh giá 1 số chỉ tiêu

hình thái, chọn lọc theo kiểu hình ưu tú. Các cá thể có các đặc điểm ưu việt

như: thời gian sinh trưởng < 130 ngày, trỗ thoát hoàn toàn, lá vẫn giữ màu

xanh tự nhiên, hạt to, hạt mẩy, đều, chín tập trung, cứng cây và chiều cao

cây < 120 cm,.có kiểu hình gần giống với giống nền nhận gen hoặc có

một số tính trạng tốt hơn giống nền được lựa chọn, đánh dấu và thu mẫu lá

theo từng cá để tách chiết ADN, phục vụ cho thí nghiệm xác định gen ứng

viên kháng mục tiêu.

Kết quả kiểm tra PCR các dòng BC3F2 đã xác định được 1 số các thể

mang 2-3 gen/gen ứng viên mục tiêu đồng hợp kháng: 01 cá thể mang 2

gen ứng viên Xa4 +xa5 (R5.5-tổ hợp lai Thủ đô 1/Chấn thơm); 3 cá thể

mang 2 gen ứng viên Xa4 +xa5 (B1.16, B1.68, B1.77) và 03 cá thể mang 2

gen ứng viên Xa4 +Xa7 (B1.37, B1.44, B1.59) thuộc tổ hợp lai DT39/Chấn

thơm; tổ hợp lai An Dân 11/Hom râu xác định được 1 cá thể mang 3 gen

ứng viên xa5+Xa7+xa13 (B7.44), 1 cá thể có 2 gen ứng viên xa5+xa13

(B7.32), 1 cá thể có 2 gen ứng viên xa5+Xa7 (B7.48); tổ hợp lai Thủ đô

1/IRBB62 xác định được cá thể T4.9 mang 3 gen Xa4+Xa7+Xa21, T4.10

mang 2 gen Xa4+Xa7, T4.43 mang 2 gen Xa4 +Xa21; tổ hợp lai Bắc thơm

số 7/IRBB62 xác định được các cá thể: B6.13 (Xa4+Xa7+Xa21), B6.1

(Xa4+Xa7) và B6.25 ( Xa7+Xa21). Với mục đích là tạo các dòng mang đa

gen, 16 cá thể mang 2-3 gen/gen ứng viên đồng hợp kháng được lựa chọn

để đánh giá đặc điểm nông sinh học chính ở vụ Xuân 2017.

pdf28 trang | Chia sẻ: trungkhoi17 | Lượt xem: 403 | Lượt tải: 0download
Bạn đang xem trước 20 trang tài liệu Tóm tắt Luận án Nghiên cứu tích hợp gen kháng bệnh bạc lá vào một số dòng/giống lúa phục vụ chọn tạo giống, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
iễm sắc thể. Khi đó việc chọn lọc dựa vào chỉ thị phân tử sẽ cho kết quả không chính xác. Để loại bỏ tác động của hoạt động phân ly tái tổ hợp, có thể sử dụng các chỉ thị chức năng là những chỉ thị nằm trên gen kháng, khi đó sự biểu hiện của chỉ thị có thể đảm bảo sự có mặt của gen kháng trong cá thể. Ngoài ra có thể sử dụng kết hợp 2 chỉ thị nằm ở hai phía của gen kháng trong quá trình chọn lọc. Sự có mặt của hai chỉ thị này trong cùng một cá thể sẽ giúp tăng đáng kể hiệu quả chọn lọc. Chính vì vậy, việc phân tích genom, xác định chính xác vị trí, trình tự gen để thiết kế các chỉ thị chức năng là những chỉ thị nằm trong hoặc ngay 2 đầu gen đích có thể loại bỏ tác động của sự phân ly tái tổ hợp, làm tăng đáng kể hiệu quả chọn lọc cá thể mang gen kháng phục vụ công tác lai tạo giống (Miah et al., 2013). Ở đây, chúng tôi đã lựa chọn phương thức lai chọn lọc với chỉ thị phân tử trong phép lai trở lại để ứng dụng trong lai tạo. Đặc biệt, phương thức này rất có ưu thế trong việc tích hợp nhiều gen kháng vào một giống lúa do tính chính xác, nhanh chóng và độc lập đối với kiểu gen. 1.4. Tình hình nghiên cứu chọn tạo giống lúa kháng bạc lá 1.4.1. Sàng lọc nguồn gen kháng bệnh bạc lá Sàng lọc nguồn gen là một trong những khâu rất quan trọng và hữu ích trong các chương trình chọn tạo giống lúa. Cho đến nay, với những thành tựu đạt được trong việc phát hiện các gen kháng về cả định lượng và định tính đã đặt nền tảng cho những nghiên cứu chọn tạo giống kháng bệnh bạc lá. 1.4.2. Tình hình nghiên cứu chọn tạo giống lúa kháng bạc lá trên thế giới Với sự phát triển nhanh chóng của các chỉ thị phân tử, nhiều giống lúa cải tiến mang nhiều gen kháng bệnh nói chung và bạc lá nói riêng đã và 8 đang được chọn tạo. Tính đến này, khu vực Châu Á đã có hơn 10 giống lúa kháng bệnh bạc lá đã được phát triển và thương mại hóa. Các giống này đều được chọn tạo nhờ sử hỗ trợ của chỉ thị phân tử (MAS) (Valérie et al., 2011; Ali et al., 2014; Mueen et al., 2014). 1.4.3. Tình hình nghiên cứu chọn tạo giống lúa kháng bạc lá ở Việt Nam Ở Việt Nam, các nhà chọn giống thường sử dụng phương pháp truyền thống để cải tiến khả năng kháng bệnh bạc lá ở lúa, nhưng kết quả chưa cao, các dòng/giống mang gen kháng chưa ổn định hoặc chưa kháng được phổ rộng. Mười năm trở lại đây, với sự phát triển nhanh chóng của các chỉ thị phân tử, các nhà nghiên cứu của Việt Nam đã bước đầu ứng dụng chỉ thị phân tử trong chọn tạo giống và tạo ra nhiều dòng triển vọng. Các dòng triển vọng hiện đang được trồng khảo nghiệm ở một số vùng thuộc đồng bằng sông Hồng để đánh giá khả năng kháng thực tế trong điều kiện tự nhiên. Tuy nhiên, thực tế cho thấy, việc sử dụng các dòng NILs của Viện Nghiên cứu lúa Quốc tế (IRRI) làm dòng cho QTL/gen kháng có hiệu quả chưa cao do các chủng nòi sinh thái ở Việt Nam rất đa dạng và phong phú. Mặt khác, hiệu lực của các gen kháng bạc lá đối với các nòi vi khuẩn bạc lá phân lập ở các vùng khác nhau là không giống nhau - một gen có thể kháng với nòi bạc lá ở vùng này nhưng lại nhiễm với nòi ở vùng khác. Chính vì vậy, hiện nay việc sử dụng và khai thác nguồn gen kháng bản địa đang được chú trọng và là giải pháp hữu hiệu trong công tác chọn tạo giống lúa kháng bền vững với bệnh bạc lá. 1.5. Tổng quan về gen chất lƣợng và chỉ thị liên kết với gen chất lƣợng Trong các giống lúa chất lượng, tính trạng hương thơm và hàm lượng amyloza được đánh giá là một trong những tính trạng quan trọng về chất lượng. Gen Waxy là gen mã hóa cho sự tổng hợp amyloza ở lúa. Hương thơm của lúa liên quan đến gen BADH2 hay frg. Đã có rất nhiều chỉ thị được thiết kế để nhận biết 2 gen đích này, trong đó phải kể đến là chỉ thị ESP, IFAP, INSP và M-Wx để nhận biết gen BADH2 (gen thơm fgr) và Waxy tương ứng. Tại Việt Nam, những nghiên cứu về giống lúa chất lượng chủ yếu mới dừng lại ở mức nghiên cứu sự đa dạng di truyền giữa các giống lúa. Có rất ít các nghiên cứu chuyên sâu về sự di truyền liên quan đến tính trạng hương thơm cũng như các tính trạng chất lượng khác. 1.6. Khuynh hƣớng nghiên cứu quy tụ nhiều gen vào 1 giống lúa Thông thường, trong quy trình chọn tạo giống truyền thống, người ta đưa nguồn gen mới có tính trạng mong muốn vào một giống khác bằng phương pháp lai trở lại qua 5 - 6 thế hệ, hoặc chọn lọc cá thể trong quần thể phân ly từ thế hệ F2 đến thế hệ tiếp theo. Mỗi gen chính thường chỉ kháng được với một chủng gây bệnh hoặc nòi gây hại nào đó, do vậy nếu quy tụ được vài gen kháng vào một dòng hoặc giống lúa thì sẽ tạo ra được một dòng lúa kháng được nhiều chủng gây bệnh hoặc nhiều nòi gây hại. 9 Mặt khác, việc tích hợp đơn gen vào một giống thường dẫn đến tính kháng không ổn định, nhanh chóng bị mất đi trong một thời gian ngắn. Vì vậy muốn tạo ra giống lúa kháng bền vững đối với dịch hại, người ta phải đưa một vài gen kháng hiệu quả cao vào genom đích. Việc ứng dụng chỉ thị phân tử trong chọn tạo giống đang ngày càng trở nên phổ biến để việc tạo ra các giống lúa mang đồng thời nhiều gen qui định nhiều tính trạng, sẽ cải thiện đáng kể đến hiệu quả sản xuất lúa trong nhiều năm tới. CHƢƠNG 2. VẬT LIỆU, NỘI DUNG VÀ PHƢƠNG PHÁP NGHIÊN CỨU 2.1. VẬT LIỆU 2.1.1. Vật liệu nghiên cứu - 36 giống lúa bản địa đã được giải trình tự hệ gen do Trung tâm tài Nguyên thực vật cung cấp và cơ sở dữ liệu hệ gen của từng giống do Viện Di truyền Nông nghiệp cung cấp. - Các dòng/giống lúa ưu tú (An dân 11, Bắc thơm số 7, Bắc thơm kháng bạc lá, BC15, BQ, DT39, Hương cốm, Khang dân 28, NPT3, QJ4, QP5, Thiên ưu, Thủ đô 1 và RVT) thu thập ở Trung tâm Tài nguyên Thực vật, các Viện, Trường, các cơ sở nghiên cứu chọn tạo giống lúa: - Các dòng cận đẳng gen và đối chứng chuẩn nhiễm (Taichung Native 1 (TN1) và IR24) của Viện Nghiên cứu lúa quốc tế: IRRI (IRBB1 (xa1), IRBB2 (Xa1, Xa2), IRBB3 (Xa3), IRBB4 (Xa4), IRBB5 (xa5), IRBB7 (Xa7), IRBB10 (Xa10), IRBB11 (Xa11), IRBB13 (xa13), IRBB21 (Xa21), IRBB50 (Xa4+xa5), IRBB61 (Xa4+xa5+Xa7), IRBB62 (Xa4+Xa7+Xa21) và IRBB63 (xa5+Xa7+xa13). - Các isolate vi khuẩn gây bệnh bạc lá được thu thập và phân lập ở vụ mùa 2013 tại 2 tỉnh Nam Định và Hòa Bình, do TS. Hoàng Hoa Long (bộ môn Bệnh học Phân tử, Viện Di truyền Nông nghiệp) cung cấp - Trình tự các cặp mồi sử dụng trong nghiên cứu: 5 trình tự mồi nhận biết gen/gen kháng bệnh bạc lá (2/5 mồi tự thiết kế) và 2 trình tự mồi nhận biết gen chất lượng (thơm và hàm lượng amyloza). 2.1.2.Các loại hóa chất 2.1.3.Máy móc thiết bị sử dụng 2.2. NỘI DUNG NGHIÊN CỨU - Xác định gen kháng bạc lá, thiết kế mồi nhận diện các gen ứng viên kháng bạc lá; - Đánh giá khả năng kháng/nhiễm bệnh bạc lá của các nguồn vật liệu; - Tạo nguồn vật liệu mang đa gen/gen ứng viên kháng bệnh bạc lá; - Chọn lọc và đánh giá các vật liệu mang đa gen/gen ứng viên kháng bạc lá. 2.3. PHƢƠNG PHÁP NGHIÊN CỨU 10 - Phương pháp xác định các gen ứng viên liên quan kháng bạc lá; - Phương pháp thiết kế các chỉ thị SSLP; - Phương pháp tách chiết ADN: theo phương pháp CTAB của Obara và Kako có cải tiến (Khuất Hữu Trung và cs, 2011); - Phương pháp PCR; - Phương pháp điện di kiểm tra sản phẩm PCR trên gel polyacrylamide (Khuất Hữu Trung và cs, 2011) và gel agarose; - Phương pháp lây nhiễm bệnh bạc lá nhân tạo: theo phương pháp cắt lá của Furuya (2012) (đối với với nguồn vật liệu thu thập và dòng BC3F3) và IRRI-2014 (đối với các dòng khảo nghiệm-trong điều kiện nhà lưới); - Phương pháp lai trở lại và chọn lọc các dòng mang gen kháng ở các thế hệ theo mô hình của Huang (Huang et al., 2012); - Bố trí thí nghiệm đồng ruộng theo phương pháp của Nguyễn Thị Lan (2006); - Các chỉ tiêu theo dõi, phương pháp đánh giá đặc điểm nông sinh học được áp dụng theo Quy chuẩn kỹ thuật Quốc gia về khảo nghiệm giá trị canh tác và giá trị sử dụng giống lúa (QCVN 01-55:2011/BNN&PTNT) và IRRI, 1996; - Thí nghiệm khảo nghiệm sơ bộ thực hiện theo “Quy chuẩn kỹ thuật Quốc gia về khảo nghiệm giá trị canh tác và giá trị sử dụng của giống lúa” (QCVN 01-55: 2011/BNNPTNT); - Phương pháp xử lý số liệu: Sử dụng các phần mềm chuyên dụng:Excel 2010, IRRISTAT v5.0; các trình tự được sắp xếp và thiết lập trình duyệt bằng phần mềm: NextGENE v.2.3.4, ClustalW2, GSNAP, MEGA v.6.0; Thiết kế mồi bằng phần mềm Vector NTI v.11, Primer 3. CHƢƠNG 3. KẾT QUẢ VÀ THẢO LUẬN 3.1. Xác định gen kháng bạc lá và thiết kế mồi nhận diện các gen ứng viên kháng bạc lá 3.1.1. Xác định và thiết kế mồi nhận diện các gen ứng viên kháng bạc lá có trong các giống lúa bản địa của Việt Nam - Kết quả tầm soát trình tự vùng CDS và thành phần axit amin của gen ứng viên xa5 và so sánh với locus gen kháng bạc lá xa5 với mã hiệu là LOC_Os05g01710 đã thu nhận được 33 giống có số lượng nucleotit và thành phần axit amin vùng CDS đúng bằng với số lượng nucleotit của gen kháng bạc lá xa5 đã công bố (321 nucleotit và 106 axit amin). Kết quả tầm soát và so sánh trình tự locus xa5 cho thấy: tần số xuất hiện các đa hình đơn nucleotit (SNP) và các đoạn thêm, bớt (InDels) giữa các giống khá cao. Đặc biệt, có một đoạn trình tự mất đi 35 nucleotit đã được tìm thấy ở một số giống bản địa của Việt Nam không giống như gen kháng bệnh bạc lá xa5 đã được công bố. Dựa vào sự sai khác về trình tự đoạn gen kháng 11 bệnh bạc lá giữa các giống lúa, cặp mồi đặt tên là xa5add35 (có trình tự: xa5add35F: tagtggcatgggaaatatgg và xa5add35R: taggagaaactagccgtcca) đã được thiết kế nhờ sử dụng phần mềm thiết kế mồi Primer 3.0, có thể khuếch đại đoạn gen với kích thước tính toán 179 bp ở các giống có gen ứng viên kháng giống với công bố của thế giới và 144bp ở các giống có trình tự sai khác với đoạn trình tự gen xa5 kháng bạc lá. Từ đó đã xác định được 19 giống lúa nghiên cứu xuất hiện băng kích thước 179 bp. - Kết quả tầm soát trình tự vùng CDS và thành phần axit amin của gen ứng viên xa13 và so sánh với locus gen kháng bạc lá xa13 với mã hiệu là LOC_Os08g42350 đã thu nhận được 8 giống có số lượng nucleotit và axit amin vùng CDS đúng bằng với số lượng nucleotit của gen xa13 đã công bố (924 nucleotit và 307 axit amin). Trong số 8 giống trên thì có 2 giống là Chấn thơm và Hom râu có tỷ lệ nucleotit và thành phần axit amin giống hệt với gen kháng bạc lá xa13 (LOC Os08g42350) đã công bố. Sáu giống còn lại giống về thành phần axit amin nhưng lại có tỷ lệ T(U) và C khác với gen tham chiếu. Kết quả tầm soát và so sánh trình tự locus xa13 với gen kháng bạc lá LOC_Os08g42350 cho thấy: xuất hiện các đa hình đơn nucleotit (SNP) và các đoạn thêm, bớt (InDels) giữa các giống với gen xa13 đã công bố và giữa các giống với nhau. Dựa vào sự sai khác ở đoạn trình tự nằm trong gen (mất 4 nucleotit) đã được tìm thấy ở một số giống lúa bản địa của Việt Nam so với trình tự gen xa13 đã công bố, cặp mồi chức năng đặt tên là xa13add4 (có trình tự: F- tcactcactcactcactcaa và R- cattagcagcta gttaacttac) đã được thiết kế sử dụng phần mềm thiết kế mồi Primer 3,0, có thể khuếch đại đoạn gen với kích thước 97 bp (ở các giống mang gen ứng viên xa13 giống với trình tự thế giới công bố) và băng 93bp (ở các giống mang gen ứng viên xa13 khác với trình tự gen xa13 thế giới công bố). Từ đó đã xác định được 8 giống lúa có băng kích thước 97bp ở trạng thái đồng hợp, trong đó, 2 giống là Hom râu và Nếp bồ hóng Hải Dương xuất hiện băng kích thước 97bp, có số lượng nucleotit giống với gen kháng bạc lá xa13 đã công bố. Như vậy, 2 cặp mồi này có thể xác định được sự đa hình của gen ứng viên xa5 và xa13 và có thể sử dụng phục vụ công tác nghiên cứu đánh giá khả năng kháng bạc lá của các gen ứng viên này có trong các giống lúa bản địa của Việt Nam và phục vụ cho công tác chọn tạo giống lúa kháng bạc lá. 3.1.2. Xác định các gen kháng bạc lá có trong các nguồn vật liệu thu thập nhờ sử dụng các chỉ thị liên kết - Sử dụng 2 cặp mồi thiết kế xa5add35 và xa13add4 kiểm tra 14 dòng/giống lúa ưu tú, kết quả xác định được 02 giống (QJ4 và BC15) có sự xuất hiện của băng kích thước 179 bp tương tự như giống IRBB5 (đối chứng dương) và không có giống nào mang gen ứng viên xa13. A B 12 - Sử dụng các mồi MP1-2, P3 và pTA248 để xác định các gen Xa4, Xa7 và Xa21 tương ứng có trong các dòng/giống nghiên cứu. Kết quả xác định được 11 dòng/giống mang gen ứng viên Xa4 (Thơm Lài, Nếp mặn, Một bụi đỏ, Nàng Cờ đỏ 2, Chấn thơm, Nếp ông táo, OM3536, IS1.2, Bắc thơm kháng bạc lá, Thiên ưu và RVT), 12 dòng/giống mang gen ứng viên Xa7 (Lúa ngoi, Ble te lo, Kháu mặc buộc, Chấn thơm, Coi ba đất, Ba cho K’ te, Blào sinh sái, Khấu điển lư, Nếp mèo nương, Hom râu, QJ4 và BQ), không có dòng/giống nào mang gen ứng viên Xa21 giống như dòng IRBB62. - Từ kết quả nhận diện gen/gen ứng viên kháng bạc lá đã xác định được 04 giống bản địa mang 3 gen ứng viên, đó là Chấn thơm, Coi ba đất, Khấu điển lư và Hom râu. Như vậy, đã tầm soát được 2 gen ứng viên xa5 và xa13 ở một số giống lúa bản địa của Việt Nam có trình tự và thành phần acid amin tương đồng với các gen tham chiếu đã công bố trên NCBI. Từ đó, thiết kế được 2 chỉ thị chức năng (xa5add35 và xa13add4) và xác định được 4 giống đó là Chấn thơm (Xa4, xa5 và Xa7), Hom râu, Coi ba đất và Kháu điển lư (xa5, Xa7 và xa13) mang 3 gen ứng viên, trong đó gen ứng viên xa5 và xa13 được nhận biết nhờ sử dụng chỉ thị chức năng đã thiết kế. Các chỉ thị này được sử dụng để phục vụ công tác nghiên cứu đánh giá tính kháng bạc lá của các gen ứng viên xa5, xa13 có trong các giống lúa bản địa của Việt Nam và phục vụ cho công tác chọn tạo giống lúa kháng bệnh bạc lá. 3.2. Đánh giá khả năng kháng/nhiễm bệnh bạc lá của các nguồn vật liệu Kết quả lây nhiễm 2 isolate vi khuẩn gây bệnh bạc lá với 24 dòng/giống nghiên cứu cho thấy: giống Hom râu, Chấn thơm và QJ4 kháng đối với isolate AGI5.6 và kháng trung bình với isolate AGI4.1. Giống Kháu điển lư kháng trung bình với cả 2 isolate lây nhiễm. Có 8 dòng/giống ưu tú kháng trung bình với isolate AGI5.6 và nhiễm với isolate AGI4.1 (BQ, QP5, Thủ đô 1, Bắc thơm kháng bệnh bạc lá, BC15, Thiên ưu, RVT và Hương cốm) và 5 dòng/giống ưu tú còn lại nhiễm với cả 2 isolate lây nhiễm (NPT3, Bắc thơm số 7, Khang dân 28, DT39 và An dân 11). 3 dòng IRBB5, IRBB7, IRBB62 kháng hoàn toàn với 2 isolate lây nhiễm, dòng IRBB13 kháng hoàn toàn với isolate AGI5.6 và kháng trung bình với isolate AGI4.1. Dòng IRBB4, IRBB21 kháng trung bình với cả 2 isolate lây nhiễm. Như vậy, từ kết quả đánh giá tính kháng/nhiễm của các dòng/giống lúa nghiên cứu với các isolate vi khuẩn phân lập ở 2 tỉnh phía bắc, chúng ta có thể sử dụng các giống Hom râu, Chấn thơm, Kháu điển lư, QJ4 và các dòng NIL của Viện Nghiên cứu lúa Quốc tế (IRRI) để làm nguồn cho gen, phục vụ cho lai tạo. A B 13 3.3. Tạo nguồn vật liệu mang đa gen/gen ứng viên kháng bệnh bạc lá - Dựa vào kết quả tầm soát và nhận dạng các gen ứng viên, mức độ kháng hiệu quả với các isolate vi khuẩn gây bệnh bạc lá đã phân lập, sự chênh lệch thời gian sinh trưởng của các giống bố, mẹ và mức độ cảm quang của các giống bản địa, chúng tôi đã thiết kế 05 tổ hợp lai khác nhau (DT39/Chấn thơm, Thủ đô 1/Chấn thơm, An Dân 11/Hom râu, Thủ đô 1/IRBB62 và Bắc thơm số 7/IRBB62) và ứng dụng chỉ thị phân tử, lai trở lại đến thế hệ BC3F1, sau đó tự thụ đến thế hệ BC3F4 để chọn tạo ra các dòng/giống mang đa gen kháng; - Kết quả kiểm tra gen ứng viên mục tiêu của 05 tổ hợp lai ở thế hệ BC1F1, BC2F1, BC3F1 cho thấy: các tổ hợp lai đều thu được các con lai mang các gen/gen ứng viên ở trạng thái dị hợp, cụ thể: tổ hợp lai DT39/Chấn thơm thu được các con lai mang 2 gen ứng viên Xa4+xa5 và Xa4+Xa7, Thủ đô 1/Chấn thơm thu được các con lai mang gen ứng viên Xa4+xa5, An Dân 11/Hom râu thu được các con lai mang 3 gen ứng viên xa5+Xa7+Xa21, Thủ đô 1/IRBB62 và Bắc thơm số 7/IRBB62 thu được các con lai mang 3 gen Xa4 +Xa7+Xa21. Dựa vào đặc điểm hình thái, các cá thể ưu tú đã được lựa chọn để lai trở lại và tự thụ, tạo thế hệ BC3F2. - Các cá thể BC3F2 được gieo cấy, theo dõi và đánh giá 1 số chỉ tiêu hình thái, chọn lọc theo kiểu hình ưu tú. Các cá thể có các đặc điểm ưu việt như: thời gian sinh trưởng < 130 ngày, trỗ thoát hoàn toàn, lá vẫn giữ màu xanh tự nhiên, hạt to, hạt mẩy, đều, chín tập trung, cứng cây và chiều cao cây < 120 cm,...có kiểu hình gần giống với giống nền nhận gen hoặc có một số tính trạng tốt hơn giống nền được lựa chọn, đánh dấu và thu mẫu lá theo từng cá để tách chiết ADN, phục vụ cho thí nghiệm xác định gen ứng viên kháng mục tiêu. Kết quả kiểm tra PCR các dòng BC3F2 đã xác định được 1 số các thể mang 2-3 gen/gen ứng viên mục tiêu đồng hợp kháng: 01 cá thể mang 2 gen ứng viên Xa4 +xa5 (R5.5-tổ hợp lai Thủ đô 1/Chấn thơm); 3 cá thể mang 2 gen ứng viên Xa4 +xa5 (B1.16, B1.68, B1.77) và 03 cá thể mang 2 gen ứng viên Xa4 +Xa7 (B1.37, B1.44, B1.59) thuộc tổ hợp lai DT39/Chấn thơm; tổ hợp lai An Dân 11/Hom râu xác định được 1 cá thể mang 3 gen ứng viên xa5+Xa7+xa13 (B7.44), 1 cá thể có 2 gen ứng viên xa5+xa13 (B7.32), 1 cá thể có 2 gen ứng viên xa5+Xa7 (B7.48); tổ hợp lai Thủ đô 1/IRBB62 xác định được cá thể T4.9 mang 3 gen Xa4+Xa7+Xa21, T4.10 mang 2 gen Xa4+Xa7, T4.43 mang 2 gen Xa4 +Xa21; tổ hợp lai Bắc thơm số 7/IRBB62 xác định được các cá thể: B6.13 (Xa4+Xa7+Xa21), B6.1 (Xa4+Xa7) và B6.25 ( Xa7+Xa21). Với mục đích là tạo các dòng mang đa gen, 16 cá thể mang 2-3 gen/gen ứng viên đồng hợp kháng được lựa chọn để đánh giá đặc điểm nông sinh học chính ở vụ Xuân 2017. 14 Hình 3.22. Ảnh điện di sản phẩm PCR xác định gen Xa4 (a), Xa7 (b), Xa21 (c) đối với các cá thể BC3F2 của tổ hợp lai Bắc thơm số 7/IRBB62 sử dụng cặp mồi MP1-2, P3, pTA248 tương ứng B6.1-B6.48: cá thể BC3F2; M20: O'RangeRuler 20bp DNA Ladder; M100: 100bp DNA Ladder; B: giống IRBB62; M: giống Bắc thơm số 7;(-): giống IR24 (đối chứng âm) Các cá thể BC3F2 mang đa gen/gen ứng viên kháng cũng đã được kiểm tra gen BADH2 và waxy liên quan đến tính trạng mùi thơm và hàm lượng amylose với các chỉ thị EAP, ASP, IFAP, INSP (BADH2) và M-Wx. Kết quả thu được cho thấy: 08 cá thể BC3F2 (6 cá thể có nguồn gốc từ tổ hợp lai DT39/Chấn thơm và 02 cá thể có nguồn gốc từ tổ hợp lai Bắc thơm số 7/IRBB62) có kiểu gen BADH2 đồng hợp tử lặn (thơm); đối với gen Waxy thì tất cả các dòng đều sự xuất hiện của 2 băng kích thước 228bp và 425bp, giống như các dòng/giống bố, mẹ (trừ dòng IRBB62) và giống Jasmine 85, điều này có nghĩa là các dòng BC3F2 có hàm lượng amylose < 20%. Như vậy, với sự hỗ trợ của chỉ thị phân tử từ 5 tổ hợp lai thiết kế đã tạo được 10 dòng BC3F3 mang 2-3 gen ứng viên Xa4+xa5/Xa4+Xa7/ xa5+Xa7+xa13 (có nguồn gốc từ các giống bản địa) có nền di truyền của giống DT39, Thủ Đô 1 và An dân 11 và 06 dòng BC3F3 mang 2-3 gen Xa4+Xa7/ Xa4+Xa21/Xa7+Xa21/ Xa4+Xa7+Xa21 (có nguồn gốc từ các dòng NILs của IRRI) có nền di truyền của giống Bắc thơm số 7 và Thủ Đô 1. Ngoài ra, xác định được 16/16 dòng đều mang gen Waxy, 8/16 dòng mang gen BADH2 - đây chính là nguồn vật liệu hữu ích phục vụ cho công tác chọn tạo giống kháng bệnh bạc lá. 3.4. Chọn lọc và đánh giá các vật liệu mang đa gen/gen ứng viên kháng bạc lá 3.4.1. Đánh giá một số đặc điểm nông sinh học chính và khả năng kháng bạc lá (lây nhiễm nhân tạo) của các dòng BC3F3 mang gen ứng viên kháng bạc lá có nền di truyền của giống An dân 11 (a) (b) (c) 15 Các cá thể thuộc thế hệ BC3F3 của tổ hợp lai An dân 11/Hom râu (kí hiệu AD2) được gieo trồng ở vụ Xuân 2017 để đánh giá khả năng kháng bạc lá (bằng lây nhiễm nhân tạo) và theo dõi, đánh giá một số đặc điểm nông sinh học chính. Chúng tôi đã sử dụng 2 isolate vi khuẩn bạc lá AGI4.1 và AGI5.6 để đánh giá khả năng kháng/nhiễm của 3 dòng AD2/1, AD2/2 và AD2/3. Hình 3.26. Đánh giá lây nhiễm nhân tạo khả năng kháng bạc lá của các của các dòng BC3F3 có nền di truyền của giống An Dân 11 (Vụ Xuân 2017) (a): dòng AD2/1; (b): dòng AD2/2; (c): dòng AD2/3; (d): Mẫu lá lây nhiễm isolate AGI5.6 Hình 3.27. Các cá thể BC3F3:4 mang gen ứng viên kháng bạc lá có nền di truyền của giống An Dân 11 Kết quả thu được cho thấy giống bố mẹ và 3 dòng BC3F3 có phản ứng kháng/nhiễm khác nhau với các isolate lây nhiễm khác nhau. Giống An dân 11 bị nhiễm bệnh ở cả 2 isolate AGI4.1 và AGI5.6. Các dòng AD2/1, AD2/2, AD2/3 mang 2-3 gen ứng viên (xa5+Xa7+xa13/ xa5+Xa7/xa5+xa13) biểu hiện tính kháng từ kháng trung bình đến kháng ở cả 2 isolate lây nhiễm, cả 3 dòng đều kháng với isolate AGI5.6 và kháng trung bình với isolate AGI4.1, tương tự như giống Hom râu (giống cho gen) và 2 dòng của IRRI là dòng IRBB5 và IRBB13. Dòng IRBB7 và IRBB63 kháng với cả 2 isolate. Kết quả đánh giá các chỉ tiêu hình thái và năng suất của 3 dòng AD2 cho thấy: 2 chỉ tiêu sức sống mạ và độ thoát cổ bông của các dòng tương tự như giống An dân 11. Độ tàn lá có sự phân ly giữa 3 dòng BC3F3. Các dòng AD2 đều có, sức sống mạ đạt điểm 1 (cây (a) (b) (c) (d) (a) 16 sinh trưởng tốt, lá xanh, nhiều cây có hơn 1 dảnh), độ thoát cổ bông đạt điểm 1 (thoát hoàn toàn) và có độ cứng cây đạt điểm 5 (cứng trung bình). Chiều cao cây trung bình của 3 dòng AD2 dao động từ 109,4 - 118 cm. Năng suất lý thuyết và năng suất thực thu của cả 3 dòng đều thấp hơn so với giống An dân 11, tỷ lệ hạt chắc dao động từ 88,2 đến 91,2 %; tổng số hạt/bông dao động từ 168 đến 196 hạt, thấp hơn so với giống đối chứng; khối lượng 1000 hạt dao động từ 18,9 đến 20,1 gam. Số bông hữu hiệu/khóm là chỉ tiêu liên quan đến số bông/đơn vị diện tích, dao động từ 6,6 - 7,6 bông. Bảng 3.19. Các yếu tố cấu thành năng suất của các dòng BC3F3 mang gen ứng viên kháng bạc lá có nền di truyền của giống An Dân 11 (Vụ Xuân 2017 - Thạch Thất, Hà Nội) TT Tên dòng/ giống Số bông hữu hiệu Tổng số hạt/ bông Tỷ lệ hạt chắc (%) Khối lƣợng 1000 hạt (g) Năng suất lý thuyết (tạ/ha) Năng suất thực thu (tạ/ha) 1 An dân 11 6,5 240,9 88,1 18,75 84,96 66,10 2 AD2/1 6,7 168,0 88,2 19,5 63,05 41,80 3 AD2/2 7,6 169,4 87,5 20,1 74,53 52,49 4 AD2/3 6,6 196,0 91,2 18,9 73,15 50,54 CV% 5,2 5,3 2,6 - 6,0 8,5 LSD0,05 0,9 17,3 3,3 - 7,7 10 Dựa vào các chỉ tiêu năng suất và khả năng kháng bệnh bạc lá cho thấy có thể sử dụng dòng AD2/1, AD2/2 và AD2/3 làm nguồn vật liệu để phục vụ cho công tác chọn tạo giống kháng bệnh bạc lá. 3.4.2. Đánh giá một số đặc điểm nông sinh học chính và khả năng kháng bạc lá (lây nhiễm nhân tạo) của các dòng BC3F3 mang gen ứng viên kháng bạc lá có nền di truyền của giống DT39 Các dòng BC3F3 có nguồn gốc từ tổ hợp lai DT39/Chấn thơm (kí hiệu DT39-6) được đánh giá khả năng kháng/nhiễm qua lây nhiễm nhân tạo. Kết quả thu được cho thấy tất cả 6 dòng BC3F3 đều có khả năng kháng bạc lá, từ kháng trung bình đến kháng với isolate AGI5.6. Đối với isolate AGI4.1 thì chỉ có 2 dòng kháng trung bình (DT39-6/3, DT39-6/4), 4 dòng khác đều bị nhiễm bạc lá (DT39-6/1, DT39-6/2, DT39-6/5, DT39-6/6). Trong đó, có 2 dòng mang 2 gen ứng viên (Xa4+xa5/Xa4+Xa7) là DT39- 6/3, DT39-6/4 kháng với isolate AGI5.6 và kháng trung bình isolate AGI4.1 tương tự như giống Chấn thơm (giống cho gen) và dòng IRBB5 (dòng NIL của IRRI). Kết quả đánh giá một số đặc điểm nông sinh học chính của các dòng này cho thấy: dòng DT36-6 có sức sống mạ ở mức trung bình, cây sinh trưởng trung bình, hầu hết có 1 dảnh (điểm 5), độ thoát cổ bông điểm 1 17 (thoát hoàn toàn). Độ cứng cây của các dòng đều được đánh giá từ điểm 1 (cứng cây) đến điểm 5 (cứng trung bình), các dòng DT39-6/3, DT39-6/5, DT39-6/6 là các dòng cứng cây, cây không bị đổ. Trong tổng số 6 dòng thì có 3 dòng vẫn giữ được màu xanh tự nhiên ở giai đoạn chín (độ tàn lá điểm 1); 3 dòng còn lại thì các lá trên biến vàng tương tự giống DT39 (độ tàn lá điểm 5). Các dòng đều có thời gian sinh trưởng từ 120-130 ngày và chiều cao cây 104,6 - 113,4 cm, tương tự giống DT39. Từ kết quả thu nhận được cho thấy các dòng DT39-6 đều thuộc nhóm giống ngắn ngày và có chiều cao trung bình. Hình 3.29. Đánh giá lây nhiễm nhân tạo khả năng kháng bạc lá của các của các dòng BC3F3 có nền di truyền của giống DT39 (Vụ Xuân 2017) (a): dòng DT39-6/1, DT39-6/2, DT39-6/3, DT39-6/4; (b): DT39-6/5, DT39-6/6, Mẫu lá lây nhiễm isolate AGI5.6 Bảng 3.22. Các yếu tố cấu thành năng suất của các dòng các dòng BC3F3 mang gen kháng bạc lá có nền di truyền của giống DT39 (Vụ Xuân 2017 - Thạch Thất, Hà Nội) TT Tên dòng/ giống Số bông hữu hiệu Tổng số hạt/ bông Tỷ lệ hạt chắc (%) Khối lƣợng 1000 hạt (g) Năng suất lý thuyết (tạ/ha) Năng suất thực thu (tạ/ha) 1 DT39 8,6 160,2 82,60 23,5 88,22 61,24 2 DT39-6/1 8,2 170,0 73,53 20,9 70,49 54,43 3 DT39-6/2 8,7 150,8 71,80 21,1 65,09 47,63 4 DT39-6/3 8,5 175,6 83,93 23,9 99,02 63,18 5 DT39-6/4 7,5 200,0 91,20 19,4 87,15 61,24 6 DT39-6/5 7,7 226,2 92,47 16,7 8

Các file đính kèm theo tài liệu này:

  • pdftom_tat_luan_an_nghien_cuu_tich_hop_gen_khang_benh_bac_la_va.pdf
Tài liệu liên quan