Tóm tắt Luận án Tiêu chuẩn hoá dược liệu đương quy Nhật Bản di thực từ cây Angelica Acutiloba (Sieb.et zucc.) Kitagawa trồng tại Việt Nam

Các bước định danh:

Bước 1: Chiết tách DNA toàn phần

Bước 2: Chọn lựa đoạn gen (ITS, trnH-psbA, matK) để

khuếch đại

Bước 3: Giải trình tự

Bước 4: So sánh với trình tự tham chiếu

Đánh giá kết quả

1. Trình tự mẫu thử phải bao phủ toàn bộ vùng key base của

trình tự tham chiếu

2. Trình tự vùng key base của mẫu thử phải trùng khít 100%

với vùng key base của trình tự tham chiếu

3. Trình tự ngoài vùng key base của mẫu thử phải trùng khít >

95% với vùng tương ứng của trình tự tham chiếu

pdf28 trang | Chia sẻ: thinhloan | Ngày: 12/01/2023 | Lượt xem: 25 | Lượt tải: 0download
Bạn đang xem trước 20 trang tài liệu Tóm tắt Luận án Tiêu chuẩn hoá dược liệu đương quy Nhật Bản di thực từ cây Angelica Acutiloba (Sieb.et zucc.) Kitagawa trồng tại Việt Nam, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
five components in Angelica sinensis and Angelica acutiloba acclimatized growing in vietnam by high-performance liquid chromatography with photodiode array detector”,World Journal of Traditional Chinese Medicine, Volume 7 | Issue 1 | January-March 2021, DOI: 10.4103/wjtcm.wjtcm_28_20 5. Pham T.M.T., Le T.T.C., Tran V.H., Nguyen V.T. (2021), “Isolation and identification of two flavonoid compounds from acclimatized Angelica acutiloba Kitagawa growing in Vietnam”, World Journal of Traditional Chinese Medicine, 2021(x), xx-xx (Accepted by July 1st, 2021) -­‐  1  -­‐   GIỚI THIỆU LUẬN ÁN 1. Tính cấp thiết của luận án Đương quy là dược liệu quý và phổ biến trong Đông y, đa phần dược liệu Đương quy (Angelica sinensis) đều nhập từ Trung quốc. Đương quy Nhật Bản (Angelica acutiloba) được trồng rất nhiều tại các tỉnh khu vực miền Trung, Tây Nguyên như Lâm Đồng, Đắk Nông, Đắk Lắk, Quảng Nam,... và các tỉnh vùng núi phía Bắc như Lào Cai, Sơn La, ... Nghiên cứu ứng dụng các kỹ thuật hiện đại vào công tác kiểm nghiệm, đánh giá chất lượng dược liệu là một yêu cầu cấp bách và cần thiết để theo kịp với thế giới, phục vụ cho nhu cầu của xã hội, cũng là một trong những động thái để tìm đầu ra cho Đương quy Nhật Bản (Angelica acutiloba) đang được nhân dân trồng ở quy mô công nghiệp. 2. Mục tiêu nghiên cứu Vì tính chất cấp thiết trên, đề tài: "Tiêu chuẩn hóa dược liệu Đương quy Nhật Bản di thực từ cây Angelica acutiloba (Sieb. et Zucc.) Kitagawa trồng tại Việt Nam" được thực hiện với mục tiêu xây dựng tiêu chuẩn và thiết lập cơ sở khoa học nhằm đề xuất dự thảo nâng cấp chuyên luận "Đương quy di thực" với các mục tiêu cụ thể như sau: 1.   Định danh cây thuốc Angelica acutiloba (Sieb. et Zucc.) Kitagawa bằng phương pháp phân tích thực vật và giải trình tự gen. -­‐  2  -­‐   2.   Chiết xuất, tinh chế và xác định cấu trúc một số thành phần hóa học chính trong Angelica acutiloba (Sieb. et Zucc.) Kitagawa. 3.   Thiết lập một số chất đối chiếu hóa học đặc trưng cho dược liệu Đương quy Nhật Bản di thực Radix Angelicae acutilobae 4.   Xây dựng các quy trình định tính và định lượng đồng thời một số chất trong dược liệu Radix Angelicae acutilobae. 5.   Tiêu chuẩn hoá dược liệu từ cây Đương quy Nhật Bản trồng tại Việt Nam, từ đó thiết lập dược liệu đối chiếu rễ Đương quy Nhật Bản Radix Angelicae acutilobae. Đề xuất dự thảo nâng cấp chuyên luận "Đương quy Nhật Bản di thực (rễ) Radix Angelicae acutilobae". 3. Những đóng góp mới của nghiên cứu về mặt lý luận và thực tiễn 1.   Đánh giá mức độ phân biệt của 4 trình tự ITS, rbcL, matK, đoạn chèn trnH-psbA trên A. acutiloba. Đề xuất trình tự tham chiếu của ITS, matK, đoạn chèn trnH-psbA làm cơ sở dữ liệu so sánh. Đề xuất các bước để định danh dược liệu A. acutiloba bằng phương pháp giải trình tự gen dựa trên trình tự tham chiếu theo mô hình Dược điển Anh. 2.   Phân lập 11 chất từ Angelica acutiloba; trong đó rutin và isoquercitrin là báo cáo đầu tiên trên thế giới phân lập từ A. acutiloba. 3.   Thiết lập 4 chuẩn đối chiếu từ A. acutiloba. Trong đó Z- ligustilid là chuẩn đầu tiên ở Việt Nam. -­‐  3  -­‐   4.   Xây dựng và thẩm định quy trình định lượng đồng thời 5 chất acid chlorogenic, scopoletin, acid ferulic, xanthotoxin và Z-ligustilid bằng phương pháp HPLC đầu dò PDA. 5.   Xây dựng và thẩm định quy trình định lượng các monosaccharid cấu thành polysaccharid bằng phương pháp thuỷ phân và tạo dẫn xuất với PMP, sau đó phân tích bằng HPLC với đầu dò PDA. Tách các phân đoạn polysaccharid dựa trên mức độ không tan trong EtOH ở các nồng độ khác nhau và xác định tỷ lệ monosaccharid của các phân đoạn phân lập được. 6.   Đã thiết lập một "Bảng điểm đánh giá marker" áp dụng cho các dược liệu dựa theo các tiêu chí của WHO. Dựa vào những nghiên cứu khảo sát về thành phần hóa học của dược liệu, đã xây dựng toàn văn tiêu chuẩn và dự thảo đề xuất nâng cấp chuyên luận dược điển Đương quy Nhật Bản. Đề xuất đổi tên Việt Nam của chuyên luận Radix Angelicae acutilobae từ "Đương quy di thực" thành "Đương quy Nhật Bản di thực". 5. Bố cục của luận án Luận án gồm 148 trang: Mở đầu 2 trang, tổng quan 33 trang, đối tượng và phương pháp nghiên cứu 23 trang, kết quả nghiên cứu 61 trang, bàn luận 24 trang, điểm mới của luận án 1 trang, kết luận 3 trang và kiến nghị 1 trang. Luận án có 64 bảng, 49 hình, 9 sơ đồ, 177 tài liệu tham khảo gồm 8 tài liệu tiếng Việt và 169 tài liệu tiếng Anh, 35 phụ lục thể hiện các kết quả thực nghiệm. -­‐  4  -­‐   Chương 1: TỔNG QUAN TÀI LIỆU Trình bày về những vấn đề sau 1.   Tổng quan về dược liệu mang tên Đương quy 2.   Thành phần hóa học của Đương quy Nhật Bản 3.   Tác dụng dược lý của Đương quy Nhật Bản 4.   Tổng quan về các chỉ tiêu và phương pháp kiểm nghiệm 5.   Tổng quan về tiêu chuẩn hóa dược liệu, chuẩn đối chiếu và chất đánh dấu Chương 2: ĐỐI TƯỢNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU 2.1. Đối tượng Đương quy Nhật Bản trồng tại Việt Nam, Angelica acutiloba (Sieb. et Zucc.) Kitagawa, và những hợp chất tự nhiên trong thành phần hoá học có thể chọn làm chuẩn đối chiếu. Nguyên liệu dùng cho nghiên cứu là thân, lá và rễ củ Đương quy tươi hoặc khô hoặc đã qua chế biến thành dược liệu. 2.2. Phương pháp nghiên cứu 2.2.1 Định danh cây thuốc bằng phân tích thực vật và giải trình tự gen. 2.2.2 Chiết xuất, phân lập, tinh chế và xác định cấu trúc. 2.2.3 Thiết lập chuẩn đối chiếu từ dược liệu. 2.2.4 Xây dựng quy trình định lượng đồng thời acid chlorogenic, acid ferulic, scopoletin, xanthotoxin và Z-ligustilid. 2.2.5 Phân tích carbohydrat -­‐  5  -­‐   2.2.6 Tiêu chuẩn hoá và đề xuất dự thảo nâng cấp chuyên luận dược liệu Đương quy Nhật Bản di thực (rễ) Radix Angelicae acutilobae. 2.2.7 Thiết lập chuẩn dược liệu Radix Angelicae acutilobae. Chương 3: KẾT QUẢ 3.1 - Định danh dược liệu Bảng 3-1: Khoảng cách loài ITS (#600bp) trnH-psbA (#220 bp) rbcL (#500bp) matK (#800 bp) A. gigas 0,0164 1,0423 0,0013 0,0195 A. sinensis 8,1889 1,5399 0.0027 0,0308 Levisticum officinale 7,6995 1,4055 0,0028 0,0146 Từ cây phân loài và khoảng cách loài, chọn ITS > trnH-psbA > matK làm marker sinh học để định danh dược liệu Angelica acutiloba. Xác định trình tự tham chiếu và trình tự key base của các đoạn trình tự/gen như sau: Trình tự ITS có 618 base với 98 key base: TCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAATAG CAGAATGACCCGCTAACACGtcaacattttgggcgAGCGTCGGGGGGCCTC GGTCTCCTGTCTGCGAATCCCTGGTAGGTggccactcccgggtggCCACTG GCCTGCAAAATCATTCGGGCGCGGAATGCGCCAAGGACCTTAAAA CTGAATTGTACGTCCGTATCCCGTTagcgggcaccggcgtcattccaaaacACAA CGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACG TAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCA -­‐  6  -­‐   TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCTgagggca cgcctgcctgggtgtcacgcatcgtcttgcccacAAACCACTCACACCTGAGAAGTTG TGCCGGTTTGGGGCGGAAACTGGCCTCCCGTACCTTGTCGTGCGGT TGGCGGAAAAACGAGTCTCCGGCGACGGACGTCGCGACATCGGTG GTTGTAAAAGACCCTCTTGTCTTGTCGTGCGAATCCTCGTCATCTTA GCGAGCTCCAGGACCCTTAGGCAGCACACACTCTGTGCGCTTCGAC TGTGACCCCAGGTCAGGCGGGACTACCCGCTGAGTTTAAGCATATC AATAAG Trình tự đoạn chèn trnH-psbA có 268 base với 41 key base: CTTGGCTACATCCGCCCCGCCAattttcttttatttatttattaaatatttattaAAGaaa aaaaaGGATTCCTTTTTGATCATTCAAAAATATTTGTTTATCTAAAAC AGTCTGAAATATAAAAAGAAGAAATACCGCCCTCTTGATAGAACA AGAGGGCGGTATTTCTTCTTTTTATTTCAAAAAACTCGTATATACTA AAACCCGGTCTTACCCATTTGTAGATGGAGCTTCAACAGCAGCTAG GTCTAGAGGAAAGTTATGAGCATTACGTTCGTGCATAAC Trình tự gen matK có 816 base vói 75 key base AGTCGAAGTATATACTTTATTCGATACAAACTCtttttttGTGAGGATCC ACTATAATAATGAGAAATATTTCTGcagatacgcccaaatcggacaacAATAT CAGAATCTGATAAATCAGTCCAAACCGCCTTACTAATAGGGTGCCC CAATACGTTACAAAATCTCGCCTTAGacaaTGATCCAATTAGAGGAA CAATTGGAACAAGAGTATCGAACTTATTAATAGGATTATCAATTAT AAATGCATTTTCTAGCATTTGACTGCGTACCATTGAAGGGTTTAGT CGCGCACTTGATAGATAGCCCAGAAGAGCTAGGGAATGATTATAT AATTGGTTTATACAGATCCGTCCCGGCTGAGACCATAGGTAAAAAT GACATTTCCATAAATtgacaaaataatatgtccattttttcatcaaaaggggcgtcCCTTT -­‐  7  -­‐   TGAAGCGAGAATGGATTTTCCTTGATAACTAATATAATGCATGAAA GGGTCCTTAAACAACCATAGATTGTCCTGAAAGGCCTTAGCAAAA GCTTCTACAAGTCCAAGATGTTTTAGTTTTCCATATAAAAAGATTC GTTCAAGAAGGGTTCCAGAAGACGTTGAGCATAAATGAGAAGATT TGTTACGAAGAAAGACGAAGATGGATTCGTATTCACATAGATGAG AATTATATAGGACGAAGAAAAACCTTTGATTTCTTTTTGAAAAACA AGAACTGGCTTTATTTGGAGTATTCCAAATACGATACTCGTGGAGA AAGAATCTTAATAAATGTAAAGAAGAAGCGTCTTTTACCCAGTAGC GAAGAGTTTGA Các bước định danh: Bước 1: Chiết tách DNA toàn phần Bước 2: Chọn lựa đoạn gen (ITS, trnH-psbA, matK) để khuếch đại Bước 3: Giải trình tự Bước 4: So sánh với trình tự tham chiếu Đánh giá kết quả 1.   Trình tự mẫu thử phải bao phủ toàn bộ vùng key base của trình tự tham chiếu 2.   Trình tự vùng key base của mẫu thử phải trùng khít 100% với vùng key base của trình tự tham chiếu 3.   Trình tự ngoài vùng key base của mẫu thử phải trùng khít > 95% với vùng tương ứng của trình tự tham chiếu 3.2 - Chiết xuất, phân lập, tinh chế và xác định cấu trúc -­‐  8  -­‐   3.2.1 Chiết xuất, phân lập và tinh chế Sơ đồ 3-1: Kết quả phân lập và tinh chế 11 chất từ cây Đương quy Nhật Bản trồng tại Việt Nam. 3.2.2 Xác định cấu trúc Dựa vào các đặc tính lý, hoá và kết quả phân tích phổ UV, IR, MS, NMR (13C-NMR, 1H-NMR, DEPT, HSQC, COSY, HMBC) 11 chất chiết xuất ở trên được xác định là: (1) LIG là Z-ligustilid, (2) E29 là psoralen, (3) E30 là xanthotoxin, (4) E35A là Isopimpinellin, (5) E35B là bergapten, (6) P20A là senkyunolid I, (7) P20B là senkyunolid H, (8) V20 là acid ferulic, (9) S18 là acid chlorogenic, (10) S1 là rutin và (11) S2 là isoquercitrin. Kết quả phân tích cũng phù hợp với các nghiên cứu đã công bố. Z-ligustilid   Senkyunolid I   Senkyunolid H   O H O ! O H OOH HO ! O H OOH HO -­‐  9  -­‐   Psoralen Xanthotoxin   Bergapten   Isopimpinellin   Acid ferulic Acid chlorogenic Rutin Isoquercitrin 3.3 -Thiết lập chuẩn đối chiếu hóa học từ dược liệu Bốn chất được chọn lựa trong số 11 chất tách chiết được từ dược liệu Đương quy Nhật Bản là: (1): Z-ligustilid, (2): xanthotoxin, (3): acid chlorogenic, (4): acid ferulic. !OO O ! OO O O !OO O O ! OO O O O C O OHHO O C O OHO HO OH OH HO O OH ! O OOH HO OH OH O O O HO OH OH O OHHO HO H3C ! O OOH HO OH OH O O HO OH OH OH -­‐  10  -­‐   3.3.1 Xây dựng và thẩm định quy trình định lượng Bảng 3-2: Điều kiện sắc ký lỏng hiệu năng cao   Hợp chất Nồng độ (µg/ml) Pha động Bước sóng CGA 200 ACN - AcOH 1 % (gradient) 325 FA 200 ACN - dd AcOH 1% (17:83) 316 XAN 250 ACN - nước (50:50) 248 LIG 200 ACN - dd AcOH 1% (65:35) 328 Nhiệt độ 30ºC Cột Gemini NX C18 (150 x 4,6mm); 5 µm Tốc độ dòng 1 ml/phút Dữ liệu thẩm định cho thấy phương pháp đạt yêu cầu về tính đặc hiệu, tính tuyến tính, độ chính xác và độ đúng theo qui định ICH 3.3.2 Xây dựng tiêu chuẩn chất chuẩn đối chiếu Bảng 3-3: Tóm tắt tiêu chuẩn chất lượng 4 chất đối chiếu Chỉ tiêu CGA FA XAN LIG Mô tả/cảm quan Bột vô định hình màu trắng xám Bột vô định hình màu trắng xám Tinh thể hình kim, màu trắng Dung dịch màu vàng nhạt Định tính UV (λmax) 217 ± 2 nm, 334 ± 2 nm 216 ± 2 nm, 316 ± 2 nm 218 ± 2 nm, 248 ± 2 nm, 301 ± 2 nm 280 ± 2 nm, 328 ± 2 nm TLC Mẫu thử có màu và Rf trùng với mẫu chuẩn IR Phổ IR trùng với phổ IR của chất chuẩn HPLC Thời gian lưu trùng với đỉnh chuẩn Điểm chảy 204-210 °C 168-174 °C 146-148 °C NA Độ ẩm £ 5 % £ 5 % £ 5 % NA Định lượng ≥ 95 % ≥ 95 % ≥ 95 % ≥ 95 % Tạp chất liên quan £ 5 % £ 5 % £ 5 % £ 5 % -­‐  11  -­‐   3.3.3 Thiết lập chất chuẩn đối chiếu Bảng 3-4: Giá trị ấn định và độ không đảm bảo đo Hoạt chất Giá trị ấn định (%) Độ lệch chuẩn (s) Độ không đảm bảo đo U(x) CGA 98,19 0,684 0,200 FA 97,92 1,211 0,356 XAN 96,30 0,356 0,106 LIG 96,45 0,678 0,200 3.4 Định lượng đồng thời acid chlorogenic, scopoletin, acid ferulic, xanthotoxin và Z-ligustilid trong dược liệu. 3.4.1 Chọn lựa các chất theo tài liệu tham khảo Z-ligustilid và acid ferulic vì đóng vai trò trị liệu trong dược liệu, acid chlorogenic, xanthotoxin và z-ligustilid vì có hàm lượng cao trong dược liệu, acid chlorogenic và scopoletin vì có tác dụng hỗ trợ trị liệu và scopoletin và xanthotoxin vì có tính đặc trưng và xanthotoxin vì được cho là có độc tính (khi kết hợp với UV). 3.4.2 Chọn lựa phương pháp chiết xuất Chiết siêu âm trong 1 h, 10 ml MeOH cho 1 g dược liệu. 3.4.3 Thẩm định quy trình Điều kiện sắc ký Pha động: Hệ 2 dung môi ACN: AcOH 1%, gradient. Pha tĩnh: Cột Gemini NX C18 (150 x 4,6 mm); 5µm. Cài đặt hệ thống: nhiệt độ cột: 30 0C, tốc độ dòng 1 ml/min, detector 321 nm, thể tích tiêm: 10µl. -­‐  12  -­‐   Dữ liệu thẩm định cho thấy phương pháp đạt tất cả các yêu cầu về tính đặc hiệu, tính tuyến tính, độ chính xác và độ đúng theo qui định của ICH. 3.4.4 Ứng dụng quy trình khảo sát mẫu dược liệu Hình 3-1: So sánh tương quan hàm lượng các chất trong các dược liệu Đương quy khác nhau Nhận xét: Các điểm khác biệt về thành phần hoá học của rễ A. acutiloba và A. sinensis: 1.   Xanthotoxin và scopoletin có trong A. acutiloba nhưng không có trong A. sinensis, 2.   Hàm lượng acid ferulic và Z-ligustilid trong A. sinensis cao hơn trong A. acutiloba. 3.5 Phân tích carbohydrat 3.5.1 Chọn lựa, tối ưu hóa điều kiện chiết xuất Điều kiện chiết xuất: tỉ lệ nước: dược liệu = 10, tại 80 ºC trong thời gian 4 giờ 3.5.2 Định lượng polysaccharid toàn quy sang glucose bằng phương phápđo quang với thuốc thử phenol sulfuric -­‐  13  -­‐   Thực hiện phản ứng tạo dẫn xuất furan và tạo màu với phenol. Đo quang ở 490 nm. Dữ liệu thẩm định cho thấy phương pháp đạt tất cả các yêu cầu về tính đặc hiệu, tính tuyến tính, độ chính xác và độ đúng theo qui định của ICH. Bảng 3-5: Kết quả định lượng hàm lượng polysaccharid quy ra glucose Mẫu Độ hấp thụ Độ hấp thụ trung bình Nồng độ (mg/ ml) Hàm lượng nguyên trạng ĐQ Đắk Nông 0,4934 0,4934 0,0394 82.08 % 0,4933 ĐQ Đơn Dương 0,6823 0,6827 0,0547 88.23 % 0,6830 3.5.3 Tối ưu hóa phản ứng thủy phân Điều kiện tối ưu là 120 °C trong 1 giờ và nồng độ TFA 2 M 3.5.4 Định tính và định lượng đồng thời 8 monosaccharid cấu thành polysaccharid Pha động: Hệ 2 dung môi ACN: Amonium acetat 20 nM, gradient. Pha tĩnh: cột Gemini NX C18 (250 x 4,6 mm); 5 µm. Cài đặt hệ thống: nhiệt độ cột 25 ºC, tốc độ dòng 1 ml/phút, detector 245 nm, thể tích tiêm 10 µl. Dữ liệu thẩm định cho thấy phương pháp đạt tất cả các yêu cầu về tính đặc hiệu, tính tuyến tính, độ chính xác và độ đúng theo qui định của ICH. -­‐  14  -­‐   3.  5.5 Ứng dụng khảo sát định tính và định lượng monosaccharid cấu thành Hình 3-2: Thành phần và tỷ lệ monosaccharid trong các mẫu polysaccharid toàn phần Hình 3-3: Thành phần monosaccharid trong mẫu chưa thuỷ phân, mẫu PĐ20 sau thuỷ phân và mẫu chuẩn -­‐  15  -­‐   Hình 3-4: Thành phần monosaccharid trong mẫu chưa thuỷ phân, mẫu PĐ30 sau thuỷ phân và mẫu chuẩn 3.6 Tiêu chuẩn hoá dược liệu và đề xuất dự thảo nâng cấp chuyên luận Đương quy Nhật Bản di thực cho Dược điển Việt Nam 3.6.1 Tiêu chuẩn hóa Chọn lựa các tiêu chí kiểm nghiệm theo quy định của WHO và dược điển Xây dựng bảng điểm chọn marker Bảng 3-6: Xây dựng Bảng điểm đánh giá chọn lựa marker cho dược liệu Tiêu chí Điểm 1. Hoạt tính sinh học 1.1 Chưa có nghiên cứu về hoạt tính sinh học 0 1.2 Đã có nghiên cứu về hoạt tính 1.2.1 Không có hoạt tính sinh học 0 1.2.2 Có hoạt tính sinh học 1.2.2.1 Hoạt tính sinh học không/chưa có liên quan tác dụng trị liệu (trong y học cổ truyền và hiện đại). 1 1.2.2.2 Hoạt tính 1.2.2.2.1 Tác dụng trị liệu của chất được sử dụng 2 -­‐  16  -­‐   sinh học (nhóm trị liệu) sinh học có liên quan gián tiếp (chất hỗ trợ) tác dụng trị liệu (trong y học cổ truyền và hiện đại). không liên quan đến việc sử dụng trong y học cổ truyền/ y học hiện đại của dược liệu đó 1.2.2.2.2 Tác dụng trị liệu của chất được sử dụng liên quan đến việc sử dụng trong y học cổ truyền/ y học hiện đại của dược liệu đó 3 1.2.2.3 Hoạt tính sinh học có liên quan trực tiếp đến tác dụng trị liệu (trong y học cổ truyền và hiện đại). 1.2.2.3.1 Tác dụng trị liệu của chất được sử dụng không liên quan đến việc sử dụng trong y học cổ truyền/ y học hiện đại của dược liệu đó 4 1.2.2.3.2 Tác dụng trị liệu của chất được sử dụng liên quan đến việc sử dụng trong y học cổ truyền/ y học hiện đại của dược liệu đó 10 1.2.3 Có hoạt tính sinh học (nhóm độc tính) 1.2.3.1 Hoạt tính sinh học liên quan trực triếp đên độc tính của dược liệu đó 5 1.2.3.3 Hoạt tính sinh học không liên quan trực triếp đên độc tính của dược liệu đó 4 1.2.4 Nhóm điểm phụ sinh học Là chất có liên quan đến những chất có hoạt tính sinh học, hoạt tính trị liệu (tiền chất, sản phẩm hoặc chất chuyển hóa của một phản ứng hóa học hoặc enzym) ½* 2. Khả năng phân tích 2.1 Hàm lượng Hàm lượng thấp < 5 µg/g 1 Hàm lượng trung bình 5-50 µg/g 2 Hàm lượng cao > 50 µg/g 3 2.2. Tính Có tính chỉ điểm địa lý hoặc đặc trưng cho dưới loài 5 -­‐  17  -­‐   đặc trưng Đặc trưng cho loài trong chi 3 Đặc trưng cho chi 1 2.3 chất chuẩn Có sẵn 1 Chưa có 0 * ½ số điểm của nhóm chính Chọn marker dựa trên tài liệu tham khảo Bảng 3-7: Kết quả chọn marker dựa trên tài liệu tham khảo CGA SCO FA XAN LIG Đã được chọn làm marker cho dược liệu mang tên Đương Quy x x Có tác dụng trị liệu liên quan đến tác dụng trị liệu của dược liệu x x Tác dụng sinh học hỗ trợ tác dụng trị liệu x x Đã có thực hiện đánh giá chuẩn x x x x x Có thể chiết xuất, định tính định lượng được x x x x x Hàm lượng cao trong dược liệu x x x Có tính đặc trưng x Có độc tính x Nhận xét: Dựa trên Bảng 6, đưa ra 5 marker có khả năng là acid chlorogenic, acid ferulic, scopoletin, xanthotoxin, và Z-ligustilid. Chọn marker dựa trên thực nghiệm: xác định tính đặc trưng trên TLC và HPLC -­‐  18  -­‐   Bả ng 3 -8 : T ổn g k ế t k ết q u ả k h ả o sá t t ín h đặ c tr ưn g tr ên T LC v à H PL C Z- lig us til id H PL C + + + + - - - D ựa v ào t ha m k hả o tà i liệ u và t hự c ng hi ệm , ch ọn a ci d ch lo ro ge ni c, s co po le tin , ac id fe ru lic , xa nt ho to xi n và Z -li gu st lid đ ể ch ấm đ iể m . TL C + + + + - - - X an th ot o x in H PL C - + - - + - - TL C - + - - + - - A ci d fe ru lic H PL C + + + + + + + TL C - - - - - - - Sc op ol et in H PL C - + - - - - - TL C N D N D N D N D N D N D N D A ci d ch lo ro ge ni c H PL C + + + + + + + TL C N D N D N D N D N D N D N D Đ ỉn h / v ết An ge lic a si ne ns is An ge lic a ac ut ilo ba Le vi st ic um o ffi ci na le Li gu sti cu m w al ch ill i An ge lic a gi ga s An ge lic a da hu ri ca An ge lic a pu be sc en s -­‐  19  -­‐   Tổng kết kết quả chọn matker Bảng 3-9: Kết quả chấm điểm marker Đặc điểm CGA SCO FA XAN LIG Hoạt tính sinh hoc 2 2 10 11 10 Hóa học-phân tích 4 2 2 7 5 Cộng 6 4 12 18 15 Kết luận: Dựa trên điểm số, chọn xanthotoxin và Z-ligustilid làm marker Xác định mức chất lượng marker Đánh giá hàm lượng xanthotoxin và z-ligustild trên 6 vùng nguyên liệu Đak Nông, Đà Lạt, Đơn Dương, Quảng Nam và Lào Cai. Từ đó xác định mức chất lượng của xanthotoxin:”không được ít hơn 0,015%” và z-ligustilid :”Không được ít hơn 0,05%”. 3.6.2 Tóm tắt dự thảo đề xuất nâng cấp chuyên luận Đương quy Nhật Bản di thực Bảng 3-10: tóm tắt dự thảo chuyên luận Đương quy Nhật Bản di thực Chỉ tiêu Mức chất lượng Phương pháp Ghi chú 1 Mô tả Rễ chính ngắn và mập, dài 10-20 cm, đường kính 2 cm trở lên, có nhiều rễ nhánh dài 15-20 cm, đường kính 0,2 cm trở lên. Mặt ngoài màu nâu tối, có nhiều nếp nhăn dọc, nhiều sẹo lồi nằm ngang là vết tích của rễ con. Mặt cắt ngang màu trắng ngà có vân tròn và nhiều điểm tinh dầu. Chuyên luận Đương quy di thực, DĐVN 5 -­‐  20  -­‐   Mùi thơm hơi hắc, vị ngọt nhẹ, sau hơi cay nóng. 2 Soi bột Có nhiều hạt tinh bột hình tròn hay hình trứng nhỏ đứng riêng lẻ hay từng đám, đường kính từ 5-20 µm. Mảnh mạch mạng, mạch xoắn, mạch điểm. Mảnh mô mềm có nhiều hạt tinh bột, rải rác có các giọt dầu màu vàng nhạt. Chuyên luận Đương quy di thực, DĐVN 5 3 Định tính TLC So sánh với dược liệu chuẩn Chuyên luận Đương quy di thực, DĐVN 5 4 Mất khối lượng do làm khô £ 15 % Phương pháp sấy, Phụ lục 9.6, DĐVN 5. Tham khảo BP, EP 5 Tro không tan trong acid £ 4,5 % Phụ lục 9.7, DĐVN 5. 6 Tro toàn phần £ 7 % Phụ lục 9.8, DĐVN 5. Tham khảo JP 7 Tạp chất Thân lá hoa: £ 2 % Khác £ 1 % Chuyên luận Đương quy di thực, DĐVN 5 8 Chất chiết trong dược liệu ≥ 35 % Chuyên luận Đương quy di thực, DĐVN 5 9 Định lượng tinh dầu ≥ 0,1 % tinh dầu tính theo dược liệu khô Phụ lục 12.7, DĐVN 5. 10 Định lượng Bổ sung chỉ tiêu mới Xanthotoxin ≥ 0,15 mg/g dược liệu Theo dự thảo chuyên luận đề xuất Z-ligustilid ≥ 0.5 mg/g dược liệu -­‐  21  -­‐   3.7 Thiết lập chuẩn dược liệu Dược liệu được xác định tên khoa học bằng phương pháp giải trình tự gen ITS, kiểm tra đúng bộ phận dùng bằng vi phẫu và soi bột. Đánh giá chất lượng dược liệu theo dự thảo chuyên luận đề xuất. Bảng 3-11: Kết quả kiểm tra chất lượng dược liệu Chỉ tiêu và kết quả Yêu cầu Kết quả 1 Mô tả Như Bảng 3-10 Đúng 2 Soi bột Như Bảng 3-10 Đúng 3 Định tính TLC Như Bảng 3-10 Đúng 4 Mất khối lượng do làm khô £ 15 % Đạt (10,09 %) 5 Tro không tan trong acid £ 4,5 % Đạt (3,08 %) 6 Tro toàn phần £ 7 % Đạt (5,75 %) 7 Tạp chất Thân lá hoa: £ 2 % Khác £ 1 % Đạt (0 %) 8 Chất chiết từ dược liệu ≥ 35 % Đạt (37,49 %) 9 Định lượng tinh dầu ≥ 0,1 % tinh dầu tính theo dược liệu khô kiệt Đạt (0,1 %) 10 Định lượng (Tính trên dược liệu khô kiệt) Xanthotoxin ≥ 0,15 mg/g Đạt (0,26 mg/g) Z-ligustilid ≥ 0,5 mg/g Đạt (1,65 mg/g) Dược liệu đạt chất lượng được đóng lọ 5g/lọ và kiểm tra độ đồng nhất lọ, thiết lập hồ sơ dược liệu chuẩn và dán nhãn. -­‐  22  -­‐   KẾT LUẬN VÀ KIẾN NGHỊ Kết luận 1.   Đã mô tả thực vật, phân tích hoa và vi phẫu của Đương quy Nhật Bản trồng tại Việt Nam. a. Luận án đã chiết tách DNA của 17 mẫu dược liệu mang tên Đương quy, đã khuếch đại và giải trình tự các trình tự gen ITS, trnH-psbA, rbcL và matK và định danh 17 mẫu nghiên cứu. Đã phân tích và xác định trình tự phù hợp nhất để định danh dược liệu mang tên Đương quy. Đề xuất các trình tự tham chiếu ITS, trnH-psbA và matK cho dược liệu A. acutiloba. Đề xuất các bước để định danh dược liệu A. acutiloba bằng phương pháp giải trình tự gen dựa trên trình tự tham chiếu theo mô hình Dược điển Anh. 2.   Chiết xuất, tinh chế và xác định cấu trúc 11 hợp chất từ Đương quy Nhật Bản: (1) 3 hợp chất thuộc khung phthalid là Z-ligustilid, senkyunolid I, senkyunolid H, (2) 4 hợp chất thuộc khung furanocouarin là psoralen, xanthotoxin, bergapten và isopimpinellin, (3) 2 hợp chất phenylpropanoid là acid chlorogenic và acid ferulic (4) 2 flavonoid là rutin và isoquercitrin. Đây là báo cáo đầu tiên trên thế giới phân lập rutin và isoquercitrin từ cây Angelica acutiloba. 3.   Đã thiết lập 4 chuẩn đối chiếu hóa học (acid chlorogenic, acid ferulic, xanthotoxin và Z-ligustilid) từ rễ Đương quy Nhật Bản với bộ dữ liệu chuẩn bao gồm điểm chảy, phổ UV, IR, MS, NMR. Đã xây dựng quy trình đánh giá các chất chuẩn -­‐  23  -­‐   này được áp dụng tại Viện Kiểm nghiệm thuốc TP. Hồ Chí Minh. 4.   Xây dựng quy trình định lượng đồng thời 5 chất acid chlorogenic, acid ferulic, scopoletin, xanthotoxin và Z-ligustilid trong dược liệu Đương quy. Đã áp dụng quy trình để khảo sát 12 mẫu dược liệu mang tên Đương quy, trong đó có 7 mẫu dược liệu có nguồn gốc Trung Quốc và Nhật Bản, 5 mẫu có nguồn gốc trong nước. 5.   Luận án đã khảo sát phương pháp chiết xuất, thủy phân và định tính, định lượng các monosaccharid tạo thành polysaccharid trong dược liệu. Đã áp dụng quy trình để khảo sát monosaccharid tạo thành polysaccharid toàn phần trong 4 mẫu dược liệu và monosaccharid tạo thành trong 2 phân đoạn polysaccharid tách chiết. Từ đó tính tỷ lệ mol tạo thành trong carbohydrat toàn phần của các mẫu và các phân đoạn polysaccharid. 6.   Luận án đã xây dựng bảng điểm để đánh giá chọn lựa marker cho dược liệu dựa trên những yêu cầu của WHO. Đã áp dụng bảng điểm để chọn lựa và đề xuất 2 marker cho dược l

Các file đính kèm theo tài liệu này:

  • pdftom_tat_luan_an_tieu_chuan_hoa_duoc_lieu_duong_quy_nhat_ban.pdf
  • pdfCÔNG VĂN.pdf
  • pdfPHẠM THỊ MINH TÂM.pdf
  • docTTLA dua len mang 20220610.doc
Tài liệu liên quan