Luận văn Nghiên cứu sự lưu hành của virus cúm B tại miền bắc Việt Nam

MỤC LỤC

Trang phụ bìa

Lời cam đoan

Mục lục

Danh mục các chữ viết tắt

Danh mục các bảng

Danh mục các hình

MỞ ĐẦU . 1

CHƯƠNG 1 TỔNG QUAN . 3

1.1. VIRUS CÚM B . . 3

1.1.1. Đặc điểm chung . 3

1.1.2. Hình thái và cấu trúc virion của virus cúm B. 4

1.1.3. Cấu trúc phân tử của virus cúm B và chức năng . . 5

1.1.4. Cơ chế nhân lên của virus cúm B . . 8

1.2. SỰ LƯU HÀNH CỦA VIRUS CÚM B TRÊN THẾ GIỚI . 10

1.3. SỰ LƯU HÀNH CỦA VIRUS CÚM B TẠI VIỆT NAM . 12

1.4. SỰ TIẾN HÓA CỦA VIRUS CÚM B . . 13

1.5. BIỂU HIỆN LÂM SÀNG VÀ SINH BỆNH HỌC BỆNH CÚM. 14

1.5.1. Biểu hiện lâm sàng của bệnh cúm . 14

1.5.2. Sinh bệnh học bệnh cúm . 14

1.6. ĐIỀU TRỊ VÀ DỰ PHÒNG BỆNH CÚM .

1.6.1. Các thuốc kháng virus . . .

15

15

pdf100 trang | Chia sẻ: mimhthuy20 | Ngày: 24/09/2020 | Lượt xem: 86 | Lượt tải: 0download
Bạn đang xem trước 20 trang tài liệu Luận văn Nghiên cứu sự lưu hành của virus cúm B tại miền bắc Việt Nam, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
ợc giải trình tự của các máy tự động thì các mach ADN đơn sản sinh ra trong ống nghiệm phải được đánh dấu huỳnh quang để các vạch điện di của các mạch đơn này phát sáng khi đi qua một chùm tia sáng laser. Sự xuất hiện của các dideoxynucleotide (các nucleotide mất gốc -OH ở vị trí cacbon 3' và được thay bằng -H, đã được đánh dấu huỳnh quang với các màu khác nhau) trong quá trình tổng hợp ADN bổ sung (mẫu gen cần giải trình tự ở dạng ADN sợi đơn) tạo ra những đoạn ADN có độ dài khác nhau. Những đoạn ADN này được điện di qua mao quản từ nhỏ đến lớn và các dideoxynucleotide được phát hiện bởi đầu đọc laser. Trình tự gen của mẫu chính là trình tự bổ sung các dideoxynucleotide được phát hiện bởi đầu đọc laser [8]. Cấu tạo của một máy giải trình tự tự động gồm hai phần chính là phần điện di với gel polyacrylamide và phần phát hiện các vạch điện di. Phần điện di polyacrylamide là các ống mao quản chứa gel. Phần phát hiện vạch điện di là những con mắt cảm quang và một chùm tia laser đi qua trước nó. Trong suốt quá trình điện 32 di, mỗi khi có một vạch điện di đi qua chùm tia laser thì vạch điện di sẽ phát sáng lên và sự phát sáng này sẽ được con mắt cảm quang ghi nhận và lưu lại thành một đỉnh cường độ ánh sáng trong biểu đồ. Từ biểu đồ của các đỉnh cường độ sáng này, máy sẽ so dòng của các đỉnh tương ứng với các màu để cuối cùng phân tích thành trình tự của đoạn ADN. Phương pháp xác định trình tự gen đóng một vai trò quan trọng trong việc nghiên cứu đặc điểm di truyền học, so sánh giữa các gen của virus cúm để xây dựng cây gia hệ. Qua đó có thể xác định được tần suất tiến hóa, các đột biến trên một số gen liên quan đến khả năng tăng độc lực của virus, giảm độ nhạy của thuốc kháng virus và phát hiện các yếu tố tiềm tàng của sự trao đổi và tích hợp của các chủng virus cúm đang lưu hành. 33 Chương II ĐỐI TƯỢNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU 2.1. ĐỐI TƯỢNG NGHIÊN CỨU Đối tượng nghiên cứu là tổng số 115 chủng virus cúm B được phân lập từ bệnh phẩm lâm sàng thu thập trên bệnh nhân hội chứng cúm trong 3 năm (2010 - 2012) tại Hà Nội và các tỉnh miền Bắc Việt Nam. Các chủng virus cúm này được cung cấp bởi Phòng thí nghiệm Cúm - Viện Vệ sinh Dịch tễ Trung ương. 2.2. VẬT LIỆU 2.2.1. Chủng virus cúm B Các chủng phân lập virus cúm B được sử dụng trong nghiên cứu cần có hiệu giá virus đạt ≥ 8 đơn vị HA xác định bằng phương pháp ngưng kết hồng cầu (HA). 2.2.2. Sinh phẩm 2.2.2.1. Sinh phẩm sử dụng cho định týp virus Bộ sinh phẩm kháng huyết thanh chuẩn dùng trong phản ứng ngăn ngưng kết hồng cầu (HI) để định týp virus cúm được TCYTTG cung cấp hàng năm (2010 - 2012) tùy theo từng năm. Kháng nguyên chuẩn (reference antigens) Kháng huyết thanh chuẩn (reference antisera) A/H1N1 A/H1N1 A/H3N2 A/H3N2 B/Florida/4/2006 (B/Yamagata lineage) hoặc B/Wisconsin/01/2010 (B/Yamagata lineage) B/Florida/4/2006 (B/Yamagata lineage) hoặc B/Wisconsin/01/2010 (B/Yamagata lineage) B/Brisbane/60/2008 ( B/Victoria lineage) B/Brisbane/60/2008 ( B/Victoria lineage) 34 2.2.2.2. Sinh phẩm sử dụng cho phương pháp xác định trình tự gen - Uni 12 primer (CDC - Mỹ) - cADN SuperscriptIII Reverse Transcriptase, P/N 02321, Invitrogen - Hotstar Hifidelity Polymerase Kit, Cat No 202605, Qiagen - Bộ sinh phẩm tinh sạch sản phẩm PCR: Qiaquick PCR Purification kit 250, Cat.No. 28106, Qiagen và Qiaquick Gel Extraction kit 250, Cat.No. 28706, Qiagen. - Bộ sinh phẩm cho chu kỳ nhiệt tạo đoạn ADN gắn các dideoxynucleotide (Cycle sequencing): BigDye Terminator v3.1 Cycle Sequencing kit P/N: 4336917, ABI. - Bộ sinh phẩm tinh sạch sản phẩm đã gắn các dideoxynucleotide : Big Dye X Terminator Purification Kit, Cat. No. 4376486, ABI. - Hệ thống mồi: Tên mồi Trình tự HA-25F ATCCACAAAATGAAGGCA HA-36F GAAGGCAATAATTGTACT HA-482F GCAACAATGGCTTGGGC HA-660R TATCAGAGTGGAACCCC HA-760R GCCGCCAATCTGAGAAAC HA-1140R ACCAGCAATAGCTCCGAA NA-F1 AGCAGAAGCAGAGCATCTTCTCAA NA-560F CTCCATTTTCCACATGGCAGCTTG NA-620R ATTACTGTCAGGGCCATCAAC NA-1557R AGTAGTAACAAGAGCATTTTTCAGAAA 35 2.2.3. Trang thiết bị và dụng cụ 2.2.3.1. Trang thiết bị Trang thiết bị Hãng Phòng thí nghiệm an toàn sinh học cấp độ 2 Viện VSDTTƯ Tủ an toàn sinh học cấp độ 2 (Biosafety Cabinet - Class2) Bioquell - Anh Tủ ấm CO2 Jouan - Pháp Tủ lạnh 4oC, - 20oC và - 80oC Sanyo - Nhật Máy li tâm Rotofex - Mỹ Máy khuếch đại gen Biorad - Mỹ Máy phân tích trình tự gen ABI-3130 Avant Hitachi - Nhật Máy lắc (vortex) IKA - Malaysia 2.2.3.2. Dụng cụ - Phiến nhựa 96 giếng, đáy chữ U và đáy chữ V. - Pipet tự động vi lượng các loại từ 0,5µl đến 1000µl. - Pipet đa kênh các loại từ 20µl đến 300µl. - Đầu côn vô trùng các loại, có phin lọc từ 0,5µl đến 1000µl. - Tuýp eppendorf các loại từ 0,2ml đến 1,5ml. Và các dụng cụ thí nghiệm cần thiết khác. 2.3. PHƯƠNG PHÁP 2.3.1. Định týp virus bằng phản ứng ngăn ngưng kết hồng cầu (HI) 2.3.1.1. Chuẩn độ hiệu giá kháng nguyên bằng phản ứng ngưng kết hồng cầu (HA) 36 Phương pháp này được tiến hành trên phiến nhựa 96 giếng đáy chữ V (hồng cầu gà) hoặc phiến nhựa 96 giếng đáy chữ U (hồng cầu chuột lang).  Các bước tiến hành: (1) Chuẩn bị hồng cầu gà 0,5% hoặc hồng cầu chuột lang 0,75% trong dung dịch đệm PBS, pH 7,2. (2) Cho 50µl đệm PBS vào các giếng từ hàng thứ 2 đến hàng thứ 12. (3) Cho 100µl hỗn dịch nuôi cấy virus vào giếng đầu tiên. Trộn đều và chuyển 50µl hỗn dịch này sang giếng thứ 2, pha loãng bậc 2 hỗn dịch nuôi cấy virus từ hàng thứ 2 đến 12. Loại bỏ 50µl ở hàng cuối cùng. (4) Cho 50µl hồng cầu gà 0,5% hoặc hồng cầu chuột lang 0,75% vào toàn bộ 96 giếng. Lắc đều, ủ 30 phút (với hồng cầu gà) hoặc 60 phút (với hồng cầu chuột lang) ở nhiệt độ phòng.  Nhận định kết quả: Hiệu giá kháng nguyên là độ pha loãng cuối cùng của kháng nguyên gây ngưng kết hồng cầu hoàn toàn. Đó chính là một đơn vị ngưng kết hồng cầu của kháng nguyên, 50µl kháng nguyên 8 đơn vị hay 25µl kháng nguyên 4 đơn vị. 2.3.1.2. Định týp virus bằng phản ứng ngăn ngưng kết hồng cầu (HI)  Xử lý kháng huyết thanh chuẩn: Trước khi tiến hành phản ứng HI cần xử lý kháng huyết thanh chuẩn để loại bỏ những chất ức chế không đặc hiệu có trong kháng huyết thanh chuẩn. (1) Cho 1 thể tích kháng huyết thanh kết hợp với 3 thể tích dung dịch RDE (enzyme phá hủy các thụ thể-Recepter Destroying Enzyme). Ủ 37oC trong 18 giờ hoặc qua đêm. (2) Bất hoạt tại nhiệt độ 56oC trong vòng 30 phút. (3) Bổ sung 6 thể tích nước muối sinh lý NaCl 0,85% để kháng huyết thanh chuẩn được pha loãng 1/10.  Các bước tiến hành: 37 (1) Cho 25µl đệm PBS vào các giếng từ hàng B tới hàng H (trừ cột 6 và cột 12) của tấm nhựa 96 giếng. Cột 6 và cột 12 cho 50µl đệm PBS. (2) Cho 50µl kháng huyết thanh chuẩn đã xử lý vào hàng A (trừ các giếng A6, A12) (3) Hút từ hàng A chuyển xuống hàng B 25µl kháng huyết thanh chuẩn và bắt đầu pha loãng bậc 2 từ hàng B tới hàng H, tại hàng H bỏ đi 25µl. Cột 6 và cột 12 giữ nguyên. (4) Cho thêm 25µl kháng nguyên 4 đơn vị HA thích hợp (dịch nuôi cấy tế bào và chứng dương) vào các giếng tương ứng. Lắc nhẹ để kháng nguyên và kháng huyết thanh tiếp xúc với nhau rồi để ủ ở nhiệt độ phòng trong 1h. (5) Cho 50µl hồng cầu gà 0,5% hoặc hồng cầu chuột lang 0,75% vào tất cả các giếng. Lắc nhẹ, để ở nhiệt độ phòng trong 1 giờ.  Nhận định kết quả: - Phản ứng đọc được khi: + Kháng huyết thanh chuẩn: ngăn ngưng kết hoàn toàn. + Chứng hồng cầu: ngăn ngưng kết hoàn toàn. - Hiệu giá ức chế ngưng kết hồng cầu của chủng virus: là giá trị tại độ pha loãng cao nhất của kháng huyết thanh chuẩn và chủng virus gây nên hiện tượng ngăn ngưng kết hồng cầu. - Phân týp của virus được xác định tại kháng huyết thanh chuẩn cho hiệu giá ngăn ngưng kết hồng cầu cao nhất. 2.3.2. Giải trình tự gen 2.3.2.1. Tách chiết vật liệu di truyền từ chủng virus cúm phân lập được Sử dụng bộ sinh phẩm tách chiết ARN: QIAamp viral RNA Mini Kit, 250 preps, Cat No 52904, Qiagen. Các bước thực hiện tách chiết theo thường quy bộ sinh phẩm như sau: 38 (1) Trộn đều 140µl mẫu (dịch nổi phân lập thu hoạch được) với 560µl đệm AVL. Ủ tại nhiệt độ phòng trong 10 phút. (2) Thêm 560µl Ethanol tuyệt đối (100%) vào hỗn dịch trên, lắc đều bằng máy vortex rồi li tâm nhẹ. (3) Đặt cột QIAamp spin vào tuýp li tâm 2ml sạch. Chuyển 630µl hỗn dịch trên vào cột QIAamp spin. Li tâm 8000 vòng/phút/1 phút. Loại bỏ tuýp li tâm. Sau đó lặp lại bước (3). (4) Đặt cột QIAamp spin vào tuýp li tâm 2ml sạch, rửa cột QIAamp spin bằng 500µl dung dịch đệm AW1, li tâm 8000 vòng/phút/1 phút. Loại bỏ tuýp li tâm. (5) Đặt cột QIAamp spin vào tuýp li tâm 2ml sạch, tiếp tục rửa cột QIAamp spin bằng 500µl dung dịch đệm AW2, li tâm 14000 vòng/phút/3 phút. Loại bỏ dung dịch trong tuýp li tâm. (6) Đặt cột QIAamp spin vào tuýp li tâm vừa được loại bỏ dung dịch. Li tâm 14000 vòng/phút/1 phút. Loại bỏ tuýp li tâm. (7) Đặt cột QIAamp spin vào tuýp eppendorf 1,5ml sạch. Cho 60µl dung dịch đệm AVE vào chính giữa màng lọc của cột, ủ tại nhiệt độ phòng trong 1 phút, li tâm 8000 vòng/phút/1 phút. Loại bỏ cột QIAamp spin. Phần dung dịch thu được trong tuýp li tâm chính là ARN của chủng virus thu thập được. (8) Bảo quản ARN tại -20oC hoặc -80oC. 2.3.2.2. Tổng hợp sợi ADN bổ sung (cDNA) Với những đoạn gen có kích thước > 1000bp, cần phải tổng hợp sợi ADN bổ trợ sau đó mới thực hiện phương pháp PCR. Hôn hợp 1 Thành phần Thể tích(µl) Mồi Uni 12 (10µM) 5 dNTP (10µM) 1 39 ARN 10 Tổng 16 Ủ hỗn hợp này ở 65oC / 5 phút. Giữ lạnh ngay trong đá. Hỗn hợp 2 Thành phần Thể tích(µl) Buffer 5x 5 DTT (0,1M) 1 RNase inhibitor 1 SuperSriptIII (200U/µl) 1 Tổng 8 Trộn hỗn hợp 1 và hỗn hợp 2 rồi ủ 50oC/45 phút, 70oC/15 phút. 2.3.2.3. Thực hiện PCR Sử dụng bộ sinh phẩm Hotstar Hifidelity Polymerase Kit, Cat No 202605, Qiagen. Thành phần Thể tích(µl) Đệm 5x 10 Mồi xuôi (100pmol) 0,5 Mồi ngược (100pmol) 0,5 Hifi Taq polymerase 2 Nước cất tinh khiết 31 40 cADN 6 Tổng 50 Mồi sử dụng trong phản ứng này là: Tên mồi Trình tự HA-25F ATCCACAAAATGAAGGCA HA-1140R ACCAGCAATAGCTCCGAA NA-F1 AGCAGAAGCAGAGCATCTTCTCAA NA-1557R AGTAGTAACAAGAGCATTTTTCAGAAA Chu kỳ nhiệt: (1) 95oC trong 5 phút (2) 94oC 15 giây lặp lại (2) 35 lần 50 o C 1 phút 68 o C 2 phút (3) 68oC 10 phút (4) 10oC ∞ Điện di sản phẩm PCR: Sử dụng thạch 1% và thang trọng lượng phân tử 1kb (Hãng Promega). 2.3.2.4. Tinh sạch sản phẩm PCR Tinh sạch sản phẩm PCR nhằm loại bỏ những sinh phẩm và mồi thừa trong quá trình PCR để tránh gây nhiễu trong quá trình giải trình tự. 41 Nếu sản phẩm PCR sau điện di cho kết quả đặc hiệu: sử dụng bộ sinh phẩm Qiaquick PCR Purification kit 250, Cat.No. 28106, Qiagen để tinh sạch. Thành phần của bộ Kit: + Cột Quiquick 250 chiếc + Đệm PB 150ml + Đệm PE 55ml + Đệm EB 15ml + Tuýp 2 ml: 250 chiếc Trước khi tiến hành tinh sạch, cần thêm 220ml cồn tuyệt đối (96 - 100%) vào đệm PE. Các bước tiến hành: (1) Trộn 5 thể tích đệm PB vào 1 thể tích sản phẩm PCR đã có. (2) Dùng pipet chuyển toàn bộ hỗn dịch đã trộn ở bước (1) vào cột Qiaquick đặt trong tuýp 2ml, li tâm 13000 vòng/phút/1 phút. (3) Loại bỏ dung dịch ở tuýp 2ml, đặt lại cột vào tuýp. (4) Dùng pipet hút 750µl đệm PE cho vào cột Qiaquick để rửa ADN, li tâm 13000 vòng/phút/1 phút. (5) Loại bỏ dung dịch rửa ở tuýp 2ml, đặt lại cột vào tuýp, li tâm 13000 vòng/phút/1 phút để đảm bảo loại bỏ hoàn toàn dung dịch rửa. (6) Chuyển cột Qiaquick sang tuýp eppendorf 1,5ml sạch đã chuẩn bị sẵn. (7) Cho 30µl đệm EB vào chính giữa màng lọc của cột Qiaquick, ủ tại nhiệt độ phòng trong 1 phút, li tâm 13000 vòng/phút/1phút. Sản phẩm thu được chính là ADN đã được tinh sạch. ADN sau khi tinh sạch giữ ở - 20 oC đến -80oC. Nếu sản phẩm PCR sau khi điện di không cho kết quả đặc hiệu: Sử dụng bộ sinh phẩm Qiaquick Gel Extraction kit 250, Cat.No. 28706, Qiagen. 42 Thành phần bộ Kit: + Cột Qiaquick 250 chiếc + Đệm QG 150ml + Đệm PE 55ml + Đệm EB 15ml + Tuýp 2ml 250 chiếc Trước khi tiến hành tinh sạch cần thêm 220ml cồn tuyệt đối (96-100%) vào đệm PE trước khi sử dụng. Các bước tiến hành: (1) Cắt băng sản phẩm cần giải trình tự trên thạch 1% đã điện di (dưới đèn chiếu tia cực tím) (2) Cân trọng lượng thạch chứa băng sản phẩm. Cho 3 lần thể tích dung dịch đệm QG vào 1 lần thể tích thạch (100µg ≈ 100µl) (3) Ủ tại 50oC trong 10 phút cho tới khi thạch tan hết trong dung dịch đệm QG. Để thạch có thể tan nhanh hơn có thể lắc tuýp bằng máy lắc sau mỗi 2-3 phút ủ. (4) Đặt cột Qiaquick vào tuýp 2ml. (5) Dùng pipet chuyển 750µl hỗn dịch ở bước (3) sang cột Qiaquick, li tâm 13000 vòng/phút/1 phút. (6) Loại bỏ dung dịch ở tuýp 2ml, đặt lại cột vào tuýp. (7) Lặp lại bước (5) và (6) cho tới khi hết hỗn dịch ở bước (3). (8) Dùng pipet chuyển 500µl dung dịch đệm QG vào cột Qiaquick, li tâm 13000 vòng/phút/1 phút. (9) Dùng pipet chuyển 750µl dung dịch đệm PE vào cột Qiaquick, li tâm 13000 vòng/phút/1 phút. (10) Loại bỏ dung dịch ở tuýp 2ml, đặt lại cột vào tuýp, li tâm 13000 vòng/phút/1 phút. 43 (11) Chuyển cột Qiaquick sang tuýp 1,5ml sạch (12) Cho 30µl đệm EB vào chính giữa màng lọc của cột Qiaquick để thu ADN, ủ tại nhiệt độ phòng trong 1 phút, li tâm 13000 vòng/phút/1 phút. ADN sau khi tinh sạch giữ ở -20oC đến -80oC. 2.3.2.5. Chu trình nhiệt tạo đoạn ADN gắn các dideoxynucleotide (Cycle sequencing) Sử dụng bộ sinh phẩm Bigdye Terminator v3.1 Cycle Sequencing kit P/N: 4336917, ABI. Thành phần Thể tích (µl) Đệm 5x 3 BDX 64 1,5 Bigdye 1/3 1,5 Mồi (3.2 pmol) xuôi hoặc ngược 1 Sản phẩm ADN đã tinh sạch 2 Nước cất tinh khiết 11 Tổng số 20 Chu kỳ nhiệt: (1) 96oC trong 3 phút (2) 96 oC 10 giây lặp lại (2) 35 lần 50 o C 5 giây 60 o C 2 phút (3) 4 oC ∞ 44 2.3.2.6. Tinh sạch sản phẩm sau khi chạy chu trình nhiệt gắn dideoxynucleotide Mục đích: Loại bỏ những dideoxynucleotide và sinh phẩm còn thừa sau khi chạy chu trình nhiệt gắn dideoxynucleotide, tránh tín hiệu nhiễu trong quá trình giải trình tự. Sử dụng bộ sinh phẩm Big Dye X Terminator Purification Kit, Cat. No. 4376486, ABI. Thành phần: XTerminator Solution 9ml SAM Solution 2ml Các bước tiến hành: (1) Dùng pipet hút 45µl SAM Solution vào tuýp 0,2 ml đặt trên giá PCR 96 giếng. (2) Dùng pipet và đầu côn cắt hút 10µl XTerminator Solution cho tiếp vào tuýp trên. (3) Dùng pipet hút 10µl sản phẩm sau khi chạy chu trình nhiệt gắn dideoxynucleotide cho tiếp vào tuýp trên. (4) Dùng giấy bạc bọc giá PCR 96 giếng này lại, lắc đều trong 30 phút bằng máy vontex. (5) Li tâm nhẹ trong 5 phút. Hút 20µl sản phẩm tinh sạch sang phiến 96 giếng, tránh không để đầu côn chạm vào thành tuýp hay đáy tuýp. (6) Chuyển phiến 96 giếng vào máy. (7) Cài đặt chương trình, tạo tệp dữ liệu và bắt đầu chạy máy. 2.3.3. Phương pháp phân tích kết quả và xử lý số liệu  Sử dụng phần mềm DNAstar: chỉnh sửa các tín hiệu lỗi, nối các đoạn nucleotide lại với nhau tạo thành một gen hoàn chỉnh. 45  Sử dụng phần mềm BioEdit: So sánh các đoạn gen của virus cúm B tại Miền Bắc Việt Nam năm 2010-2012 với các virus cúm B lưu hành trong khu vực và trên thế giới.  Sử dụng phần mềm Mega 4 [53]: Xây dựng cây gia hệ của các gen HA của virus Cúm B tại Miền Bắc Việt Nam năm 2010-2012: sử dụng phương pháp ước tính khả năng chênh lệch tối đa (maximum likelihood) thông qua mô hình NJ (Neighbor-Joining). Trình tự của các chủng vắc xin được sử dụng làm gốc của cây gia hệ được lấy từ GenBank. 46 Chương 3 KẾT QUẢ VÀ BÀN LUẬN 3.1. KẾT QUẢ PHÂN LẬP VÀ KHUẾCH ĐẠI CÁC CHỦNG VIRUS CÚM B TẠI MIỀN BẮC VIỆT NAM, 2010-2012 3.1.1. Sự lưu hành của virus cúm B tại miền Bắc Việt Nam, 2010 - 2012 Tại Việt Nam, Chương trình giám sát cúm Quốc gia được triển khai từ năm 2006 do sự tài trợ của Trung tâm phòng chống và kiểm soát bệnh tật Hoa Kỳ (CDC) tại 4 vùng là miền Bắc, miền Trung, miền Nam và Tây Nguyên với mục đích xác định sự lưu hành của các phân týp virus cúm bằng phản ứng RT-PCR. Tại miền Bắc Việt Nam từ năm 2010 đã triển khai 4 điểm giám sát bệnh nhân hội chứng cúm (ILI): Bệnh viện Nhi Trung Ương, Trung tâm Y tế huyện Cao Lộc - Lạng Sơn, Trung tâm Y tế huyện Kiến Xương - Thái Bình, Phòng khám đa khoa Thanh Xuân - Hà Nội. Trong giai đoạn nghiên cứu, 2010 - 2012, sự lưu hành của virus cúm B được quan sát theo số liệu của chương trình Giám sát cúm Quốc gia tại các điểm nghiên cứu như sau: 47 Hình 3.1. Sự lưu hành của virus cúm B tại miền Bắc Việt Nam, 2010 - 2012 Nguồn: Chương trình Giám sát Cúm Quốc gia- Viện Vệ sinh Dịch tễ Trung Ương Thông qua Dự án Giám sát Cúm Quốc gia được triển khai tại Việt Nam với sự phối hợp của Viện Vệ sinh Dịch tễ Trung ương và Trung tâm phòng chống và kiểm soát bệnh tật Hoa Kỳ (CDC) từ năm 2006 đến nay cho thấy virus cúm B được quan sát thấy hàng năm, cùng với 2 loại virus cúm mùa khác là A/H1N1 và A/H3N2, virus cúm B lưu hành quanh năm tại Việt Nam, trong đó virus cúm B thường tập trung lưu hành chủ yếu vào mùa đông xuân (tháng 2 - 3). 3.1.2. Kết quả phân lập virus cúm B tại miền Bắc Việt Nam, 2010 - 2012 Virus cúm B cùng với các virus cúm mùa khác là A/H1N1 và A/H3N2 được tiến hành phân lập trong phòng thí nghiệm an toàn cấp độ 2 và sử dụng dòng tế bào 0 5 10 15 20 25 30 T ỷ l ệ % Năm Tỷ lệ % bệnh nhân ILI dương tính với virus cúm B, Việt Nam 2006– 2012, N=37,636 B 48 cảm thụ MDCK. MDCK là dòng tế bào thích hợp nhất để phân lập virus cúm B trên người do virus cúm B có khả năng thích ứng tốt nhất trên dòng tế bào này. Bảng 3.1. Kết quả phân lập virus cúm B tại Miền Bắc Việt Nam, 2010 - 2012 Trong tổng số 397 mẫu bệnh phẩm được xác định là dương tính với virus cúm B trong 3 năm (2010 - 2012) đã phân lập được 115 chủng virus cúm B (29,0%), trong đó số mẫu dương tính phân lập của năm 2010 chiếm tỉ lệ thấp hơn hẳn so với năm 2011 và 2012, mặc dù số mẫu dương tính với virus cúm B trong năm 2010 là cao nhất. Kết quả của phương pháp phân lập virus phụ thuộc rất nhiều vào chất lượng bệnh phẩm, điều kiện bảo quản cũng như kỹ năng phân lập. Trong năm 2011, 2012 điều kiện và kỹ năng phân lập đã được nâng cao, do đó đã làm tăng tỷ lệ phân lập từ 7,5% năm 2010 lên 43,4% và 40,1% vào năm 2011 và 2012. Phân lập virus được coi là “tiêu chuẩn vàng” trong chẩn đoán nhiễm virus cúm [17]. Bên cạnh những nhược điểm như quy trình phân lập virus đòi hỏi nhiều thời gian (3 tuần) cũng như phụ thuộc rất nhiều vào chất lượng bệnh phẩm, vì vậy tỷ lệ dương tính sẽ không cao. Phương pháp này cũng có những ưu điểm như cho phép tìm hiểu đặc điểm di truyền cũng như đặc tính kháng nguyên - hệ quả của quá trình tiến hóa của virus cúm [7]. Chủng virus phân lập được phục vụ cho việc nghiên cứu về các đặc điểm sinh học cũng như sự biến đổi di truyền và tính chất kháng nguyên, từ đó có thể dự đoán được sự lan truyền của một chủng virus mới có Năm Số mẫu có hội chứng cúm Số mẫu phân lập được Tỷ lệ (%) 2010 147 11 7,5 2011 113 49 43,4 2012 137 55 40,1 Tổng số 397 115 29,0 49 độc lực cao trong giai đoạn tiếp theo và lựa chọn thành phần vắc xin cúm hàng năm phù hợp. 3.2. ĐẶC TÍNH KHÁNG NGUYÊN CỦA VIRUS CÚM B, 2010-2012 Đặc tính kháng nguyên của virus cúm được quyết định bởi những thay đổi trong vật liệu di truyền tại một số vị trí đặc biệt trên gen HA. Đặc tính kháng nguyên của virus quyết định hiệu quả bảo vệ của vắc xin phòng chống virus và được thể hiện rất rõ trong lịch sử phát triển của vắc xin cúm trong hơn 50 năm qua. Thông thường đặc tính kháng nguyên của virus được xác định thông qua khả năng tương tác với các kháng huyết thanh chuẩn (reference antisera) được sản xuất từ các chủng dự tuyển vắc xin thông qua phản ứng ngăn ngưng kết hồng cầu (HI). Các chủng virus cúm B phân lập được từ các bệnh nhân hội chứng cúm (ILI) từ năm 2010-2012 tại Miền Bắc Việt Nam có hiệu giá HA ≥ 8 sẽ được xác định đặc tính kháng nguyên bằng phản ứng ngăn ngưng kết hồng cầu (HI) sử dụng kháng huyết thanh chuẩn do TCYTTG cung cấp hàng năm (bảng 3.2). Bảng 3.2. Kết quả định týp virus cúm B bằng phương pháp HI, 2010- 2012 Năm Dòng kháng nguyên 2010 2011 2012 Tổng n % n % n % B/Victoria/2/87 9 81,8 41 83,7 22 40,0 65 B/Yamagata/16/88 2 18,2 8 16,3 33 60,0 50 Tổng số 11 100 49 100 55 100 115 50 Hình 3.2. Tỷ lệ lưu hành 2 dòng kháng nguyên virus cúm B theo năm Tại Việt Nam, khác với virus cúm A là xuất hiện xen kẽ giữa các năm với phân týp khác nhau (A/H1N1, A/H3N2), virus cúm B xuất hiện hàng năm và đều có sự lưu hành đồng thời 2 dòng kháng nguyên B/Yamagata/16/88 và B/Victoria/2/87, trong đó sẽ có một dòng kháng nguyên chiếm ưu thế. Mùa cúm năm 2007-2008, dòng B/Yamagata chiếm ưu thế; năm 2009 được thay thế bằng dòng Victoria (theo số liệu Giám sát Cúm Quốc gia). Trong nghiên cứu của chúng tôi, 2010-2012, dòng kháng nguyên B/Victoria chiếm ưu thế trong 2 năm 2010 và 2011 với tỷ lệ gần như ngang bằng nhau (81,8% và 83,7%) và giảm dần vào năm tiếp theo (40% năm 2012). Thay vào đó, dòng kháng nguyên B/Yamagata năm 2010, 2011 có tỷ lệ thấp (18,2% và 16,3%), và dần chiếm ưu thế vào năm 2012 với tỷ lệ 60% (hình 3.2). Kết quả này phù hợp với quy luật lưu hành của virus cúm B là 2 dòng kháng nguyên virus cúm B gồm có B/ Victoria và B/Yamagata thay phiên nhau chiếm ưu thế trong 2-3 năm. 18.2 16.3 60 81.8 83.7 40 0 20 40 60 80 100 120 B/Yamagata/16/88 B/Victoria/2/87 2010 2011 2012 51 Tỷ lệ này chỉ dựa trên những chủng vius phân lập và khuếch đại được với hiệu giá HA ≥ 8 (115/397 mẫu, chiếm tỷ lệ 29,0%). Số mẫu dương tính với RT- PCR nhưng phân lập không thành công hoặc hiệu giá HA ≤ 8 còn lại (chiếm tỷ lệ 71%) không cho phép phân tích được đặc tính kháng nguyên. Tuy nhiên kết quả so sánh về tỷ lệ lưu hành của 2 dòng cúm B trong giai đoạn này vẫn mang tính đại diện cao, phù hợp với quy luật lưu hành của virus cúm B tại các nước Đông Nam Á. Bảng 3.3. Hiệu giá HI của các chủng virus cúm B, 2010-2012 Dòng kháng nguyên Hiệu giá HI 2010 (n) 2011 (n) 2012 (n) Tổng n % B/Victoria ≥160 9 34 19 62 86,1 80 0 5 2 7 9,7 ≤40 0 2 1 3 4,2 Tổng 9 41 22 72 100 B/Yamagata ≥ 320 2 4 18 24 55,8 160 0 3 7 10 23,3 ≤80 0 1 8 9 20,9 Tổng 2 8 33 43 100 Bảng 3.3 cho thấy, trong dòng kháng nguyên B/Victoria, tỷ lệ chủng virus có hiệu giá HI ≥ 160 khi tương tác với kháng huyết thanh tạo ra từ chủng virus vắc xin dự tuyển B/Brisbane/60/2008, tương đương với hiệu giá chuẩn, là 86,1% (62/72 chủng). Trong khi đó, tỷ lệ này ở dòng B/Yamagata là 55,8% (24/43 chủng) với hiệu giá HI ≥ 320. Tỷ lệ hiệu giá HI của các chủng virus thấp hơn 1-2 bậc so với hiệu giá chuẩn của dòng B/Victoria là 9,7% và 4,2%, thấp hơn so với dòng B/Yamagata là 23,3 và 20,9%. Điều này cho thấy hiệu quả bảo vệ của vắc xin có chủng virus cúm B/Victoria với chủng virus thuộc dòng B/Victoria lưu hành tại Việt Nam cao hơn so với các chủng B/Yamagata. 52 Bảng 3.4. So sánh hiệu giá HI giữa hai dòng B/Victoria và B/Yamagata Năm Mã số PTN Kết quả HI Kết quả định týp Kháng huyết thanh chuẩn Dòng B/Yamagata Dòng B/Victoria 2010 TX 72 320 >640 B/ Victoria TX 73 160 >640 B/ Victoria TX 121 160 640 B/ Victoria N 101 80 >640 B/ Victoria N131 80 >640 B/ Victoria N121 >640 160 B/Yamagat a 2011 N32 80 >640 B/ Victoria N361 80 160 B/ Victoria N373 ≥1280 40 B/Yamagat a 2012 N15 80 ≥1280 B/ Victoria N22 80 160 B/ Victoria N27 80 160 B/ Victoria Để tìm hiểu khả năng bảo vệ chéo giữa 2 dòng kháng nguyên, chúng tôi lựa chọn các chủng đã được xác định đặc tính kháng nguyên bằng phản ứng HI có kháng thể bảo vệ chéo với dòng kháng nguyên còn lại với hiệu giá kháng thể bằng hoặc thấp hơn từ 1 đến 2 bậc pha loãng. Đối với các chủng B/Victoria có hiệu giá 53 tương đương với chủng chuẩn là HI ≥160 và B/Yamagata là HI ≥320, chúng tôi sẽ lựa chọn những chủng thuộc dòng B/Vitoria có hiệu giá với kháng huyết thanh chuẩn dòng B/Yamagata là HI= 320, 160 và 80 hoặc ngược lại những chủng thuộc dòng B/Yamagata có hiệu giá với kháng huyết thanh chuẩn dòng B/Victoria là HI=160, 80 và 40. Kết quả đã xác định được 6 chủng năm 2010, 3 chủng năm 2011 và 3 chủng năm 2012 (bảng 3.4). Như vậy, khi lựa chọn một trong 2 dòng kháng nguyên trong thành phần vắc xin cúm 2010-2012, tỷ lệ nhóm được bảo vệ với dòng kháng nguyên còn lại là 12/115 (10,4%). Bảng 3.5. So sánh kháng nguyên virus cúm B tại Miền Bắc Việt Nam với thành phần vắc xin cúm tại Bắc và Nam Bán cầu theo khuyến cáo của TCYTTG, 2010-2012 Mùa cúm Dòng KN Nam Bán cầu Bắc Bán cầu Miền Bắc Việt Nam 2010/ 2011 B/Victoria B/Brisbane/60/2008- like virus B/Brisbane/60/2008- like virus B/ Brisban/60/2008 -like

Các file đính kèm theo tài liệu này:

  • pdfluanvanthacsi_chuaphanloai_372_6223_1870238.pdf
Tài liệu liên quan