Luận văn Nghiên cứu tác dụng chống lại vi khuẩn kháng kháng sinh (Moraxella catarrhalis) gây nhiễm đường hô hấp trên ở người của dịch lên men quả táo mèo (Docynia indica)

MỞ ĐẦU

Chương 1: TỔNG QUAN TÀI LIỆU

1.1 BỆNH NHIỄM KHUẨN HÔ HẤP Ở NGƯỜI

1.2 Moraxella catarrhalis VÀ BỆNH VIÊM ĐƯỜNG HÔ HẤP TRÊN

1.2.1 Đặc điểm hình thái và nuôi cấy

1.2.2 Vai trò của M.catarrhalis trong bệnh nhiễm khuẩn hô hấp

1.2.3 Tính kháng kháng sinh của M. catarrhalis

1.3 CHẤT KHÁNG SINH

1.3.1 Khái niệm

1.3.2 Chất kháng sinh có nguồn gốc từ vi khuẩn

1.3.3 Chất kháng khuẩn thực vật

1.3.4 Cơ chế kháng khuẩn

1.4 CÂY TÁO MÈO VÀ DỊCH CHIẾT TỪ QUẢ TÁO MÈO

1.4.1 Đặc điểm thực vật học

1.4.2 Sự phân bố

1.4.3 Tác dụng dược lý

14.4 Thành phần hóa học

1.4.5 Tình hình nghiên cứu táo mèo

Chương 2 NGUYÊN LIỆU VÀ PHƯƠNG PHÁP

2.1 NGUYÊN LIỆU

2.1.1 Nguồn giống

2.1.2 Hóa chất và thiết bị

 

docx64 trang | Chia sẻ: mimhthuy20 | Ngày: 22/09/2020 | Lượt xem: 85 | Lượt tải: 0download
Bạn đang xem trước 20 trang tài liệu Luận văn Nghiên cứu tác dụng chống lại vi khuẩn kháng kháng sinh (Moraxella catarrhalis) gây nhiễm đường hô hấp trên ở người của dịch lên men quả táo mèo (Docynia indica), để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
ổ kháng khuẩn và cơ chế tác động. Tập hợp các gen cấu trúc, gen điều hòa sinh tổng hợp bacteriocin ở vi khuẩn rất đa dạng, cớ thể nằm trong hệ gen hoặc plasmit hoặc trong cả transposon. Bacteriocin được phân chia thành 2 nhóm lớn là bacteriocin của vi khuẩn Gram âm và bacteriocin của vi khuẩn Gram dương [45]. Vi khuẩn Gram dương tổng hợp bacteriocin phong phú và đa dạng hơn nhiều so với vi khuẩn Gram âm. Đa phần các bacteriocin có phổ kháng khuẩn không rộng, chủ yếu ức chế hoặc tiêu diệt các vi khuẩn khác có mối quan hệ gần gũi hoặc tương đồng, có sự cạnh tranh trực tiếp về nơi sống và nguồn dinh dưỡng [39]. Phổ kháng khuẩn của bacteriocin của vi khuẩn Gram dương rộng hơn so với của vi khuẩn Gram âm. Bảng 1.4 So sánh bacteriocin và chất kháng sinh dùng trong y tế [14] Đặc tính Bacteriocin Kháng sinh Tổng hợp Từ ribosom Sản phẩm trao đổi chất bậc 2 Hoạt tính Phổ hẹp Phổ đa dạng Miễn dịch tế bào chủ Có Không Cơ chế tác động tế bào đích Ảnh hưởng tới kết cấu màng tế bào Tùy thuộc phương thức hoạt động, ảnh hưởng tới yếu tố phiên mã di truyền. Yêu cầu tương tác Đôi khi cần cắt ngắn phân tử Đích đặc hiệu Phương thức hoạt động Hầu hết là tạo lỗ trên màng tế bào chất (một số ít có thể ảnh hưởng đến sinh tổng hợp thành tế bào) Màng tế bào hoặc các đích nội bào Độc tính/tác dụng phụ Chưa thấy Có 1.3.3 Chất kháng khuẩn thực vật Từ thời cổ đại, con người đã biết dùng thực vật làm thuốc chữa bệnh, trong những năm gần đây, ngành dược phẩm và các nhà khoa học đã dành mối quan tâm lớn đến dược liệu và phân tích thành phần kháng sinh thực vật bổ sung vào nguồn kháng sinh nhằm khắc phục tình trạng kháng thuốc hiện nay, đem lại những sản phẩm với giá thành thấp hơn. Ước tính có 14- 28% các loài thực vật được sử dụng làm dược liệu trong y học và 74% đã được phát hiện có hoạt tính sinh học [31]. 1.3.3.1 Khái niệm Kháng khuẩn thực vật là tên gọi chung chỉ các hợp chất hữu cơ có trong thực vật có tác dụng tiêu diệt hay kìm hãm sự phát triển của vi sinh vật. Các chất kháng khuẩn thường có tác dụng đặc hiệu lên các loài vi sinh vật khác nhau ở nồng độ thường rất nhỏ [50]. Những tính chất này có thể thuộc nhiều cấu trúc hóa học khác nhau như: ankaloit, tannin, flavonoit, tinh dầu... 1.3.3.2 Khái quát lịch sử nghiên cứu Trên trái đất ước tính có từ 250.000 đến 500.000 loài thực vật [25], nhưng chỉ một tỷ lệ tương đối nhỏ (1- 10%) trong số này được sử dụng như thực phẩm cho cả con người và động vật. Thực vật cũng được sử dụng như là nguồn dược liệu quý giá cho con người từ ngàn xưa. Vào cuối thế kỷ thứ V trước Công nguyên, Hippocrates đã đề cập 300 đến 400 dược liệu từ thực vật. Theo Moerman [44] người Mỹ bản xứ tại Bắc Mỹ đã sử dụng 1.625 loài thực vật làm thực phẩm, trong khi đó có đến 2.564 loài được dùng làm thuốc. Uớc tính có 14-28% các loài thực vật được sử dụng trong y học và 74% đã được phát hiện là có hoạt tính sinh học [31]. Châu Á là khu vực có nền y học cổ truyền phát triển từ lâu đời đặc biệt là tại Trung Quốc, Ấn Độ, Việt Nam Với tình trạng kháng thuốc kháng sinh hiện nay việc nghiên cứu, phát triển sản xuất các hợp chất có hoạt tính kháng khuẩn từ thực vật đang là mối quan tâm lớn của các nhà khoa học, ngành y học, dược học. Việt Nam với điều kiện khí hậu và thảm thực vật đa dạng, phong phú đã và đang phát triển các nghiên cứu về các hoạt chất có tính kháng khuẩn từ thực vật dựa vào những bài thuốc cổ truyền từ ngàn xưa để lại. Theo các số liệu thống kê mới đây, thảm thực vật tại Việt Nam có trên 12000 loài, trong số đó có trên 3200 loài được sử dụng làm thuốc trong Y học cổ truyền [16]. Tại Việt Nam đã có nhiều đề tài nghiên cứu về hợp chất kháng khuẩn từ thực vật và đã thu được những kết quả nhất định trên các đối tượng như: tỏi, đu đủ, anh đào, lá dứa, thanh long, lá lốt, dừa cạn, dâm bụt, sống đời, xoan, bồ công anh Việt Nam, diệp hạ châu, đinh lăng 1.3.3.3 Phân loại các hợp chất kháng khuẩn của thực vật Thực vật có khả năng tổng hợp chất thơm, hầu hết là phenol hoặc dẫn xuất oxy. Chúng đều là hợp chất thứ cấp, hiện nay đã phân lập được khoảng 12000 loại, chiếm tỷ lệ ước tính dưới 10% tổng số hợp chất thứ cấp [42]. Trong đó đa số các hợp chất thứ cấp có vai trò bảo vệ cây trồng chống lại những sinh vật hại chúng như: vi sinh vật, côn trùng, động vật. Ví dụ như nhóm terpenoid tạo mùi hôi, nhóm quinon và tannin tạo sắc tố trên thực vật, một số chất tạo hương vị và một số được dùng làm dược phẩm và thực phẩm cho con người. Các hợp chất kháng khuẩn thực vật gồm có: Ankaloit: berberin, piperin Phenol và polyphenol: phenol, axit phenol, catechol, pyrogallol, quinon, flavon, flavonoit. Terpenoit: tinh dầu, saponin Và một số hợp chất khác như: lectin, polyacetylen Cơ chế kháng khuẩn Chất kháng sinh có thành phần và cấu trúc hóa học đặc trưng nên không có một cơ chế tác dụng chung đối với vi sinh vật. Đặc tính và cơ chế phụ thuộc vào bản chất hóa học của từng chất, nồng độ và cấu trúc của vi sinh vật. Nhìn chung chất kháng sinh có các cơ chế tác dụng như sau: Ức chế quá trình tổng hợp thành tế bào vi khuẩn: penicillin, bacitracin, vancomycin. Do tác dộng lên quá trình tổng hợp thành tế bào nên làm cho vi khuẩn dễ bị phá vỡ do thay dổi áp suất thẩm thấu. Ức chế chức năng của màng tế bào: colistin, polymycin, gentamicin, amphoterricin. Cơ chế làm mất chức năng của màng làm cho các phân tử có khối luợng lớn và các ion bị thoát ra ngoài, vi khuẩn bị tiêu diệt. Ức chế quá trình sinh tổng hợp protein: Nhóm aminoglycosid gắn với receptor trên tiểu phần 30S của ribosom làm cho quá trình dịch mã không chính xác. Nhóm chloramphenicol gắn với tiểu phần 50S của ribosom ức chế enzym peptidyltransferaza dẫn đến không kéo dài chuỗi. Nhóm macrolid và lincoxinamid gắn với tiểu phần 50S của ribosom sẽ ức chế giải phóng axit amin khỏi phức hợp aa-tARN-riboxom-mARN. Ức chế quá trình tổng hợp axit nucleic: Nhóm refampin gắn với enzym ARN polymeraza ngăn cản quá trình sao mã tạo thành ARN thông tin. Nhóm quinolon ức chế tác dụng của enzym DNA gyraza làm cho hai mạch đơn của ADN không thể duỗi xoắn, ngăn cản quá trình nhân đôi của ADN. Nhóm sulfamid có cấu trúc giống PABA (axit p- aminobenzoic) có tác dụng cạnh tranh PABA và ngăn cản quá trình tổng hợp axit nucleic. Nhóm trimethoprim tác động vào enzym xúc tác cho quá trình tạo nhân purin làm ức chế quá trình tổng hợp axit nucleic. CÂY TÁO MÈO VÀ DỊCH CHIẾT TỪ QUẢ TÁO MÈO 1.4.1 Đặc điểm thực vật học Cây táo mèo hay còn gọi là cây chua chát, tên khoa học là Docynia indica, thuộc họ hoa hồng (Rosaceae). Dạng sống là dạng bụi hoặc gỗ nhỏ, ưa sáng, chiều cao 5-10 mét, cây phân cành sớm, tán tròn, trên nhánh và thân non có gai, mọc rải rác trong rừng ở độ cao 1300-2000 mét. Lá mọc so le, hình thuôn, gốc tròn đầu nhọn, mép lá nguyên, mặt dưới có lông bạc mịn, mặt trên màu xanh lục, có 2 lá kèm rụng sớm. Rụng lá hoàn toàn vào cuối mùa đông, ra lá non vào tháng 3. Mùa ra hoa vào tháng 2-4, hoa màu trắng, mọc thành cụm 3- 5 hoa ở nách lá hoặc đầu cành, cuống ngắn, đài dày có lông trắng, hoa mỏng manh và không có lông, nhị ngắn, vòi nhụy dài[6]. Quả chín vào tầm tháng 8- 9-10, quả thịt hình trứng, chín có màu vàng nhạt, vị chua chát và có mùi thơm đặc trưng. 1.4.2 Sự phân bố Cây táo mèo là cây ưa sáng, ưa khí hậu ẩm mát của vùng nhiệt đới núi cao, nhiệt độ trung bình năm 15- 180C, lượng mưa 1.500 – 3.800mm/năm và độ ẩm trung bình khoảng 85%. Trên thế giới cây có ở một số nước như: Ấn Độ, Trung Quốc, Myanma, Thái Lan. Tại Việt Nam, cây phân bố tại: Ðiện Biên (Tuần Giáo, đèo Pha Ðin), Lai Châu (Sìn Hồ), Lào Cai (Sa Pa), Hà Giang (Ðồng Van, Quản Bạ, Mèo Vạc); Yên Bái (Mù Cang Chải) [6]. 1.4.3 Tác dụng dược lý Quả táo mèo được dùng phổ biến trong Đông y, có thể dùng thay thế hay tương tự như vị thuốc sơn tra với nhiều tác dụng như làm thuốc bổ tỳ, vị, kích thích tiêu hóa, giúp ăn ngon, dễ tiêu chống đầy bụng, ợ chua, giúp tăng cường miễm dịch, giảm cholesterol, hạ mỡ máu, đại tiện xuất huyết, chữa toàn thân đau mỏi...dưới dạng thuốc sắc, cao lỏng hoặc tán bột uống. Điều đáng chú ý nhất táo mèo có tác dụng hạ huyết áp nhờ làm giãn mạch ngoại vi. Mặt khác còn giúp hạ mỡ máu, chống huyết khối làm giãn động mạch vành, cải thiện sức co bóp của cơ tim, phòng chống tích cực các biến chứng do cao huyết áp gây ra. Ngoài ra, chúng còn có tác dụng ức chế các trực khuẩn: thương hàn, bạch hầu, lị, tụ cầu vàng, giảm chứng suy hô hấp. Trong dân gian, táo mèo dùng ngâm với rượu uống để tăng cường sức khỏe, kích thích tiêu hóa và dùng làm siro táo mèo hay chế biến ruợu vang. Dịch lên men quả táo mèo - giấm táo mèo gần đây được lan truyền và phổ biến rộng rãi trong cộng đồng với tác dụng phòng chống béo phì,tăng cường khả năng miễn dịch và khả năng kháng khuẩn, chữa bệnh viêm đường hô hấp: ho, viêm amidan. Thành phần hóa học Theo nghiên cứu của Đinh Thị Kim Chung [5] cho biết khối lượng trung bình của quả táo mèo tại 2 vùng Yên Bái và Lào Cai là 20,5 ± 0,5 g, nước chiếm tỷ lệ 84,6%, đường 4,81%, axit tổng số 1,47% và pH là 2,9. Theo kết quả khảo sát định tính dịch chiết từ quả táo mèo thấy có đủ các nhóm hợp chất như: Flavonoit, tannin, ankaloit, glycozit có tác dụng kháng khuẩn rất có hiệu quả. Giấm táo chứa axit malic, axit acetic, hàm lượng enzym cao rất tốt cho tiêu hóa. Tình hình nghiên cứu táo mèo tại Việt Nam Hiện nay trên thế giới chưa có nhiều nghiên cứu về cây táo mèo Docynia indica, đặc biệt là về tác dụng kháng khuẩn của quả táo mèo. Tại Việt Nam, nghiên cứu của Nguyễn Thị Thanh Loan [15] cho thấy tác dụng chống béo phì và giảm trọng luợng của dịch chiết quả Táo mèo Docynia indica (Wall.) Decne trên mô hình chuột béo phì thực nghiệm. Theo Vũ Thị Hạnh Tâm [20] nghiên cứu và ghi nhận vai trò hạ lipit và đường huyết của dịch chiết quả táo mèo trên chuột. Hoàng Thị Minh Tân [21] quả và lá táo mèo có khả năng chống rối loạn trao đổi gluxit và lipit. Vũ Thị Huê, Bùi Thị Việt Hà [49] đã có những nghiên cứu sơ bộ ghi nhận về tác dụng kháng khuẩn của dịch lên men quả táo mèo. Chương 2 - NGUYÊN LIỆU VÀ PHƯƠNG PHÁP 2.1. NGUYÊN LIỆU 2.1.1 Nguồn giống Các chủng Vi sinh vật kiểm định lấy từ Bảo tàng Giống chuẩn VSV, Viện VSV và Công Nghệ Sinh học - ĐH Quốc gia Hà Nội, gồm các chủng; Shigella flexneri. Klebsiella VTCC-B-814;E. coli VTCC-B-883; Salmolella typhi VTCC-B-897; Vibrio VTCC-B-652, Moraxella catarrhalis ATCC 43617. Chủng Moraxella catarrhalis kháng kháng sinh, Staphylococcus aureus phân lập tại Bệnh viện Tai – Mũi – Họng Trung ương. 2.1.2 Hóa chất và thiết bị Hóa chất - Các thành phần hóa chất dùng làm môi trường. - Các hóa chất dùng trong tách chiết hợp chất thiên nhiên: DMSO, silicagel, florisil 100- 200 U.S.mesh,ethylaxetat, metanol, n-Butanol,. Thiết bị: tủ ấm, máy lắc ổn nhiệt, máy đo pH, máy ly tâm lạnh, máy cô chân không, thiết bị đông khô, hệ thống chiết pha rắn, cột sắc ký 2.2. PHƯƠNG PHÁP 2.2.1. Phương pháp lên men quả táo mèo Sử dụng 1kg quả táo mèo tươi, rửa sạch, cắt thành các phần nhỏ, để nguyên hạt, cho vào bình thủy tinh. Bổ sung 3 lít nước đun sôi ấm (khoảng 400C), 300 g đường, 30 g muối , đậy kín bình bằng vải màn. Sau một tháng thu dịch lên men quả táo mèo – giấm táo mèo. 2.2.2. Phương pháp phân lập vi khuẩn Dịch lên men quả táo mèo đã thu được nhỏ vào các giếng thạch trên đĩa petri có chứa sẵn vi khuẩn Moraxalla catarrhalis. Để trong tủ lạnh từ 4-8 giờ, sau đó để vào tủ ấm. Kết quả sau 72 giờ cho thấy giấm táo mèo có khả năng ức chế sự sinh trưởng của vi khuẩn M. catarrhalis. Vì vậy, tiến hành phân lập vi khuẩn từ dịch lên men quả táo mèo. Pha loãng dịch giấm bằng nước cất khử trùng theo hệ thập phân ở các nồng độ khác nhau từ 10-1 đến 10-6 và tran đều trên đĩa petri chứa môi trường thạch thường để tìm chủng vi khuẩn có hoạt tính mong muốn. 2.2.3. Xác định hoạt tính kháng sinh và enzym 2.2.3.1. Xác định hoạt tính kháng khuẩn bằng phương pháp đục lỗ thạch Dùng khoan nút chai đục các lỗ trên môi trường thạch đã cấy VSV kiểm định trong đĩa petri. Dịch nuôi vi khuẩn 2 ngày ở nhiệt độ thích hợp được ly tâm với tốc độ 6000 vòng/phút, ở 4oC trong 15 phút sau đó được nhỏ với lượng 0,1 ml vào mỗi lỗ thạch. Đọc kết quả sau 2 ngày hoạt tính kháng sinh xác định dựa vào kích thước vòng vô khuẩn (D-d, mm). Trong đó, D là đường kính vòng vô khuẩn, d là đường kính lỗ khoan. 2.2.3.2. Xác định hoạt tính enzym Xác định khả năng sinh enzym ngoại bào (proteaza, kitinaza, xenlulaza, amylaza) trong dịch nuôi cấy bằng phương pháp khuếch tán trên thạch chứa 1% cơ chất tương ứng (cazein, kitin, CMC, tinh bột tan). Môi trường gồm cơ chất và thạch được khử trùng ở 1atm trong 30 phút, sau đó được đổ vào các đĩa petri đã được vô trùng, với độ dày thạch khoảng 3mm, đợi nguội, dùng khoan nút chai để đục các lỗ thạch trên môi trường. Nhỏ 200µl dịch nuôi cấy vi sinh vật vào các lỗ thạch, rồi để vào tủ lạnh 4-5h cho enzym khuếch tán vào thạch, sau đó chuyển vào tủ ấm 30-32oC. Sau 24 giờ đem ra hiện vòng phân giải bằng cách nhuộm màu các đĩa bằng dung dịch Lugol (với cơ chất là CMC, kitin, tinh bột) và bằng axit triclo axetic với cơ chất là cazein. Hoạt tính enzym được xác định qua kích thước vòng phân giải theo công thức: Hoạt tính enzym = D-d (mm). Trong đó: D là đường kính vòng phân giải, d là đường kính lỗ khoan. 2.2.4. Bảo quản giống Vi khuẩn được nuôi trong ống thạch nghiêng thạch thường, nuôi ở nhiệt độ phòng. Sau khoảng 10-14 ngày khi vi khuẩn đã mọc tốt cất vào tủ mát ở nhiệt độ 4-6oC. Sau 1-2 tháng cấy truyền lại một lần. Nhằm bảo quản được giống lâu hơn, để giống trong ống cát, trong paraffin lỏng vô trùng giữ lạnh sâu trong glycerin hoặc đông khô, bảo quản được từ 6 tháng đến 2 năm. 2.2.5. Xác định sinh khối bằng phương pháp đo mật độ quang học-OD Số lượng tế bào VSV trong dịch nuôi có thể xác định gián tiếp bằng cách đo mật độ quang học. Dịch nuôi được pha loãng 5 lần, đo OD ở bước sóng 620nm. 2.2.6. Xác định các yếu tố ảnh hưởng tới khả năng sinh trưởng và hoạt tính kháng khuẩn của vi khuẩn Vi khuẩn được lên men trên môi trường dịch thể trong bình nón dung tích 250ml với các thành phần và các yếu tố liên quan như sau: Lựa chọn môi trường nuôi cấy thích hợp Chủng nghiên được nuôi cấy lắc 220 vòng / phút trên các môi trường khác nhau ở nhiệt độ và pH thích hợp. Sau 2 ngày xác định pH sau nuôi cấy, mật độ tế bào và hoạt tính kháng khuẩn. Ảnh hưởng của pH Nuôi lắc vi khuẩn 220 vòng/phút ở nhiệt độ thích hợp sau khi đã điều chỉnh pH ban đầu của môi trường ở các giá trị pH khác nhau với bước nhảy bằng 1. Xác định OD, pH, hoạt tính kháng khuẩn sau nuôi cấy. Ảnh hưởng của nguồn cacbon Bổ sung vào môi trường nuôi cấy thích hợp 1% các nguồn cacbon khác nhau là: kitin, tinh bột tan, dextrin, glucoza, CMC, lactoza, bột ngô. Tiến hành nuôi cấy lắc vi khuẩn với vận tốc 220 vòng/phút. Sau 2 ngày xác định OD, pH sau khi nuôi cấy, hoạt tính kháng khuẩn. Ảnh hưởng của nguồn nitơ Bổ sung nguồn nitơ khác nhau vào môi trường thích hợp với các hàm lượng 1%: NaNO2, NaNO3, (NH4)2SO4, bột đậu tương, cao nấm men, peptone. Các bước tiếp theo tiến hành tương tự như trên. Ảnh hưởng của thời gian nuôi cấy Vi khuẩn được nuôi cấy lắc trên môi trường với nguồn cacbon, nitơ, pH thích hợp, cứ sau 24h lại lấy mẫu để xác định OD, pH, hoạt tính enzym, hoạt tính kháng khuẩn. 2.2.7. Tách chiết các hợp chất trong dịch lên men vi khuẩn và dịch lên men quả táo mèo [18] 2.2.7.1 Phương pháp đông khô Đông khô là quá trình mà nước được lấy ra khỏi mẫu khi các mẫu đang ở trạng thái lạnh sâu. Ở đây mẫu được làm lạnh trong môi trường chân không. Thiết bị đông khô sẽ hút nước và cuối cùng mẫu được làm khô đến mức nhất định (mẫu được hàn kín để cho môi trường chứa mẫu là chân không). Đây là phương pháp phổ biến có hiệu quả cao dùng để bảo quản các đối tượng vi sinh vật khác nhau như nấm sợi, nấm men, vi khuẩn và một số virut nhưng đôi khi cũng được sử dụng để đưa dịch chiết thành dạng cao chiết. 2.2.7.2 Phương pháp sắc ký cột Khảo sát hệ dung môi rửa giải và pha rắn hấp phụ Nhồi pha hấp phụ rắn (Silicagel 0,063-0,2mm, Florisil 100-200 U.S.mesh) vào cột xilanh cỡ 1 (d = 5mm) từng lượng nhỏ, lắc đều, thông số thiết kế cột được trình bày ở bảng 2.1: Bảng 2.1: Thông số thiết kế cột nhồi Pha hấp phụ Khối lượng (g) Chiều cao cột nhồi (cm) Silicagel 0,5 5 Florisil 0,6 5 Pha mẫu vào methanol nồng độ khoảng 0,01 g/ml rồi đưa lên cột 0,2 ml dung dịch này. Đưa cột lên hệ thống chiết pha rắn và thử nghiệm sơ bộ để khảo sát chất hấp phụ và hệ dung môi rửa giải. Hệ dung môi rửa giải được thử nghiệm là: n-Hexan, Cloroform, Ethylaxetat, n-Butanol n-Hexan, Cloroform, Aceton, methanol n-Hexan, n-Butanol, Aceton, Nước Kết quả nghiên cứu sơ bộ thấy chất hấp phụ silicagel và hệ dung môi rửa giải n-Hexan, Cloroform, Aceton, methanol có thể tách phân đoạn tương đối tốt và phù hợp. Do đó ta đi khảo sát quá trình tách phân đoạn dịch chiết táo mèo và dịch lên men trên cột sắc ký nhồi to hơn. Phân đoạn dịch chiết trên sắc ký cột - Nhồi cột: Silicagel được sấy ở 3000C trong 2h và để nguội trong bình hút ẩm sau đó nhồi cột có đường kính 1cm, chiều cao là 22cm. - Luyện cột: dùng metanol để hoạt hóa pha rắn, làm ướt để pha rắn có thể sẵn sàng tiếp xúc và tương tác với các chất tan. Tránh không làm khô pha rắn trong và sau khi luyện cột. - Cân bằng cột: tương tự như bước 2 (nhưng phải dùng chính dung môi chứa mẫu như ban đầu để cho vào cột) dùng metanol. - Đưa mẫu vào cột: pha các mẫu cao chiết trong methanol ở nồng độ 0,01g/ml. Đưa 5ml dung dịch trên lên cột nhồi. - Rửa giải trên cột: dùng hệ dung môi rửa giải là: n-Hexan, Cloroform, Aceton, methanol với tỷ lệ phối trộn khác nhau sao cho mức độ phân cực tăng dần. Tốc độ dòng điều chỉnh sao cho thời gian tiếp xúc giữa dung môi rửa và pha rắn kéo dài trong 1-2 phút. Kiểm tra các phân đoạn trên sắc ký bản mỏng để thu gom các phân đoạn có kết quả triển khai tương tự nhau trong cùng một hệ dung môi có kết quả gần giống nhau. 2.2.7.3. Phương pháp kiểm tra phân đoạn bằng sắc ký bản mỏng Sấy bản mỏng rồi cắt thành từng tấm theo kích thước nhất định. Đánh dấu đường xuất phát cách mép dưới 0,5 –1 cm. Dùng ống mao quản hút dung dịch mẫu thử rồi chấm lên bản mỏng. Vết chấm phải tròn, gọn và đưa được lượng mẫu phù hợp. Sau đó đặt bản mỏng đã chấm vào bình triển khai sắc ký với hệ dung môi triển khai đã được bão hòa, đậy nắp bình. Sau khi dung môi chạy đến cách đầu trên của bản khoảng 0,5-1 cm thì lấy ra, đánh dấu mức dung môi trên bản mỏng, sấy khô bản mỏng rồi soi UV hoặc phun các thuốc thử hiện màu như dung dịch H2SO4 10% rồi sấy khô cho dung môi bay hết để vết triển khai trên bản mỏng được hiện rõ. Các hệ dung môi triển khai đã thử nghiệm khi nghiên cứu các phân đoạn trên bản mỏng bao gồm: TEAF - Tuluen: Ethylacetae: Acetone: Acid Focmic = 5:3:1:1. Ethylaxetat: axit focmic: nước = 8:1:1 Toluen: Ethylaxetat: axit focmic = 5:4:1 [Axit acetic (2,4%) – Etanol –Acetonitril (35: 5: 10)] - Metanol : (70: 30) Metanol – Axit acetic – Nước (36,7%: 0,3%: 63%) Axit acetic (0,28%) – Metanol – Acetonitril (35: 5: 10) n-Butanol – Axit acetic – Nước (85: 5: 10) n-Butanol – Etyl acetat – Dimetyl formamit – Nước (10: 6: 3: 2) Toluen – Etyl acetat – Aceton – Axit formic (15: 2: 2: 1) Benzen – Aceton (4:1): Benzen – Pyridin – Axit formic (36: 9: 5) 2.2.8. Khảo sát sơ bộ thành phần hóa học dịch chiết quả táo mèo và phân đoạn kháng khuẩn 2.2.8.1 Thử định tính flavonoit Phản ứng Shinoda. Pha mẫu thử trong ethanol với một lượng thích hợp, bổ sung vài giọt axit clohidric đặc và chia dung dịch thành hai ống nghiệm Ống 1: dùng làm đối chứng Ống 2: thả vài mảnh Mg vào, đun trên ngọn lửa đèn cồn trong vài phút. Kết quả dương tính khi trong ống nghiệm xuất hiện màu hồng, đỏ hay da cam. Phản ứng diazo hóa: Dung dịch thử được pha tương tự như trên. Cũng chia làm hai ống nghiệm Ống 1: dùng làm đối chứng Ống 2: cho vài 3-4 giọt thuốc thử diazo. Kết quả là dương tính khi có xuất hiện màu da cam. Phản ứng với dung dịch kiềm. cũng pha và chia dung dịch mẫu thử như trên Ống 1: dùng làm đối chứng Ống 2: nhỏ thêm vài giọt dung dịch NaOH 10%. Kết quả dương tính khi có màu vàng cam. Phản ứng với axit sulfuric: cũng tiến hành pha và chia dung dịch mẫu thử tương tự như trên Ống 1: dùng làm đối chứng Ống 2: Nhỏ bổ sung vài giọt axit sulfuric. Kết quả sẽ xuất hiện màu vàng đậm nếu dung dịch thử có chứa flavon hoặc flavonol. Màu đỏ hay nâu cho thấy sự có mặt của chalcon và auron. 2.2.8.2. Thử định tính tannin Phản ứng vanillin: cũng tiến hành pha dung dịch như trên Ống 1: dùng làm đối chứng Ống 2: Nhỏ thêm vài giọt thuốc thử vanillin/H2SO4. Kết quả dương tính nếu dung dịch có màu đỏ thẫm. Phản ứng gelatin/ NaCl: Cũng tiến hành tương tự như trên nhưng bổ sung vào ống 2 vài giọt thuốc thử gelatin/NaCl. Kết quả dương tính khi ống nghiệm có hiện tượng vẩn đục. Phản ứng với acetate chì: Bổ sung vài giọt thuốc thử acetat chì 10% vào dung dịch mẫu thử với cách pha tương tự như trên. Kết quả là dương tính thì sẽ xuất hiện kết tủa. Phản ứng với FeCl3 1% trong nước. Cách pha mẫu và phân chia mẫu tương tự như trên Ống 1: dùng làm đối chứng Ống 2: đổ vào ống nghiệm chứa thuốc thử được pha loãng bằng cồn 96%. Kết quả dương tính khi dung dịch có màu xanh, tía hoặc xanh đen. 2.2.8.3. Thử định tính ankaloit Phản ứng Dragendrorff cải tiến. Lấy lượng 0.01g cao dịch chiết trong 1ml CH3COOH 2%, lọc để thu dịch lọc. Lấy khoảng 1ml mẫu thử cho vào ống nghiệm Ống 1 : Dùng làm đối chứng Ống 2: nhỏ từ từ thuốc thử vào ống 2. Thành phần thuốc thử gồm có Bi (NO3)3 và KI trong dung dịch acid axetic. Kết quả dương tính sẽ cho kết tủa màu đỏ da cam hay đỏ gạch. 2.2.8.4. Thử định tính glicozit Phản ứng Keller- Killian Dung dịch 1: 50 ml CHCOOH 10% + 5,5 ml dung dịch FeCl3 5% Dung dịch 2: 50ml H2SO4 đặc + 0,5 ml dung dịch FeCl3 5% Lấy 0,01 g cao chiết ở các phân đoạn cho vào ống nghiệm. Sau đó, bổ sung 1 ml dung dịch 1, lắc cho hòa tan hết, nghiêng ống nghiệm khoảng 450 rồi nhỏ từ từ dung dịch 2 vào. Kết quả dương tính khi phản ứng cho màu đỏ nâu giữa hai lớp chất lỏng. Chương 3: KẾT QUẢ VÀ THẢO LUẬN 3.1 HOẠT TÍNH KHÁNG Moraxella catarrhalis CỦA DỊCH LÊN MEN QUẢ TÁO MÈO Quả táo mèo tươi lên men sau một tháng xuất hiện lớp màng trắng, dịch có màu vàng trong, mùi thơm, vị chua thanh, pH 4,3. Tiến hành thu dịch, thử hoạt tính kháng M. catarrhalis kháng kháng sinh, thấy dung dịch này có hoạt tính kháng kháng với kích thước vòng kháng 20mm. Dùng nước cất pha loãng dịch lên men táo mèo theo các tỷ lệ thể tích (ml) khác nhau: V1: V2= 1: 1, 1:2, 1:3, 1:4. Trong đó V1 là thể tích dịch lên men quả táo mèo, V2 là thể tích nước cất. Sau đó đem kiểm tra hoạt tính kháng M. catarrhalis. Kết quả như sau: Bảng 3.1. Hoạt tính kháng M. catarrhalis của dịch lên men quả táo mèo V1 : V2 (ml: ml) HTKK (D-d,mm) pH sau pha Dịch lên men quả táo mèo 13 7 Dịch lên men quả táo mèo 20 4,3 1:1 16 4,8 1:2 10 5,1 1:3 3 5,3 1:4 0 5,5 Cho thấy dịch lên men quả táo mèo nguyên chất có hoạt tính kháng M. catarrhalis mạnh nhất, hoạt tính kháng giảm dần theo tỷ lệ pha loãng và tại tỷ lệ pha 1: 4 dịch không còn hoạt tính. Dịch lên men quả táo mèo khi đưa về pH trung tính có hoạt tính kháng khuẩn thấp hơn so với pH axit ban đầu. Vậy hoạt tính kháng M. catarrhalis của dịch lên men quả táo mèo chịu tác động của pH, nồng độ các chất trong dịch. Từ dịch lên men quả táo mèo tiến hành phân lập, tuyển chọn vi khuẩn có khả năng kháng M. catarrhalis kháng kháng sinh. 3.2. TUYỂN CHỌN CHỦNG VI SINH VẬT 3.2.1 Phân lập và tuyển chọn chủng vi sinh vật kháng Moraxella catarrhalis Tiến hành phân lập vi khuẩn từ mẫu dịch lên men quả táo mèo trên môi trường thạch thường thu được 5 chủng vi sinh vật, trong đó có 4 chủng có hoạt tính kháng khuẩn Moraxella catarrhalis (bảng 3.2) đặc điểm sau: TM2.2: Khuẩn lạc nhỏ, màu vàng, có vành phóng xạ xung quanh, bóng- nhầy, bên ngoài đục hơn phía trong của khuẩn lạc. TM5.1: Khuẩn lạc nhỏ, màu vàng, bề mặt nhầy – bóng, tròn, lồi và có kích thước nhỏ. TM5.2: Khuẩn lạc nhỏ, màu trắng, bề mặt trơn, mép viền, giữa có nhân trắng nhỏ. TM5.4: Khuẩn lạc nhỏ, màu trắng, tròn, bề mặt trơn, không bóng. Bảng 3.2. Hoạt tính kháng M. catarrhalis của 4 chủng vi khuẩn Chủng TM2.2 TM5.1 TM5.2 TM5.4 HTKK(D-d, mm) 10 + 20 12 Kết quả khảo sát cho thấy chủng TM5.2 là chủng có hoạt tính kháng M. catarrhalis mạnh nhất và ổn định nhất. Ngoài ra, chủng này còn có khả năng ức chế sự sinh trưởng của một số chủng vi khuẩn kiểm định khác (bảng 3.3). Từ đó tiến hành nghiên cứu trên đối tượng chủng TM5.2. Bảng 3.3: Hoạt tính kháng khuẩn của chủng TM5.2 lên các chủng vi khuẩn kiểm định E. coli VTCC-B-883 Staphylococus aureus Salmolella typhi VTCC-B-897 Shigella flexneri HTKK (D- d mm) 12 10 16 9 3.2.2 Phân loại chủng vi khuẩn đã tuyển chọn Chủng TM5.2 được xác định trình tự gen ADN riboxom 16S, kết quả thu được dải trình tự như sau: TGAGTTTGATCCTGGCTCAGGACGAACGCTGGCGGCGTGCCTAATACATGCAAGTCGAGCGG

Các file đính kèm theo tài liệu này:

  • docxluanvanthacsi_dinhdangword_103_5207_1869785.docx
Tài liệu liên quan