Đề tài Ứng dụng chỉ thị phân tử AND xác định gene phục vụ chọn tạo giống lúa thơm

Ứng dụng chỉ thị phân tử AND xác định gene phục vụ chọn tạo giống lúa thơm

Việc làm này không những tốn kém về tiền bạc mà còn cả về thời gian. Sử dụng chỉ thị phân tử (marker) để xác định các gen mong muốn ở các cá thể từ thế hệ sớm sẽ giúp cho công tác chọn tạo giống cây trồng nói chung và giống lúa nói riêng một cách hiệu quả hơn.

Cho tới nay đã có rất nhiều nghiên cứu về các chất tạo mùi thơm ở lúa cũng như bản chất di truyền của gen tạo mùi thơm. Người ta đã chứng minh rằng, chất thơm trong lúa được hợp thành từ hơn một trăm hợp chất dễ bay hơi như hydrocarbons, alcohol, aldehydes, acid, esters, phenols và những hợp chất khác. Trong đó, chất 2-acetyl-1-pyrroline (2AP) được xem là hợp chất quan trọng nhất tạo mùi thơm ở tất cả các giống lúa.

 

 

ppt22 trang | Chia sẻ: lethao | Lượt xem: 1593 | Lượt tải: 3download
Bạn đang xem trước 20 trang tài liệu Đề tài Ứng dụng chỉ thị phân tử AND xác định gene phục vụ chọn tạo giống lúa thơm, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
TRƯỜNG CAO ĐẲNG NÔNG LÂM KHOA CÔNG NGHỆ SINH HỌC BÀI THẢO LUẬN “Ứng dụng chỉ thị phân tử AND xác định gene phục vụ chọn tạo giống lúa thơm” Giáo viên hướng dẫn: Lã Thị Nguyệt Nhóm 2_9K3 Ứng dụng chỉ thị phân tử AND xác định gene phục vụ chọn tạo giống lúa thơm 1. ĐẶT VẤN ĐỀ Trong những đặc tính lý hoá liên quan tới chất lượng gạo thì mùi thơm là một trong những đặc tính quan trọng. Sự biểu hiện tính trạng thơm trong lúa gạo thường bị tác động bởi điều kiện môi trường nên việc đánh giá để chọn lọc ra các dòng giống lúa thơm thường phải tiến hành trên nhiều vụ và chỉ tiến hành được khi đã thu hoạch lúa. Ứng dụng chỉ thị phân tử AND xác định gene phục vụ chọn tạo giống lúa thơm Việc làm này không những tốn kém về tiền bạc mà còn cả về thời gian. Sử dụng chỉ thị phân tử (marker) để xác định các gen mong muốn ở các cá thể từ thế hệ sớm sẽ giúp cho công tác chọn tạo giống cây trồng nói chung và giống lúa nói riêng một cách hiệu quả hơn. Cho tới nay đã có rất nhiều nghiên cứu về các chất tạo mùi thơm ở lúa cũng như bản chất di truyền của gen tạo mùi thơm. Người ta đã chứng minh rằng, chất thơm trong lúa được hợp thành từ hơn một trăm hợp chất dễ bay hơi như hydrocarbons, alcohol, aldehydes, acid, esters, phenols và những hợp chất khác. Trong đó, chất 2-acetyl-1-pyrroline (2AP) được xem là hợp chất quan trọng nhất tạo mùi thơm ở tất cả các giống lúa. Dựa trên những kết quả này người ta sử dụng phương pháp ASA (Allele Specific Amplication) với 4 cặp mồi: ESP, EAP, IFAP và INSP giúp phân biệt kiểu gen của các giống lúa đồng hợp tử thơm (cho băng 257 bp), dị hợp tử thơm (cho 2 băng dài 355 bp và 257 bp) và giống không thơm (cho băng dài 355 bp). Trình tự các cặp mồi sử dụng: + ESP: TTGTTTGGAGCTTGCTGATG + EAP: AGTGCTTTACAAAGTCCCGC + IFAP: CATAGGAGCAGCTGAAATATATACC + INSP: CTGGTAAAAAGATTATGGCTTCA Ứng dụng chỉ thị phân tử AND xác định gene phục vụ chọn tạo giống lúa thơm Ứng dụng chỉ thị phân tử AND xác định gene phục vụ chọn tạo giống lúa thơm 2. NỘI DUNG 2.1. Vật liệu 2.2. Phương pháp 2.3. Kết quả và thảo luận Ứng dụng chỉ thị phân tử AND xác định gene phục vụ chọn tạo giống lúa thơm 2.1. VẬT LIỆU Hiện nay có trên 40 dòng, giống lúa thơm và không thơm đang được gieo trồng rộng rãi trong sản xuất, một số giống phổ biến như: Giống lúa HT Giống lúa Q5 Ứng dụng chỉ thị phân tử AND xác định gene phục vụ chọn tạo giống lúa thơm Các chỉ thị phân tử là RG 28, RM342, L05 và chỉ thị BADH2 gồm 4 mồi EAP, ESP, IFAP và INSP, cùng các hóa chất sử dụng trong tách chiết ADN và chạy điện di được sử dụng như: phenol, EDTA, iso propanol, TAE, glyceol, brommophenol blu... Các giống lúa, mẫu lá được thu khi cây được 30-35 ngày tuổi và được bảo quản trong điều kiện –80OC đến khi phân tích. Ứng dụng chỉ thị phân tử AND xác định gene phục vụ chọn tạo giống lúa thơm 2.2. PHƯƠNG PHÁP a, Tách chiết ADN Lấy 100 mg mẫu lá được nghiền nhỏ trong 800 µl dung dịch đệm chiết (NaCl 0,05 M, SDS 1%, EDTA 0,05 M, Tris HCl 0,01 M) bằng cối chày sứ. Hỗn hợp được ủ ở nhiệt độ 65OC trong 30 phút, rồi thêm 100 µl CH3COOK 5 M, trộn đều và để trên đá -200C trong 20 phút, sau đó ly tâm ở tốc độ 12.000 vòng/phút trong 15 phút. Ứng dụng chỉ thị phân tử AND xác định gene phục vụ chọn tạo giống lúa thơm Thu và chuyển phần dung dịch phía trên sang ống 1,5 ml mới. Thêm vào ống 300 µl dung dịch Isopropanol, để ở nhiệt độ phòng 30 phút, ly tâm 12.000 vòng/phút rồi thu chất kết tủa và rửa bằng Ethanol 80%, để khô trong 10 phút. Hoà tan ADN trong 200 µl TE, thêm vào 1 µl Rnase, ủ trong khoảng thời gian 30 phút ở 37oC, thêm vào 10 µl CH3COONa và 200 µl Ethanol 100%, trộn đều và để ở nhiệt độ phòng 30 phút, ly tâm 12.000 vòng/phút rồi thu kết tủa ADN ở đáy ống nghiệm. Rửa phần kết tủa bằng Ethanol 70%, để khô và cho TE vào hòa tan ADN để sử dụng. Ứng dụng chỉ thị phân tử AND xác định gene phục vụ chọn tạo giống lúa thơm b, Phản ứng PCR Đối với primer RG28, RM342, L05 mỗi một 10 µl phản ứng nhân gen chứa 20 ng ADN của mẫu, 0,5 đơn vị Taq polymerase, 10 X PCR buffer, 20 mM MgCl2, 1 mM dNTPs và 5 uM primer. Phản ứng nhân gen được tiến hành trên máy Bio-rad 9800 với các chu trình nhiệt như sau: Bước 1: Giữ ở 94oC trong 5 phút; bước 2: 94oC trong 30 giây; bước 3: 55oC trong 30 giây; bước 4: 72oC trong 1 phút 30 giây; bước 5: 72oC trong 5 phút; và bước 6: Giữ ở 4oC. Chu kỳ nhiệt từ bước 2 đến bước 4 lặp lại 35 chu kỳ. Ứng dụng chỉ thị phân tử AND xác định gene phục vụ chọn tạo giống lúa thơm Đối với primer BADH2 mỗi một 25 µl phản ứng nhân gen chứa 10 ng ADN mẫu, 0,2 đơn vị Taq polymerase, 10 X PCR buffer, 10 mM MgCl2, 1 mM dNTPs và 2 uM primer. Phản ứng nhân gen được tiến hành trên máy Bio-rad 9800 với chu kỳ nhiệt như sau: Bước 1: 94oC trong 2 phút; bước 2: 94oC trong 30 giây; bước 3: 58oC trong 30 giây; bước 4: 72oC trong 30 giây; bước 5: 72oC trong 5 phút; bước 6: Giữ ở 4oC. Chu kỳ nhiệt từ bước 2 đến bước 4 lặp lại 30 chu kỳ. Sản phẩm PCR được điện di trên agarose 1,5% và ladder 100 kb được nhuộm bằng Ethidium bromide 0,5 µg/ml trong 15 phút, sau đó được soi và chụp ảnh bằng hệ thống chụp và phân tích hình ảnh Gel Doc 2000. Ứng dụng chỉ thị phân tử AND xác định gene phục vụ chọn tạo giống lúa thơm Ứng dụng chỉ thị phân tử AND xác định gene phục vụ chọn tạo giống lúa thơm 2.3. KẾT QUẢ VÀ THẢO LUẬN Xác định chỉ thị phân tử ADN liên kết với gen thơm fgr trong lúa - Kết quả đánh giá sự đa hình của sản phẩm điện di ADN của các giống lúa thơm và không thơm bằng chỉ thị RG28 và RM342 kết quả cho thấy: Đối với chỉ thị RG28 và RM342, các sản phẩm điện di ADN của các giống không cho sự đa hình. Điều này cho thấy, sử dụng chỉ thị RG28 và RM342 chưa phân biệt được các giống lúa mang gen thơm và không mang gen thơm. Ứng dụng chỉ thị phân tử AND xác định gene phục vụ chọn tạo giống lúa thơm Kết quả sử dụng chỉ thị phân tử L05 và BADH2: Đối với chỉ thị L05, sản phẩm điện di ADN của các giống khác nhau có sự đa hình: Các giống lúa không thơm như Q5 và 94-30 sản phẩm điện di ADN ở khoảng gần 300 bp và các giống còn lại (trong đó có 3 giống lúa thơm là AC5, Bắc thơm, Hương thơm số 1 và 1 giống lúa không thơm KD) cho sản phẩm điện di ở khoảng 250 bp. Như vậy, sử dụng chỉ thị L05 đã phân biệt được các giống lúa mang gen thơm với một số giống lúa không mang gen thơm fgr nhưng ở mức độ chính xác không cao. Đối với chỉ thị BADH2, sản phẩm điện di ADN của các giống khác nhau cho đa hình rất rõ nét. Có thể thấy ở tất cả các giống đều xuất hiện băng ADN như nhau ở khoảng xấp xỉ 600 bp. Tuy nhiên, đối với các giống lúa không thơm như Q5, KD, 94-30 (băng 3, 4 và 8) thì sản phẩm điện di ADN xuất hiện thêm băng ở khoảng 350 bp, còn đối với các giống lúa thơm AC5, BT, HTS1 (băng 5, 6 và 7) thì sản phẩm điện di xuất hiện thêm băng ở khoảng 250 bp. Như vậy, chỉ thị phân tử BADH2 đã xác định được chính xác sự khác nhau giữa giống lúa mang gen thơm và giống lúa không mang gen thơm. Ứng dụng chỉ thị phân tử AND xác định gene phục vụ chọn tạo giống lúa thơm Kết quả sử dụng chỉ thị phân tử BADH2 để xác định các giống lúa mang gen thơm trong tập đoàn bố mẹ gồm 42 giống. Có thể thấy việc sử dụng chỉ thị BADH2 đã xác định được toàn bộ các giống lúa thơm có mang gen thơm fgr với các giống lúa không thơm. Điều đó cho thấy chỉ thị phân tử BADH2 có độ tin cậy và chính xác rất cao trong việc phân biệt các giống lúa mang gen thơm fgr (lúa thơm) và không mang gen thơm fgr (lúa không thơm). Ứng dụng chỉ thị phân tử AND xác định gene phục vụ chọn tạo giống lúa thơm Ứng dụng chỉ thị phân tử AND xác định gene phục vụ chọn tạo giống lúa thơm Sử dụng chỉ thị phân tử BADH2 để xác định các dòng lúa mang gen thơm từ các thế hệ sớm Mỗi dòng được xác định trên 15 cá thể.Kết quả điện di sản phẩm ADN được đưa ra đại diện trong hình Ứng dụng chỉ thị phân tử AND xác định gene phục vụ chọn tạo giống lúa thơm Kết quả cho thấy các dòng số 1, 5, 7, 10, 13, 14, 16 (tương ứng với giếng 3, 7, 9, 12, 15, 16 và 18) là các giống lúa không chứa gen thơm fgr (có vệt băng khoảng 355 bp). Các dòng số 2 và số 3 (tương ứng với giếng số 4 và số 5) là những dòng mang gen thơm fgr dị hợp tử (vệt băng 257 bp và 355 bp). Các dòng còn lại là dòng số 4, 6, 8, 9, 11, 12, 15 (tương ứng với giếng số 6, 8, 10, 11,13, 14 và 17) là những dòng mang gen thơm fgr đồng hợp tử (vệt băng 257 bp). Kết quả xác định gen thơm trong tập đoàn từ F4 tới F6 và một số dòng DH (dòng thuần được tạo ra từ nuôi cấy bao phấn) được chọn lọc từ các tổ hợp lai giữa các giống lúa thơm và không thơm cho thấy: + Trong 420 dòng lúa được đánh giá có 73 dòng mang gen thơm đồng hợp tử (chiếm 17,4%). + 91 dòng mang gen thơm dị hợp tử (chiếm 21,7%) và 256 dòng không mang gen thơm (chiếm 60,9%). Ứng dụng chỉ thị phân tử AND xác định gene phục vụ chọn tạo giống lúa thơm Ứng dụng chỉ thị phân tử AND xác định gene phục vụ chọn tạo giống lúa thơm Các dòng lúa mang gen thơm đồng hợp tử là các dòng đã thuần về tính trạng gen thơm fgr sẽ được đánh giá và đưa vào so sánh, đánh giá các tính trạng nông học khác, các dòng mang gen thơm dị hợp tử sẽ được tiếp tục lựa chọn để chọn ra các dòng thuần về gen thơm. Tuy nhiên, tỷ lệ rất cao của các dòng không mang gen thơm trong tập đoàn các dòng lúa mới cho thấy việc cần thiết phải chọn các cá thể và dòng mang gen thơm từ các thế hệ sớm hơn như F2, F3 để giảm khối lượng các dòng cần phải đưa vào đánh giá và chọn lọc trong các thế hệ về sau. Ứng dụng chỉ thị phân tử AND xác định gene phục vụ chọn tạo giống lúa thơm 3.KẾT LUẬN Kết quả xác định và đánh giá độ tin cậy của các chỉ thị phân tử liên kết với gen quy định mùi thơm fgr đã được tiến hành trên 40 dòng, giống lúa thơm và không thơm cho thấy: + Các chỉ thị phân tử RG28, RM342 không phân biệt được các giống lúa mang gen thơm và không mang gen thơm. + Chỉ thị phân tử L05 có thể phân biệt được giữa các giống lúa thơm và không thơm, nhưng độ chính xác không cao. + Chỉ thị phân tử BADH2 đã phân biệt chính xác 100% các giống lúa thơm và không thơm. Đây là chỉ thị cần được sử dụng trong công tác chọn tạo giống lúa thơm trong thời gian tới. Ứng dụng chỉ thị phân tử AND xác định gene phục vụ chọn tạo giống lúa thơm Kết quả của việc sử dụng chỉ thị phân tử BADH2 để xác định sự có mặt của gen thơm fgr trong tập đoàn 420 dòng lúa mới ở các thế hệ từ F4-F6: Đã xác định được 73 dòng mang gen thơm fgr đồng hợp tử và 91 dòng mang gen thơm fgr dị hợp tử. Các dòng lúa này cần được tiếp tục chọn lọc, đánh giá và so sánh để chọn ra các dòng thuần mang gen thơm cùng các đặc tính nông học quan trọng khác. Thank you!

Các file đính kèm theo tài liệu này:

  • pptỨng dụng chỉ thị phân tử AND xác định gene phục vụ chọn tạo giống lúa thơm.ppt
Tài liệu liên quan