Đồ án Nghiên cứu đa dạng di truyền nguồn gen bông (Gossypium L.) sử dụng chỉ thị phân tử SSR

MỤC LỤC

MỞ ĐẦU 1

I. ĐẶT VẤN ĐỀ 1

II. MỤC TIÊU CỦA ĐỀ TÀI 3

CHƯƠNG I: TỔNG QUAN TÀI LIỆU 4

I.1 GIỚI THIỆU VỀ CÂY BÔNG 4

I.1.1 Nguồn gốc, xuất xứ cây bông 4

I.1.2 Đặc điểm hình thái cây bông 5

I.1.3 Đặc điểm sinh thái 5

I.1.4 Đặc điểm genome 6

I.1.5 Giá trị sản xuất thương mại của các loài bông 6

I.2 ĐA DẠNG DI TRUYỀN 6

I.2.1 Khái niệm 6

I.2.2 Nguyên nhân phát sinh đa dạng di truyền 7

I.2.3 Các mức độ đa dạng di truyền 7

I.3 NGHIÊN CỨU ĐA DẠNG DI TRUYỀN 8

I.3.1 Chỉ thị hình thái 8

I.3.2 Chỉ thị isozym 8

I.3.3 Chỉ thị phân tử trong nghiên cứu đa dạng di truyền 9

I.4 MỘT SỐ CHỈ THỊ PHÂN TỬ 9

I.4.1 Chỉ thị dựa trên cơ sở lai acid nucleic: RFLP 9

I.4.2 Chỉ thị dựa trên cơ sở PCR 10

I.4.2.1 Phản ứng PCR 10

I.4.2.2 Chỉ thị RAPD 14

I.4.2.3 Chỉ thị AFLP 15

I.4.2.4 Chỉ thị SSR 16

I.5 TÌNH HÌNH NGHIÊN CỨU ĐA DẠNG DI TRUYỀN TRÊN ĐỐI TƯỢNG CÂY BÔNG 18

I.5.1 Nghiên cứu đa dạng di truyền cây bông trên thế giới 18

I.5.2 Nghiên cứu đa dạng di truyền cây bông tại Việt Nam 19

CHƯƠNG II: VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 20

II.1 VẬT LIỆU 20

II.1.1 Vật liệu thực vật 20

II.1.2 Hóa chất, thiết bị 21

II.1.3 Chỉ thị SSR 21

II.2 PHƯƠNG PHÁP NGHIÊN CỨU 24

II.2.1 Tách chiết ADN tổng số 24

II.2.1.1 Chuẩn bị vật liệu 24

II.2.1.2 Quy trình tách chiết 25

II.2.1.3 Kiểm tra ADN tổng số 26

II.2.2 Phản ứng PCR 26

II.2.2.1 Thành phần phản ứng PCR 26

II.2.2.2 Chương trình chạy PCR 27

II.2.3 Điện di, phát hiện sản phẩm 27

II.2.3.1 Nguyên tắc 27

II.2.3.2 Chuẩn bị gel agarose 27

II.2.3.3 Điện di sản phẩm PCR 28

II.2.4 Phương pháp phân tích số liệu: phương pháp phân tích đa dạng di truyền băng phần mềm NTSYS pc v.2.1 (Biostatistics Inc 2002) 28

CHƯƠNG III: KẾT QUẢ NGHIÊN CỨU VÀ THẢO LUẬN 31

III.1 KẾT QUẢ TÁCH CHIẾT ADN TỔNG SỐ 31

III.1.1 Mục đích 31

III.1.2 Các bước tiến hành 31

III.1.3 Kết quả và nhận xét 32

III.2 KẾT QUẢ PHẢN ỨNG PCR CỦA 20 CẶP MỒI SSR 33

III.2.1 Mục đích 33

III.2.2 Các bước tiến hành 33

III.2.3 Kết quả 34

III.2.4 Nhận xét kết quả 37

III.3 NHẬN DẠNG ADN 37

III.3.1 Mục đích 37

III.3.2 Các bước tiến hành 37

III.3.3 Kết quả 37

III.3.4 Nhận xét kết quả 43

III.4 HỆ SỐ PIC VÀ ĐA DẠNG CÁC ALLEN SSR 44

III.4.1 Mục đích 44

III.4.2 Các bước tiến hành 44

III.4.3 Kết quả 45

III.4.4 Nhận xét kết quả 47

III.5 HỆ SỐ TƯƠNG ĐỒNG DI TRUYỀN VÀ BIỂU ĐỒ QUAN HỆ DI TRUYỀN CỦA CÁC GIỐNG BÔNG NGHIÊN CỨU. 49

III.5.1 Mục đích 49

III.5.2 Các bước tiến hành 49

III.5.3 Kết quả và nhận xét 49

III.5.3.1 Hệ số tương dồng di truyền S 49

III.5.3.2 Biểu đồ quan hệ di truyền của các giống bông nghiên cứu 51

III.6 KẾT QUẢ XÁC ĐỊNH CẶP GIỐNG BÔNG CHO ĐA HÌNH DI TRUYỀN CAO 52

KẾT LUẬN VÀ KIẾN NGHỊ 55

TÀI LIỆU THAM KHẢO 56

 

 

 

 

 

 

 

doc60 trang | Chia sẻ: maiphuongdc | Lượt xem: 2364 | Lượt tải: 1download
Bạn đang xem trước 20 trang tài liệu Đồ án Nghiên cứu đa dạng di truyền nguồn gen bông (Gossypium L.) sử dụng chỉ thị phân tử SSR, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
nhân bản. Như vậy có thể nói kỹ thuật AFLP được phát triển bởi sự kết hợp các yếu tố kỹ thuật RFLP và phản ứng PCR để nhân các đoạn giới hạn đặc trưng. Sản phẩm PCR của mỗi mồi ở mỗi mẫu nghiên cứu sẽ xuất hiện băng ADN đặc trưng nếu không có đột biến tại điểm cắt của enzym giới hạn tương ứng với vị trí bắt cặp của mồi, ngược lại sẽ không xuất hiện băng ADN đặc trưng. Về cơ bản AFLP là chỉ thị trội, và vị trí trên nhiễm sắc thể của chúng chưa được xác định, do vậy nếu dùng chỉ thị này để lập bản đồ gen ở quần thể F2 thì cần phải sử dụng kết hợp với các chỉ thị khác đã biết trước vị trí trên NST như RFLP và SSR. I.4.2.4 Chỉ thị SSR (Simple Sequence Repeats) SSR là kỹ thuật khuếch đại các đoạn trình tự lặp lại đơn giản, còn gọi là phương pháp vi vệ tinh (Microsatellite), do Lit và Luty giới thiệu và năm 1989 khi nghiên cứu genome của một số sinh vật đã phát hiện ra những đoạn ADN có chiều dài khác nhau, phân bố một cách ngẫu nhiên mà trình tự của nó bao gồm các nhóm nucleotide lặp lại một cách có trình tự [5]. Các nhóm nucleotide lặp lại này thường có trình tự không vượt quá 5 nucleotide như (TG)n hoặc (AAT)n. ở lúa các nucleotide đã phát hiện được gồm GA, GT, CAT, CTT. Những đoạn ADN lặp lại như vậy được gọi là Microsateline hay còn có tên khác như: SSLPs (single sequennce length polymorphisms), SSRs (simple sequence repeats), STRs (short tADNom repeats). Các đoạn ADN này có trình tự hai đầu rất đặc trưng cho mỗi đoạn, bởi vậy trình tự đặc trưng cho mỗi đầu của đoạn nhắc lại này được sử dụng để thiết kế mồi cho PCR [3]. Các ‘vi vệ tinh’ rất phổ biến trong hệ gen của tất cả các sinh vật. Vùng có ADN lặp lại thường kém ổn định hơn các vùng khác, nên ở các cá thể khác nhau, trình tự đó được lặp lại với số lần khác nhau. Do đó vùng này thường đa dạng hơn các vùng khác. Các đa hình SSR được sinh ra do mồi SSR khuếch đại vùng ADN lặp lại có trình tự bổ sung với hai đầu của vùng này trong phản ứng PCR; dùng để so sánh giữa các đối tượng cần nghiên cứu. Nếu các vùng ADN lặp lại của các đối tượng này (do cùng một mồi SSR khuếch đại) có đa hình, do có số lần lặp lại khác nhau thì khi sản phẩm PCR được điện di và chụp ảnh gel sẽ phát hiện được các băng đa hình. Kỹ thuật SSR đơn giản, tiện lợi và rất hữu ích trong nghiên cứu genome vì chúng được thiết kế dựa trên những vùng mã hóa có tính bảo thủ cao trong hệ gen [22]. Hơn nữa chỉ thị ssr thường chỉ khuếch đại các locus đặc trưng cho sự đa dạng của các loài trong 1 chi, đôi khi 1 họ [19]. Tuy nhiên nhược điểm của chỉ thị này là quá trình thiết kế mồi rất tốn kém. Trong số các chỉ thị được sử dụng để lập bản đồ, ssr là loại chỉ thị đặc biệt được sử dụng nhiều bởi tính đồng trội và đa allen [22]. Chỉ thị ssr có thể sử dụng cho các quần thể để lập bản đồ khác nhau, cho các nghiên cứu về tiến hóa của genome, so sánh genome cũng như sử dụng hiệu quả nguồn gen trong chọn tạo giống nhờ chỉ thị phân tử. Đối với đối tượng genome cây bông, nhiều lỗ lực phát triển chỉ thị ssr đã được tiến hành và chỉ thị ssr đang được sử dụng rộng rãi trong nghiên cứu lập bản đồ di truyền cây bông [20], [23], [26]. Hàng nghìn chỉ thị ssr của bông được xác định tại các phòng thí nghiệm khác nhau: Brookhaven National Laboratoy (BNL), Texas A&M University [23] nghiên cứu gần đây nhất của Wangzhen Guo và cs 2007 đã sử dụng chỉ thị ssr định vị được 1790 locus ở 26 nhóm liên kết bao phủ một vùng 3425,8 cM với khoảng cách trung bình giữa các locus là 1,91 cM. Trong đó bản đồ liên kết genome này bao gồm 71,96% các locus gen chức năng, 475 locus có liên kết với 3 loại gen chính quy định quá trình sinh học, thành tế bào, chức năng phân tử ở bông. Ngoài các chỉ thị phân tử đã được đề cập đến trong nội dung đề tài này còn có rất nhiều các chỉ thị khác nữa: STS (sequennce tag site), SCAR (sequence characterized amplified region), CAPS (cleaved amplified polymorphic sequence). I.5 tình hình Nghiên cứu đa dạng di truyền trên đối tượng cây bông I.5.1 Nghiên cứu đa dạng di truyền cây bông trên thế giới Là một cây trồng quan trọng nhưng do có bộ gen lớn và phức tạp, nên công tác nghiên cứu genome bông tiến chậm hơn so với các cây trồng khác như lúa, ngô, đậu tương...[26] Những thành tựu khoa học sử dụng chỉ thị phân tử như sử dụng chỉ thị RFLP, chỉ thị SSR, hay RAPD (mục I.4) ...định vị được rất nhiều các locus trên genome bông đã tạo điều kiện để việc nghiên cứu đa dạng di truyền trên đối tượng bông sử dụng chỉ thị phân tử, trở nên thuận tiện hơn. Trong các chỉ thị phân tử dùng trong nghiên cứu đa dạng di truyền chỉ thị RFLP, SSR có mức độ chính xác rất cao, nhưng RFLP có khối lượng công việc cồng kềnh nên ít được sử dụng hơn chỉ thị SSR. Cãndida H.C. de Magalhães Bertini và cs (2006) đánh giá đa dạng di truyền các giống bông (Gosypium hirsutum L) đang được trồng ở Brazil, Argentine và Paraguay. Sau khi tách chiết ADN của 53 giống bông và nghiên cứu tính đa dạng, sử dụng 31 cặp mồi SSR, khuếch đại 33 locus. Kết quả thu được tổng số 66 allen, trung bình 2,13 allen/locus SSR và giá trị PIC khác nhau từ 0,18 - 0,62 giá trị trung bình là 0.4, hệ số không tương đồng từ 0 - 0,41. Cũng trên đối tượng bông, Gutierrez và cs (2002) đã sử dụng 60 cặp mồi cho đa hình, kết quả khuếch đại 69 locus với tổng số 139 allen và trung bình có 2 allen/locus. Liu và cs (2000b) đã sử dụng 56 cặp mồi cho đa hình, khuếch đại 62 locus bông và thu được tổng số 325 allen, trung bình 5 allen/lucus, giá trị PIC tính được là từ 0.05- 0.82 giá trị trung bình là 0.31. Các giống bông mà Liu và cs (2000b) sử dụng có cả các giống G.hirsutum hoang dại. Multani và Lyon (1995), khi phân tích đa dạng di truyền giữa 9 giống bông của úc sử dụng chỉ thị RAPD cũng thu được kết quả giá trị khoảng cách di truyền thấp (0.01-0.08). Iqbal và cs (1997) cũng sử dụng chỉ thị RADP tìm ra khoảng cách di truyền thấp (0.18-0.07) giữa 17 giống G.hirsutum [13]. A B Dongre* và cs, (2007) đã đánh giá đa dạng di truyền của 19 đối tượng bông gồm: 11 kiểu gen của loài G. hirsutum và 8 kiểu gen của loài G. arboreum, sử dụng 25 mồi SSR được lựa chọn ngẫu nhiên từ tập hợp mồi JESPR-307 do phòng thí nghiệm Brookhaven National Laboratories công bố và 19 mồi ISSR. Trong số 25 chỉ thị SSR có 17 chỉ thị cho tổng số 56 băng đa hình, 4 chỉ thị là đơn hình và 4 chỉ thị còn lại là không ghi được kết quả và không cho băng đa hình. Hệ số tương đồng giứa hai loài G.hirsutum và G.arboreum là 0.59, khi so sánh hệ số tương đồng của các giống nhị bội G.arboreum (0.618) thấy nhỏ hơn của các giống tứ bội G.hirsutum (0.718). Trong số 19 chỉ thị ISSR tạo ra 72 băng đa hình, một mồi là đơn hình, 3 mồi không ghi được kết quả và không cho đa hình. Hệ số tương đồng giữa hai loài G.hirsutum và G.arboreum là 0.59 và cũng cho kết quả hệ số tương đồng của các loài tứ bội cao hơn các loài lưỡng bội [10]. I.5.2 Nghiên cứu đa dạng di truyền cây bông tại Việt Nam [6]. ở Việt Nam, Nguyễn thị Minh Nguyệt và cs (2009) đã nghiên cứu đa dạng di truyền của 49 giống bông địa phương và nhập nội, đại diện cho 3 nhóm bông Luồi (G.hirsutum L.), bông Hải Đảo (G.babardense L.), bông Cỏ (G.arboreum L.) sử dụng 50 cặp mồi SSR. Kết quả trong số 50 cặp mồi kiểm tra, có 27 cặp mồi cho đa hình với tổng số allen thu được là 128, độ tương đồng di truyền giữa các giống bông nằm trong khoảng 0.48-0.97 trung bình là 0.8, các cặp giống xa nhau nhất về di truyền (có hệ số tương đồng 48%) chủ yếu là những cặp bông Luồi-bông Hải Đảo. Đa dạng di truyền quan sát được trong nhóm các giống bông Luồi cao hơn so với 2 nhóm bông Hải Đảo và bông Cỏ. Cũng trong nghiên cứu này, 49 giống bông nghiên cứu đã chia làm 3 nhóm: nhóm 1 gồm 16 giống bông Hải Đảo, nhóm 2 gồm 21 giống bông Luồi, nhóm 3 gồm 12 giống bông Cỏ. Độ tương đồng di truyền của nhóm 1 với 2 nhóm bông còn lại thấp, chỉ khoảng 59%. Nhóm bông Luồi và bông Cỏ gần nhau về mặt di truyền hơn, với độ tương đồng di truyền khoảng 67%. Độ tương đồng di truyền giữa các giống bông trong cùng nhóm phân loại khá cao, trên 84%. Chương II: Vật liệu và phương pháp nghiên cứu II.1 Vật liệu II.1.1 Vật liệu thực vật Chúng tôi nghiên cứu 21 giống bông bao gồm: 11 giống bông luồi (G.hirsutum L.) và 10 giống bông Hải đảo (G.barbadense L.) chọn lọc từ tập đoàn giống của Viện nghiên cứu bông và PTNN Nha Hố. Bảng 1: Danh sách các giống bông Luồi Tt Tên giống MstĐ Nguồn gốc Năm thu thập 1 591 ấn Độ 1984 2 1358 Nam Mỹ 1999 3 1426 Nam Mỹ 1999 4 1458 Thái Lan 2000 5 1488 Thái Lan 2000 6 1490 Thái Lan 2000 7 1503 Thái Lan 2000 8 1516 Thái Lan 2000 9 1530 Trung Quốc 2000 10 1562 Trung Quốc 2000 11 1598 Trung Quốc 2001 Bảng 2: Danh sách các giống bông Hải Đảo tt Tên giống MstĐ Nguồn gốc Năm thu thập 1 10 Ai cập 1965 2 62 ấn độ 1984 3 128 Ai cập 1984 4 129 Ai cập 1984 5 138 Ai cập 1984 6 139 Ai cập 1984 7 141 agy 1984 8 147 agy 1984 9 148 Zaf 1984 10 156 Zaf 1984 Chú thích: MSTĐ: mã số tập đoàn II.1.2 Hóa chất, thiết bị II.1.2.1 Hóa chất Các hóa chất thông dụng dùng trong nghiên cứu sinh học phân tử: CTAB, NaCl, Taq polymeraza, dNTP, PVP, BSA, Tris- HCl, Na2-EDTA, DIECA, β- mercaptoethanol, Ascorbic acid, Etanol 100%, NaOAc (sodium acetat), isoamyl alcohol, chloroform, isopropanol, ethidium bromide (EtBr)... II.1.2.2 Thiết bị Máy li tâm, máy nghiền mô, máy PCR Veriti 96 well thermal cycler, máy quang phổ Nanodrop, tủ hút... II.1.3 Chỉ thị ssr Các cặp mồi ssr (20 cặp) được chọn lọc từ cặp mồi đã được lập bản đồ trên hệ genome cây bông(Cotton Marker Database: Cotton Genome database: 10 9 8 7 6 5 4 3 2 1 TT Bảng 3: Thông tin mồi SSR BNL1673 BNL3257 BNL2895 BNL2821 BNL2590 BNL2495 BNL2449 BNL1611 BNL1604 BNL1551 Tên mồi CTCTTAATGCTTGGCCTTGG CAATCTGGGATCAAAAAAACC CGATTTTACTGCTTCAGACTTG TGTTTTTGCATCATCCTTGC GAAAAACCAAAAAGGAAAATCG ACCGCCATTACTGGACAAAG ATCTTTCAAACAACGGCAGC CAATGAACAAAAAATGTAAGGG AGAGGGAGTAAAGATTTGGGG CGCAAGCCACCTGTAAAAC Forward primer Trình tự mồi AGTACCGGACTCGGCACTAT GGTGAAACATAGCGTGTTGC TACCATCTCACGGATCCACA TGTAGGAACAACATGCCCAA CTCCCTCTCTCTAACCGGCT AATGGAATTTGAACCCATGC CGATTCCGGACTCTTGATGT TGGGCATTTAGCCATTTACC TCCAGTTCTTTTTGCCTTGG TCGAATTTTCTCTCTCTCTCTCTCT Reverse primer 20 19 18 17 16 15 14 13 12 11 TT Bảng 3: Thông tin mồi SSR(tiếp theo) NAU3377 NAU3171 NAU2556 JESPR296 BNL4059 BNL3599 BNL3816 BNL1693 BNL3379 BNL3261 Tên mồi TGCAAGGAATCAAGTTCACA AATATGGAGATCACCCCTCA GAGAAGTTAGTTACTTGCAT GGGTGTTACATAGAGTGTATAAAATTG GAGTTACGCCTGGCAATCAT TTTAGCCCCAGTAACATGCC GTTAGCCACGTGTTAGTTCTATG CCCTTGGGAATAGCAGGTG AACGGAACAAACCTTGAGGA AAACGGAAACGAAGAAGGGT Forward primer Trình tự mồi CTGATTGTACTTTGCGGGTA TGCTTTGGGGTTTGATATTT ATCAAGTTTTCAGGGCAATC TGACCTCAATTTAGAAACCC CCATCCCCAGTGGTGTTATC ACTGCAAGCTCTGCCCTAAA ATCGATCACTTGCTGGTTCC CATGTGTCTCCGTGTGTGTGTG GTGCATGTGGTATGTTGGGA CCCAAACCTGTCTCACCAAC Reverse primer II.2 Phương pháp nghiên cứu II.2.1 Tách chiết ADN tổng số ADN lá bông được tách chiết và tinh sạch theo phương pháp CTAB và Doyle và Doyle (1987) có cải tiến. II.2.1.1 Chuẩn bị vật liệu -Chuẩn bị mẫu lá non của mỗi giống: các tế bào lá non có cấu trúc màng tế bào dễ bị phá vỡ, sẽ thuận lợi khi tách chiết ADN. -Dung dịch đệm chiết Bảng 4: Thành phần đệm chiết Hóa chất Nồng độ Thể tích 1 M Tris- HCl pH 8.0 100 mM 100 ml 5 M NaCl 1.4 M 280 ml 0.5M Na2-EDTA, pH 8.0 20 mM 40 ml CTAB 2% (w/v) 20g PVP40 2% (w/v) 20g DIECA 0.1% 1g β- mercaptoethanol 0.2% (v/v) 2 ml Ascorbic acid 0.1% (w/v) 1g H2O Tổng số 1000 ml Hỗn hợp này có tác dụng: +Phá vỡ màng tế bào và màng nhân đồng thời giải phóng ADN ra ngoài. +Dung dịch Tris- HCl pH 8.0 làm ổn định pH dung dịch đệm chiết. +Na2-EDTA pH 8.0 có tác dụng gắn chặt các ion Mg++ là yếu tố cần thiết cho sự hoạt động của enzyme nucleaza, làm bất hoạt enzyme này. +NaCl làm tăng khả năng hòa tan nucleic acid trong dung dịch. -Dung dịch đệm rửa: Hỗn hợp đệm rửa phải có nồng độ cồn cao, nồng độ muối cao để tránh cho ADN đã kết tủa bị hòa tan trở lại gây tổn thất ADN. Bảng 5: Thành phần Wash buffer I Hóa chất Nồng độ Thể tích Etanol 100% 76% 380 ml 1M NaOAc (sodium acetat) 0.2M 100 ml H2O 20 ml Tổng số 500 ml Bảng 6: Thành phần Wash buffer II Hóa chất Nồng độ Thể tích Etanol 100% 76% 380 ml 1M NaOAc (sodium acetat) 0.2M 100 ml H2O 20 ml Tổng số 500 ml -Các hóa chất và dụng cụ cần dùng khác... II.2.1.2 Quy trình tách chiết -Mẫu lá non được nghiền trong nitơ lỏng (-196oC) trong ống eppendorf 2 ml. Trong nitơ lỏng các mô bị đông cứng, dưới tác dụng của cơ học chúng dễ dàng bị phá vỡ. Ngoài ra ở nhiệt độ thấp các enzyme đều bị bất hoạt, tránh cho ADN bị phân hủy bởi enzyme Dnase có trong tế bào khi nghiền. -Thêm 1 ml dung dịch đệm chiết. -ủ 65oC trong 90 phút , cứ 15 phút lắc đều 1 lần. -Cho 500l chloroform: isoamyl alcohol (24:1), lắc nhẹ trong 5 phút, sau đó ly tâm 12.000 (vòng/phút) trong 15 phút. Trong quá trình này protein, polysaccharide, lipid và các chất hữu cơ khác bị biến tính. Khi ly tâm các chất này và xác tế bào tách ra khỏi hỗn hợp, còn lại phần dịch hòa tan ADN ở phía trên. -Chuyển phần dịch phía trên sang ống eppendorf mới, cho 500l isopropanol để tủa ADN. Ly tâm 12.000 (vòng/phút) trong 15 phút để thu tủa. -Rửa tủa bằng 500l Wash buffer I, sau đó ly tâm 12.000 (vòng/phút) trong 5 phút để thu tủa. -Tiếp tục rửa bằng 500l Wash buffer II, sau đó ly tâm 12.000 (vòng/phút) trong 5 phút để thu tủa. -Để khô ADN sau đó cho 50l TE -Khử ARN bằng cách cho thêm 4l RNAse/eppendorf trong tủ ấm 37oC trong 3h. II.2.1.3 Kiểm tra ADN tổng số Chất lượng và nồng độ ADN tổng số được kiểm tra trên gel agarose 0.8%. Nồng độ chính xác được đo trên máy quang phổ Nanodrop. Nếu ADN tách chiết có chất lượng tốt, khi kiểm tra trên gel agarose 0.8% chỉ có 1 vạch ADN quan sát được. Nếu ADN bị gãy vụn thành nhiều đoạn trong quá trình tách chiết thì trên gel agarose sẽ quan sát thấy có nhiều vạch ADN tương ứng với các đoạn có mức độ dài ngắn khác nhau. II.2.2 Phản ứng PCR II.2.2.1 Thành phần phản ứng PCR: Mỗi phản ứng PCR bao gồm các thành phần được trình bày ở bảng sau: Bảng 7: Thành phần phản ứng PCR tt Thành phần Thể tích l 1 50 ng ADN tổng số 3 2 0.15 M mồi 3 3 0.2 M dNTPs 1.5 4 1X dịch đệm PCR 1.5 5 Taq 16X 0.75 6 PVP 10% 1.5 7 BSA 10% 1.5 8 H2O 2.25 Tổng thể tích 15 II.2.2.2 Chương trình chạy PCR: Tiến hành phản ứng PCR lần lượt từng mồi đối với ADN tổng số của 21 giống. Phản ứng PCR được tiến hành trên máy Veriti 96 Well Thermal Cycler. Tổng thể tích dung dịch phản ứng là 15 μl Bảng 8: Chương trình chạy PCR Các bước Nhiệt độ( oC ) Thời gian 1 95 5 phút 2 94 30 giây 3 55 30 giây 4 72 2 phút 5 Lặp lại 35 chu kỳ (các bước 2,3,4) 6 4 II.2.3 Điện di, phát hiện sản phẩm Phương pháp điện di tiến hành theo phương pháp điện di trên gel agarose của Khoa Genome thực vật, Trường Đại học công nghệ Texas Mỹ 2004 có cải tiến. II.2.3.1 Nguyên tắc Trong quá trình điện di do ADN tích điện (-) nên các băng ADN sẽ di chuyển từ phía cực (-) sang phía cực (+) của bể điện di. Điện áp càng cao ADN di chuyển càng nhanh. Thời gian điện di tùy thuộc vào kích thước sản phẩm PCR. Sau khi kết thúc điện di các băng ADN có kích thước khác nhau sẽ được phân tách do chúng có tốc độ di chuyển khác nhau. Có thể quan sát thấy khi chụp ảnh gel. II.2.3.2 Chuẩn bị gel agarose Gel agarose: là một loại polymer tách từ rong biển, cấu tạo bởi 2 monomer là D-galactose và 3,6-anhydro-L-galactose. -Bột agarose được hòa tan trong dung dịch đệm theo đúng tỷ lệ (đối với kiểm tra ADN tổng số, gel agarose được chuẩn bị với nồng độ 0.8%, đối với kiểm tra sản phẩm PCR, gel agarose được chuẩn bị với nồng độ 3.5%) -Đun sôi dung dịch agarose bằng lò vi sóng. -Hạ nhiệt độ sôi của gel xuống khoảng 50oC -Bổ sung Ethidium bromide (EtBr) có nồng độ 0.5g/ ml. Quan sát chất này khi chiếu đèn cực tím nó phát huỳnh quang màu cam, khi EtBr liên kết với ADN cường độ màu có thể tăng lên gần 20 lần. -Chuẩn bị khay gel và lược. -Rót hỗn hợp gel agarose EtBr vào khay gel, cắm lược. Thời gian chờ gel đông là 45-60 phút. Gel trước khi đổ vào khay phải không có bọt. Nếu như có bọt sẽ làm ảnh hưởng đến kết quả của ảnh gel không được đẹp. II.2.3.3 Điện di sản phẩm PCR Sau khi chuẩn bị gel xong tiến hành điện di theo các bước sau: -Tra mẫu ADN -Chuẩn bị dung dich đệm TBE 0.5X cho vào bể chạy điện di. -Chạy điện di tại 100 mA -Rửa gel trong nước, đặt gel vào máy soi UV và chụp ảnh. II.2.4 Phương pháp phân tích số liệu: phương pháp phân tích đa dạng di truyền bằng phần mềm NTSYS pc v.2.1 ( Biostatistics Inc, 2002) Gel điện di sản phẩm của phản ứng PCR được soi trên máy UV và chụp ảnh. ảnh gel được dùng để nhận dạng ADN của từng các thể, sau đó so sánh nhận dạng ADN giữa các giống để phân tích đa dạng di truyền, thể hiện thông qua: -Hệ số PIC (Polymorphic Information Content) được coi là thước đo tính đa dạng di truyền của các alen ở từng locus SSR. Weir (1996) cho rằng, giá trị PIC có thể được coi như là sự đa dạng di truyền của locus gen nghiên cứu và tính theo phương trình [13]: Trong đó: Pij : là tần số xuất hiện của alen thứ j tương ứng với mồi i. Giá trị PIC càng lớn tức là mức độ đa hình của locus do mồi i khuếch đại càng lớn, tức là càng nhiều allen được sinh ra. -Hệ số tương đồng di truyền S [3]: phản ánh mức độ giống nhau và khác nhau giữa các giống. Cơ sở để tính toán hệ số này là mô hình toán Nei và Li (1979) như sau: Trong đó: S: là hệ số tương đồng( hệ số khác nhau là ) Nxy: là số băng cùng vị trí của mẫu x và y Nx, Ny: là số băng AND của mẫu x và y Trong trường hợp số lượng mẫu ít, hệ số tương đồng có thể tính thủ công; tuy nhiên người ta có thể sử dụng phần mềm NTSYS để thay cho việc tính thủ công và trong trường hợp số lượng mẫu quá lớn. Sau khi nhận dạng ADN, bảng dữ liệu nhị phân được chuẩn bị gồm các số 0 và 1, trong đó 0 là không có băng ADN và 1 là có băng ADN ở cùng một vị trí. Bảng dữ liệu nhị phân này sẽ được nhập vào chương trình NTSYS để cho ra bảng hệ số tương đồng S và sơ đồ hình cây biểu thị mối liên kết di truyền giữa 21 giống bông nghiên cứu. Ví dụ khi kiểm tra đa dạng di truyền của 5 đối tượng, sử dụng một cặp mồi SSR, có sơ đồ nhận dạng ADN như sau: A B C D E 1 2 3 Từ đó ta có bảng dữ liệu nhị phân : A B C D E 1 1 0 0 0 1 2 0 1 1 0 0 3 0 0 0 1 0 Trong thực tế để cho kết quả đánh giá đa dạng di truyền chính xác thì phải tiến hành phản ứng và nhận dạng với nhiều mồi khác nhau; nên bảng dữ liệu nhị phân sẽ là tập hợp các bảng dữ liệu của các mồi mà ta tiến hành nhận dạng ADN. Chương III : Kết quả nghiên cứu và thảo luận III.1 Kết quả tách chiết ADN tổng số III.1.1 Mục đích Tách chiết ADN tổng số là công việc đầu tiên, đóng vai trò quan trọng trong nghiên cứu genome của sinh vật. 21 giống bông sau khi tách chiết ADN tổng số sẽ được sử dụng làm khuôn ADN trong phản ứng PCR-SSR để phân tích đa dạng di truyền. III.1.2 Các bước tiến hành Tách chiết ADN tổng số của 21 giống bông được thực hiện theo phương pháp CATB và Doyle và Doyle (1987) có cải tiến đã miêu tả ở mục (II.2.1). Kết quả tách chiết và xác định nồng độ ADN tổng số được kiểm tra bằng phương pháp điện di trên gel agarose 0.8% và bằng máy Narodrop như đã nêu ở mục (II.2.3 ). Trong thành phần đệm chiết dùng để tách ADN thì CTAB đóng vai trò vô cùng quan trọng. CTAB là chất tẩy mạnh, có tính chất lưỡng cực, nó kết hợp với protein màng và các phân tử phospholipid làm phá vỡ cấu trúc của màng tế bào và màng nhân, giải phóng ADN ra ngoài . Hơn thế CTAB có khả năng tách ADN ra khỏi polysaccharit vì ADN và polysaccharit có khả năng hòa tan khác nhau trong đệm chiết có CTAB. ADN có thể kết hợp với CTAB trong đệm chiết tạo thành phức hợp ADN-CTAB, phức hợp này tan vào dung dịch có nồng độ muối > 0.7 M nhưng sẽ kết tủa trong dung dịch có nồng độ muối < 0.4 M. Dựa vào đó ta có thể tách ADN ra khỏi protein, polysaccharit và các thành phần khác của dung dịch. Sau khi tách chiết ADN thu được phải tinh sạch, không chứa ARN và các chất ức chế phản ứng còn sót trong quá trình tách (CTAB, chất ức chế từ mẫu như là các sắc tố ...), tránh khi sử dụng làm khuôn ADN sẽ ảnh hưởng đến kết quả phản ứng PCR. ADN được kiểm tra nồng độ chính xác bằng máy quang phổ Nanodrop. Máy Nanodrop hoạt động dựa theo nguyên tắc của phương pháp quang phổ hấp thụ: Các bases purin và pyrimidin hấp thụ mạnh ánh sáng tử ngoại ở bước sóng 260 nm. Do đó giá trị mật độ quang ở bước sóng 260 nm (A260) của các mẫu cho phép xác định hàm lượng acid nucleic trong mẫu dựa vào mối tương quan: Một đơn vị A260 tương ứng với nồng độ 50 ng/l cho dung dịch chứa ADN sợi đôi: Hàm lượng ADN (ng/l) = A260 50 hệ số pha loãng Để kiểm tra độ tinh sạch của mẫu ADN tách chiết thông qua tỷ số A260/A280. Dung dịch acid nucleic coi là sạch khi tỷ số A260/A280 dao động trong khoảng 1.8- 2.0. Để bảo đảm chất lượng ADN sau khi tách chiết, ADN được bảo quản trong điều kiện -20oC, quá trình thí nghiệm ở điều kiện 4oC. III.1.3 Kết quả và nhận xét III.1.3.1 Kiểm tra chất lượng, độ tinh sạch ADN tổng số bằng điện di trên gel agarose 0.8% và máy Nanodrop Hình 1: ảnh điện di ADN tổng số của 21 giống bông ảnh điện di ADN tổng số của 21 giống bông cho thấy chỉ có một băng duy nhất, ADN không bị đứt gãy trong quá trình tách chiết, không còn sót ARN. Độ tinh sạch của ADN kiểm tra đạt yêu cầu. Chất lượng ADN sau tách chiết tốt, nồng độ cao, đủ tiêu chuẩn sử dụng cho phản ứng PCR. I.1.3.2 Kiểm tra nồng độ ADN tổng số bằng máy Nanodrop Nồng độ chính xác của các mẫu ADN được đo bằng máy quang phổ Nanodrop, kết quả được trình bày tại bảng 9. Bảng 9: Nồng độ ADN tổng số của 21 giống bông Tên giống Nồng độ (ng/l) Tên giống Nồng độ (ng/l) Mẫu 1 Mẫu 2 Mẫu 3 Mẫu 1 Mẫu 2 Mẫu 3 L1358 1900 1850 1250 L1503 2205 3050 2350 L1426 1600 1700 1500 L1516 1500 980 1170 HĐ10 2350 4200 2300 L1530 670 1590 2150 HĐ62 4600 3300 4100 HĐ141 4100 3600 3800 HĐ128 2800 3350 3400 L1562 2840 1660 3000 L1458 2970 2400 2250 HĐ147 4200 2250 2400 HĐ129 1300 4900 500 L1598 2250 2490 3630 L1488 2000 2150 2170 HĐ148 250 1850 3300 L1490 1890 1720 1480 HĐ156 1500 1800 3000 HĐ138 3600 4600 4100 L591 2050 HĐ139 2400 4000 2500 III.2 kết quả phản ứng PCR của 20 cặp mồi SSR III.2.1 Mục đích Kết quả thu nhận sản phẩm PCR bằng 20 cặp mồi SSR sau khi điện di, chụp ảnh gel, nhận dạng các băng ADN, phục vụ cho phân tích đa dạng di truyền. III.2.2 Các bước tiến hành Sau khi tách chiết ADN tổng số, ADN được pha loãng về nồng độ 50ng/l sử dụng để tiến hành phản ứng PCR lần lượt với các mồi SSR được lựa chọn với thành phần và chu kỳ PCR như đã nêu ở mục (II.2.2), sau đó điện di sản phẩm trên gel agarose 3.5% và chụp ảnh gel, các bước tiến hành như đã nêu ở mục (II.2.3). Trong thành phần hỗn hợp cho phản ứng PCR trên đối tượng cây bông ngoài các thành phần cơ bản của phản ứng (mục I.4.2.1) còn có thêm có 2 thành phần là PVP, BSA: vì trong thành phần tế bào cây bông có nhiều hợp chất polysaccharit, quá trình tách chiết và tinh sạch ADN có thể còn sót lại, hai chất này có tác dụng phân hủy chúng trong phản ứng PCR. Khi chuẩn bị hỗn hợp này cần chú ý là cho Taq 16X vào sau cùng và cho ngay vào hỗn hợp phản ứng của 21 giống đã chuẩn bị trước đó để tiến hành phản ứng trong máy PCR, tránh để ở ngoài quá lâu Taq 16X bị hỏng do enzyme này rất nhạy cảm ở điều kiện thường. Kết quả của phản ứng PCR ảnh hưởng rất nhiều bởi các yếu tố gây tạp nhiễm do vậy phản ứng cần tiến hành ở điều kiện sạch, các dụng cụ phải được khử trùng trước khi tiến hành, hóa chất đảm bảo độ tinh khiết đủ yêu cầu. III.2.3 Kết quả Một số ảnh chụp gel điện di sản phẩm của phản ứng PCR với mồi SSR Hình 2: ảnh điện di của mồi JESPR 296 Hình 3: ảnh điện di của mồi BNL1551 Hình 4 : ảnh điện di của mồi BNL4059 Hình 5: ảnh điện di của mồi BNL3261 Hình 6: ảnh điện di của mồi BNL3379 Hình 7: ảnh điện di của mồi BNL2590 Hình 8: ảnh điện di của mồi BNL1604 Chú thích: Số 1-21 là thứ tự các mẫu giống bông. III.2.4 Nhận xét kết quả Quan sát ảnh gel thu được thấy các băng ADN hiện khá rõ, một số giếng gel ở một vài locus còn bị khuyết. Tuy nhiên đa phần các mẫu cho thấy phản ứng PCR có kết quả tốt, dễ dàng nhận thấy đa hình III.3 nhận dạng ADN III.3.1 Mục đích Sản phẩm phản ứng PCR sau khi chụp ảnh gel, nhận dạng ADN, phát hiện các băng đa hình. Kết quả nhận dạng ADN được dùng để tính hệ số PIC, ghi điểm xây dựng ma trận nhị phân. III.3.2 Các bước tiến hành Sau khi thu nhận ảnh gel, tiến hành nhận dạng băng ADN đa hình. Trong quá trình nhận dạng những băng ADN nào có cùng kích thước sẽ xếp cùng một vị trí như ví dụ đã nêu ở mục (II.2.4) III.3.3 Kết quả BNL2449 BNL1611 BNL1604 BNL1551 locus Hình 9: Sơ đồ nhận dạng ADN của 21 giống bông 4 3 2 1 2 1 4 3 2 1 3 2 1 Số allen ---------Locus 1 Thứ tự các giếng trên gel agarose 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 JESPR296 BNL3816 BNL2812 BNL3261 BNL3257 locus Hình 9: Sơ đồ nhận dạng ADN của 21 giố

Các file đính kèm theo tài liệu này:

  • docĐồ án - Tùng.doc
  • docbìa đồ án.doc
  • docdanh mục bảng và hình.doc
  • doclời cảm ơn.doc
  • docmục lục.doc
  • doctừ viết tắt.doc
Tài liệu liên quan