Luận án Nghiên cứu đặc điểm bệnh lý của chó mắc bệnh viêm ruột tiêu chảy do virus parvo type 2 (cpv2) gây ra và đặc điểm sinh học phân tử của một số chủng CPV2 lưu hành tại miền Bắc Việt Nam

MỤC LỤC

Trang

Lời cam đoan . i

Lời cảm ơn . ii

Mục lục . iii

Danh mục chữ viết tắt . vi

Danh mục bảng . viii

Danh mục hình . ix

Trích yếu luận án . xi

Thesis abstract . xiii

Phần 1. Mở đầu . 1

1.1. Tính cấp thiết của đề tài nghiên cứu . 1

1.2. Mục tiêu nghiên cứu . 2

1.2.1. Mục tiêu tổng quát . 2

1.2.2. Mục tiêu cụ thể . 2

1.3. Phạm vi nghiên cứu . 3

1.3.1. Đối tượng nghiên cứu . 3

1.3.2. Thời gian nghiên cứu . 3

1.3.3. Địa điểm nghiên cứu . 3

1.4. Các đóng góp mới của đề tài . 3

1.5. Ý nghĩa khoa học và thực tiễn của đề tài . 3

1.5.1. Ý nghĩa khoa học . 3

1.5.2. Ý nghĩa thực tiễn . 3

Phần 2. Tổng quan tài liệu . 4

2.1. Đặc điểm sinh học của vi rút parvo . 4

2.1.1. Cấu tạo chung . 4

2.1.2. Vị trí xếp loại . 5

2.1.3. Nguồn gốc của các chủng CPV2 . 5

2.2. Bệnh viêm ruột tiêu chảy do vi rút parvo trên chó . 7

2.2.1. Dịch tễ học . 7

2.2.2. Bệnh học . 9

2.2.3. Triệu chứng lâm sàng . 10

2.2.4. Bệnh tích . 11

2.2.5. Chẩn đoán . 16

2.2.6. Điều trị . 18

2.2.7. Phòng bệnh . 21

2.3. Các nghiên cứu trong nước và trên thế giới . 23

2.3.1. Các nghiên cứu trong nước . 23

2.3.2. Các nghiên cứu trên thế giới . 27

pdf151 trang | Chia sẻ: minhanh6 | Ngày: 13/05/2023 | Lượt xem: 1137 | Lượt tải: 2download
Bạn đang xem trước 20 trang tài liệu Luận án Nghiên cứu đặc điểm bệnh lý của chó mắc bệnh viêm ruột tiêu chảy do virus parvo type 2 (cpv2) gây ra và đặc điểm sinh học phân tử của một số chủng CPV2 lưu hành tại miền Bắc Việt Nam, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
ạch lympho. Mổ tử cung và âm đạo để quan sát màu sắc, độ rắn, lở loét, sẹo... Bàng quang (bóng đái): kiểm tra trạng thái tương mạc, số lượng và tính chất của chất chứa bên trong, trạng thái niêm mạc bàng quang. Trực tràng: kiểm tra tương mạc, niêm mạc và trạng thái phân bên trong. - Mổ kiểm tra hộp sọ và não: cố định đầu con vật rồi lột da và cơ vùng trán rồi cưa một đường ngang sau lồi xương đỉnh, sau đó từ hai bên xương đỉnh men theo xương thái dương hai bên tới giáp phần dưới mũi. Lấy dao nạy xương sọ theo các đường cắt để bộc lộ não. Dùng ngón tay luồn dưới não nhẹ nhàng nâng não lên, dùng chuôi dao luồn xuống dưới bẩy nhẹ não, sau đó luồn kéo cắt đứt các dây thần kinh khác. 42 Các biến đổi bệnh tích đại thể bệnh viêm ruột tiêu chảy do vi rút parvo được xác định và thu thập qua mổ khám những chó mắc bệnh. Xử lý mẫu: lấy toàn bộ các cơ quan như hệ thống hạch lympho gồm hạch amidan, hạch dưới hàm, hạch bẹn nông, hạch màng treo ruột, thực quản, dạ dày, ruột non, ruột già, gan, lách, phổi, thận, Bệnh phẩm sau khi lấy cần cố định ngay trong dung dịch formol 10% pH trung tính (pH 7.0-7.2) để quan sát và đánh giá tổn thương vi thể và sử dụng trong nhuộm hóa mô miễn dịch. Mẫu huyết thanh bảo quản ở nhiệt độ từ 4 oC đến 8 oC tối đa trong 7 ngày. Mẫu bệnh phẩm được lưu ở nhiệt độ -20 oC đến -80 oC dùng để chẩn đoán phát hiện vi rút parvo bằng phản ứng real-time PCR, PCR hoặc phân lập vi rút. 3.3.5. Phương pháp làm tiêu bản bệnh lý vi thể Tiến hành thu mẫu các cơ quan như hạch, dạ dày, ruột, gan, phổi, thận, , ngâm trong dung dịch formol trung tính 10%. Phương pháp làm tiêu bản vi thể theo quy trình tẩm đúc bằng paraffin, nhuộm Haematoxilin - Eosin (HE) thường quy tại phòng thí nghiệm bộ môn Bệnh lý thú y, Học viện Nông nghiệp Việt Nam gồm các bước như sau: - Chuẩn bị Dụng cụ và hoá chất: Lọ chứa dung dịch formol trung tính 10%, dao, kéo, panh kẹp, cốc đựng hoá chất, phiến kính, máy đúc block, khuôn đúc, tủ ấm 37 oC, máy cắt mảnh microtome, nước ấm 48oC, xylen, paraffin, các dung dịch cồn, thuốc nhuộm Haematoxilin, Eosin... Lấy bệnh phẩm: Bệnh phẩm là ruột, tim, hạch lympho, gan, lách,... - Cố định bệnh phẩm Ngâm miếng tổ chức vào dung dịch formol trung tính 10% (chú ý bệnh phẩm phải ngập trong formol, lượng formol trung tính sử dụng cần gấp 3-5 lần thể tích mẫu). - Vùi bệnh phẩm Tiến hành lần lượt các bước sau: + Rửa formol: Lấy tổ chức ra khỏi bình formol 10%, cắt thành các miếng có chiều dài, rộng khoảng 4 - 5mm cho vào khuân đúc bằng nhựa (cassette). Đem rửa dưới vòi nước chảy nhẹ trong 24 giờ để rửa sạch formol. 43 + Đưa mẫu vào hệ thống máy chuyển đúc mẫu tự động trong 18 tiếng. Lấy mẫu ra và tiến hành đúc block. + Hệ thống máy chuyển đúc mẫu tự động gồm 12 bình Bảng 3.2. Hệ thống máy chuyển đúc mẫu tự động Bình Hóa chất Thời gian (giờ) 1 Cồn 600o 1:00 2 Cồn 60o 1:00 3 Cồn 70o 1:30 4 Cồn 80o 1:30 5 Cồn 96o 1:30 6 Cồn 100o 1:30 7 Cồn 100o 1:30 8 Cồn 100o 1:30 9 Xylen 1:30 10 Xylen 1:30 11 Paraffin 2:00 12 Paraffin 2:00 - Đúc block Mục đích: để vùi miếng tổ chức trong môi trường paraffin thuần nhất tạo thành một thể thống nhất. Chuẩn bị: Máy đúc block, máy làm lạnh block, paraffin. Phương pháp tiến hành: Đặt miếng bệnh phẩm nằm theo ý muốn vào chính giữa khuôn block đổ nhanh paraffin lỏng vào block. Đặt khuôn đã đúc sang bàn lạnh của máy làm lạnh block, để lạnh từ từ đến khi đông cứng. - Cắt dán mảnh Chuẩn bị: máy cắt, dao cắt, nước ấm 48 oC, phiến kính, panh kẹp... Cắt mảnh: cắt bằng máy microtom với độ mảnh cắt khoảng 3-5µm, sao cho mảnh cắt không rách, nát phần tổ chức. Tãi mảnh: Sau khi cắt được, dùng panh kẹp mảnh cắt đặt vào nước lạnh sau đó dùng phiến kính trong, sáng, không xước hớt mảnh cắt cho sang nước ấm 48 o C rồi lấy kính vớt mảnh cắt sao cho vị trí mảnh cắt ở 1/3 phiến kính. Sau đó để tủ ấm 37oC đến khi bệnh phẩm khô là có thể đem nhuộm được. 44 Cách tiến hành: Bước 1: Chuẩn bị mẫu. Mẫu đạt tiêu chuẩn với độ dày 2-4µm và được để khô trong tủ ấm 37oC. Trước khi nhuộm bỏ tiêu bản ra ngoài nhiệt độ phòng 15 phút. Bước 2: Khử paraffin Ngâm tiêu bản lần lượt qua các dung dịch xylen: Xylen 1: trong 5 phút Xylen 2: trong 5 phút Xylen 3: trong 5 phút Bước 3: Khử xylen Chuyển tiêu bản qua cồn ở các nồng độ khác nhau, lần lượt: Cồn 100o: 10s Cồn 100o: 10s Cồn 90o: 10s Cồn 70o: 10s Bước 4: Khử cồn Rửa nước 5 phút Lau khô từng tiêu bản, xếp ngửa lên giá chuẩn bị nhuộm Bước 5: Nhuộm bằng thuốc nhuộm Hematoxylin Dùng ống hút, hút Hematoxylin nhỏ lên từng tiêu bản, đảm bảo thuốc nhuộm bao phủ hết phần tổ chức của tiêu bản. Thời gian từ 5-7 phút Rửa nước 5 phút trước khi nhúng qua dung dịch cồn 70o. Bước 6: Nhuộm bằng thuốc nhuộm Eosin Dùng ống hút, hút Eosin nhỏ lên từng tiêu bản Thời gian nhuộm 3-5 phút Bước 7: Nhúng các tiêu bản qua cồn ở các nồng độ khác nhau, lần lượt Cồn 70o: 10s Cồn 90o: 5 phút Cồn 100o: 5 phút Cồn 100o: 5 phút 45 Bước 8: Xylen Xylen 1: 10 phút, xylen 2: 10 phút Bước 9: Gắn lamen Đọc kết quả: Các tiêu bản được soi và đánh giá tổn thương dưới kính hiển vi quang học. 3.3.6. Phương pháp nhuộm hoá mô miễn dịch Quá trình nhuộm: Dụng cụ, hóa chất: Máy hấp, hệ thống cồn và xylen, dụng cụ bảo hộ, buồng tối, pipet, PBS, kháng thể CPV2 (LS – C57655), dung dịch pha loãng kháng thể, dung dịch DAB, dung dịch Sodium citrate buffer (pH 6.0); 0,05% Tween, dung dịch huyết thanh dê 10% (Normal goat serum 10%), dung dịch Simple stain MAX-PO, Peroxidase Blocking solution, dung dịch Hematoxylin, nước cất. Cách tiến hành: Bước 1: Chuẩn bị tiêu bản Chuẩn bị 3 tiêu bản: 2 tiêu bản chứa 2 lát cắt của block bệnh phẩm (kiểm tra trường hợp dương tính giả) và 1 lát cắt đối chứng (đã được xác định chính xác có vi rút CPV2 trong đó). Lát cắt phải đạt tiêu chuẩn với độ dày 2-4µm và được để khô trong tủ ấm 37oC. Trước khi nhuộm bỏ tiêu bản ra ngoài nhiệt độ phòng 15 phút. Bước 2: Làm sạch tiêu bản bằng hệ thống sau Bảng 3.3. Hệ thống nhuộm lần 1 Lọ Hóa chất Thời gian ngâm (phút) 1 Xylen 1 10 2 Xylen 2 10 3 Xylen 3 10 4 Cồn 100o 5 5 Cồn 100o 5 6 Cồn 90o 5 7 Cồn 70o 5 8 Cồn 60o 5 46 Bước 3: Rửa dưới vòi nước, để cho nước chảy qua lam kính 5 phút Bước 4: Lau khô tiêu bản và vẽ vòng tròn giúp cố định dung dịch khi nhỏ vào lam kính Bước 5: Khử men peroxydase nội sinh Dùng pipet hút 200 µl dung dịch Peroxidase Blocking solution (Ready-to- use, DAKO) nhỏ trực tiếp vào tiêu bản. Để lam kính vào buồng tối và ủ trong khoảng thời gian 30 phút. Bước 6: Rửa bằng dung dịch rửa PBS (5% Tween 20) 3 lần, mỗi lần 5 phút Bước 7: Giảm khả năng bắt cặp liên kết không đặc hiệu Pha loãng huyết thanh dê 10% (Normal goat serum 10%) với PBS Nhỏ 100µl huyết thanh dê đã pha vào lam kính để trong buồng tối 15 phút để loại bỏ các phản ứng không đặc hiệu. Bước 8: Rửa bằng dung dịch rửa PBS (5% Tween 20) 3 lần, mỗi lần 5 phút Bước 9: Nhỏ kháng thể sơ cấp Pha loãng kháng thể bằng dung dịch pha loãng để độ pha loãng 200 lần (1:200). Nhỏ 150µl kháng thể 1 đã pha vào slide mẫu và slide đối chứng, để ở nhiệt độ 4 0C trong ngăn mát tủ lạnh, thời gian 12-15 giờ hoặc để tủ ấm 37oC trong 1 giờ. Nhỏ 150µl dung dịch pha loãng kháng thể 1 vào mẫu đối chứng âm giúp kiểm tra quá trình thao tác làm. Bước 10: Rửa bằng dung dịch rửa PBS (5% Tween 20) 3 lần, mỗi lần 5 phút. Bước 11: Nhỏ kháng kháng thể (chứa enzyme bắt màu cơ chất) Nhỏ 50µl kháng kháng thể (Simple stain MAX-PO) vào mỗi slide, để ở nhiệt độ phòng, thời gian 30 phút. Bước 12: Rửa bằng dung dịch rửa PBS (5% Tween 20) 3 lần, mỗi lần 5 phút Bước 13: Nhuộm cơ chất bằng dung dịch DAB chromogen Nhỏ 120µl dung dịch DAB lên mẫu, chờ cho mẫu biến đổi màu sắc thì kết thúc và dừng phản ứng. Bước 14: Rửa bằng nước cất 2 lần, 5 phút 47 Bước 15: Nhuộm nhân tế bào bằng dung dịch Hematoxylin Nhỏ 1ml dung dịch Hematoxylin lên tiêu bản, để ở nhiệt độ phòng 1 phút Bước 16: Trút bỏ Hematoxylin và rửa tiêu bản bằng nước cất 2 lần trong 5 phút Bước 17: Rửa sạch tiêu bản qua hệ thống Bảng 3.4. Hệ thống nhuộm lần 2 Lọ Hóa chất Thời gian ngâm (phút) 1 Cồn 70o 5 2 Cồn 90o 5 3 Cồn 100o 5 4 Cồn 100o 5 5 Xylen 1 10 6 Xylen 2 10 7 Xylen 3 10 Bước 18: Lau khô tiêu bản, gắn lamen và quan sát tiêu bản dưới kính hiển vi quang học Đọc kết quả. Soi các tiêu bản dưới kính hiển vi quang học Dương tính: có điểm bắt màu nâu vàng hoặc nâu đỏ nằm bên trong tế bào trên tiêu bản vi thể. Âm tính: Không có màu nâu vàng hoặc nâu đỏ nằm bên trong tế bào trên tiêu bản vi thể. Mẫu cơ quan được kết luận có chứa vi rút khi cả 2 tiêu bản mẫu và mẫu đối chứng đều lên màu nâu và mẫu âm tính cùng lát cắt không lên màu. Để đánh giá mức độ phân bố kháng nguyên, tiêu bản của các cơ quan trong nghiên cứu được soi và đếm số lượng tế bào dương tính trên 10 vi trường có độ phóng đại 400 lần. Sau đó, kết quả trung bình của 10 lần đếm sẽ được sử dụng để xếp mức độ phân bố kháng nguyên. Theo đó: -: không có tế bào dương tính +: ít (có từ 1-10 tế bào dương tính) ++: trung bình (có từ 11-20 tế bào dương tính) +++: nhiều (có trên 20 tế bào dương tính) 48 3.3.7. Phương pháp PCR - Phương pháp tách chiết DNA tổng số Vi rút parvo có vật liệu di truyền là DNA, vì vậy cần tiến hành tách chiết DNA tổng số của các chủng vi rút bằng kit QIAamp DNA Mini Kit (Qiagen). Quy trình tách chiết được thực hiện như sau: Bước 1: Sử dụng pipet hút 20 µl Qiagen Protease (protein K) vào đáy ống ly tâm 1,5 ml Bước 2: Bổ sung 200 µl mẫu bệnh phẩm sau xử lý vào ống ly tâm 1,5 ml Bước 3: Bổ sung 200 µl Buffer AL vào ống chứa mẫu, trộn đều bằng máy lắc trong 15 giây Bước 4: Ủ các ống ở nhiệt độ 56oC trong 10 phút Bước 5: Ly tâm nhẹ các ống 1,5 ml để loại bỏ toàn bộ các giọt bám trên lắp ống xuống Bước 6: Thêm 200 µl ethanol (96-100%) vào mẫu và trộn đều trong 15 giây Bước 7: Chuyển toàn bộ dung dịch mẫu trong ống ly tâm 1,5 ml sang cột lọc QIAamp Mini spin column. Đóng nắp và ly tâm ở 8000 rpm trong 1 phút. Chuyển cột lọc sau ly tâm sang ống chứa 2ml sạch và loại bỏ ống chứa cũ. Bước 8: Cẩn thận mở nắp cột lọc và bổ sung 500 µl Buffer AW1, đóng nắp và ly tâm ống ở 8000 rpm trong 1 phút. Đặt cột lọc sang ống chứa 2ml mới và loại bỏ ống cũ. Bước 9: Cẩn thận mở nắp cột lọc và bổ sung 500 µl Buffer AW2. Đóng nắp và ly tâm ở 14,000 rpm trong 3 phút Bước 10: Đặt cột lọc sang ống chứa 2ml mới và ly tâm ở tốc đọ cao nhất trong 2 phút Bước 11: Chuyển cột lọc sang ống ly tâm 1,5ml mới, bổ sung 100 µl Buffer AE vào cột lọc, ủ ở nhiệt độ phòng trong 1 phút và ly tâm 8000 rpm trong 1 phút Các mẫu DNA thu được sẽ được giữ ở nhiệt độ -20 oC cho đến khi sử dụng. - Phương pháp PCR Mẫu DNA sau khi tách chiết sẽ được sử dụng cho phản ứng PCR. Thành phần một phản ứng PCR được thể hiện ở Bảng 3.5. 49 Bảng 3.5. Thành phần của phản ứng PCR Thành phần Thể tích (µl) - 2X PCR Master Mix solution (iNtRON) 10 - Mồi xuôi 1 - Mồi ngược 1 - Nước tinh khiết không chứa enzyme phân cắt DNA và RNA 5 - DNA 3 Tổng 20 Chu trình phản ứng PCR được thực hiện như sau: 95oC trong 5 phút; 35 chu trình (95 o C 30 giây; 50/55 o C 30 giây; 72 o C 1 phút); pha kéo dài 72 o C trong 7 phút và bảo quản sản phẩm ở 4oC. Các cặp mồi sử dụng trong nghiên cứu này là những cặp mồi đã được công bố trước đây (Moon & cs., 2020). Thông tin chi tiết về các cặp mồi được thể hiện trong Bảng 3.6. Bảng 3.6. Thông tin các cặp mồi sử dụng trong nghiên cứu Tên mồi Trình tự (5’-3’) Vị trí Kích thước (bp) Nhiệt độ gắn mồi ( ) ParvoVP2FL-F CGGTGCAGGACAAGTAAAAA 1755 50 ParvoVP2FL-R GGTGCTAGTTGATATGTAATA CPV 1F CTTCTTGTCTTTGACAGAGTGAA 224-246 1198 55 CPV 1R TGCTATAGCGTGACAA ACTTTA 1399-1420 CPV 2F ATCTTGCAAATTCTAGAACATGTCA 1344-1368 843 CPV 2R TTGCACGTCTTTGTGAGTAAC 2165-2185 CPV 3F ACGTAGTGGACCTTGCACTGGAA 2079-2101 776 CPV 3R GATCCTGTAGCTCTTTCATTTCT 2831-2853 CPV 4F AATCTTGCACCAATGAGTGA 2774-2793 1169 CPV 4R TGACCATGTTGTCTACCAAATGCAT 3918-3942 CPV 5F TATGAGACCAGCTGAGGTTGGTTA 3775-3798 821 CPV 5R AATTTTTCTAGGTGCTAGTTGATATGTAAT 4566-4595 50 2.3.8. Phương pháp điện di kiểm tra sản phẩm PCR Bước 1: Chuẩn bị dung dịch đệm và bản gel: Chuẩn bị thạch 1% Agarose: Hòa tan 1g agarose trong 100ml TBE 1X. Đun nóng hỗn hợp bằng lò vi sóng trong thời gian 2 phút để agarose tan hoàn toàn. Bổ sung 10 µl thuốc nhuộm gel Redsafe vào hỗn hợp, lắc đều tránh bọt khí và đổ thạch lỏng vào khuôn có cắm lược được cài sẵn để tạo bản gel với các giếng kiểm tra mẫu cần điện di, giữ ở nhiệt độ phòng từ 20-25 phút để thạch đông và tháo lược ra. Đặt thạch vào khoang điện di chứa dung dịch đệm TBE sao cho ngập mặt thạch khoảng 3-5 mm Bước 2: Tra mẫu điện di Mỗi sản phẩm PCR được sử dụng là 5 µl cho một giếng và tra 5 µl Marker, đối chứng dương, đối chứng âm theo thứ tự. Cài đặt máy điện di chạy với nguồn điện có hiệu điện thế 100V, cường độ 100mA, thời gian chạy điện di là 25 phút. Bước 3: Đọc kết quả Đặt bản gel vào máy phát tia UV để quan sát kết quả điện di. Vị trí các đoạn DNA được phát hiện bằng các vệt sáng, chụp ảnh và lưu kết quả. 2.3.9. Phương pháp giải trình tự gen và xây dựng cây phả hệ Kỹ thuật giải trình tự gen là quá trình xác nhận thành phần nucleotide của đoạn DNA cần nghiên cứu. Trong nghiên cứu này tôi tiến hành gửi các sản phẩm PCR đạt yêu cầu đến công ty 1 st BASE DNA Sequencing (Malaysia) để giải trình tự. Công ty giải trình tự gen theo phương pháp Sanger. Các trình tự gen được căn chỉnh và so sánh bằng phần mềm Genious Prime (https://www.genious.com/prime) và BioEdit. Cây sinh học phân tử được phân tích bằng phần mềm MEGA X, sử dụng phương pháp Neighbor-Joining với giá trị Bootstrap là 1000 (https://www.megasoftware.net). Các chủng CPV2 tham chiếu sử dụng trong nghiên cứu được thu thập từ dữ liệu ngân hàng gen thế giới (GenBank). 51 3.4. PHƯƠNG PHÁP XỬ LÝ SỐ LIỆU - Dùng kiểm định test T so sánh giá trị trung bình 1 mẫu hoặc so sánh trung bình của hai mẫu. - Để kiểm định sự quan hệ của hai yếu tố tôi dùng kiểm định chi bình phương. - Sử dụng phần mềm thống kê SAS để thông kê và xử lý số liệu. - Sử dụng ứng dụng Excel. - Dữ liệu trình tự gen thu được sẽ được phân tích xử lý bằng phần mềm Bioedit) và MEGA (Molecular Evolutionary Gentics Analysis version 7.0). 52 PHẦN 4. KẾT QUẢ VÀ THẢO LUẬN 4.1. NGHIÊN CỨU ĐẶC ĐIỂM BỆNH LÝ CỦA CPV2 TRÊN CHÓ 4.1.1. Tỷ lệ chó mắc viêm ruột tiêu chảy do CPV2 ở chó theo từng địa phương Qua khảo sát 681 con chó có biểu hiện lâm sàng như mệt mỏi, nôn mửa, tiêu chảy, phân lẫn máu tại các phòng khám thú y ở 4 địa phương trong thời gian từ tháng 06/ 2017 đến tháng 09/2020, xác định tỷ lệ mắc VRTC do CPV2 bằng kit test nhanh (Canine parvovirus One - step Test Kit), kết quả được trình bày ở bảng 4.1. Bảng 4.1. Tỷ lệ chó mắc viêm ruột tiêu chảy do CPV2 theo địa phương Địa phương Số chó đến khám (con) Số chó mắc VRTC do CPV2 (con) Tỷ lệ mắc (%) Hà Nội 306 42 13,73 Vĩnh Phúc 131 23 17,56 Bắc Giang 136 25 18,38 Bắc Ninh 108 18 16,67 Tổng số 681 108 15,86 Kết quả cho thấy tỷ lệ chó mắc VRTC do CPV2 tại một số tỉnh Miền Bắc Việt Nam là 108/681 (15,86%), trong đó tỷ lệ bệnh do vi rút parvo ở chó cao nhất là ở Bắc Giang (18,38%) và thấp nhất là Hà Nội (13,73%), tuy nhiên không có sự khác nhau có ý nghĩa giữa các địa phương (P>0,05). Tỷ lệ chó mắc VRTC do CPV2 trên chó tại một số tỉnh Miền Bắc cao hơn so với kết quả nghiên cứu của các tác giả trước đây. Theo Terzungwe & cs. (2018) tỷ lệ mắc VRTC do CPV2 là 9% năm 2016 và năm 2012 là 25,8%. Nguyễn Thị Yến Mai & cs. (2018) cho biết tỷ lệ chó mắc VRTC do CPV2 là 9,57%. Nguyên nhân khiến tỷ lệ chó mắc VRTC do CPV2 tại một số tỉnh Miền Bắc cao do đối tượng khảo sát là những chó đã có triệu chứng về tiêu hóa. Địa điểm nghiên cứu là các phòng khám thú y nên việc chẩn đoán bệnh được thực hiện với độ chính xác và tin cậy cao hơn. Ngoài ra, địa điểm nghiên cứu trải ở nhiều tỉnh, trong khi đó việc phòng bệnh bằng vắc xin còn chưa cao, các ca bệnh phức tạp ở các nhóm bệnh khác còn chưa được quan tâm (chủ yếu vẫn là nhóm bệnh tiêu hóa). 53 Tỷ lệ chó mắc VRTC do CPV2 trong nghiên cứu này thấp hơn so với kết quả nghiên cứu của một số tác giả khác, theo nghiên cứu của Võ Thị Hải Lê & Trần Thị Cúc (2019), tỷ lệ chó mắc VRTC do CPV2 là 32,41%. Theo Nguyễn Hương Quỳnh & Võ Tấn Đại (2013), tỷ lệ này là 82,5%. Nguyên nhân khiến cho kết quả các kết quả trên cao là do ở điều kiện dịch tễ ở khu vực miền trung phức tạp, nhận thức về việc tiêm chủng của người dân chưa cao, từ đó tỷ lệ mắc bệnh cũng cao hơn. Ngoài ra nghiên cứu của Nguyễn Hương Quỳnh sử dụng phương pháp PCR cho những chó đã qua chẩn đoán sàng lọc ban đầu nên tỷ lệ dương tính với bệnh cao nhất. Hình 4.1. Chó bị viêm ruột tiêu chảy do CPV2 (hình trái) và kết quả chẩn đoán bằng kit test nhanh (hình phải) 4.1.2. Tỷ lệ chó mắc viêm ruột tiêu chảy do CPV2 theo lứa tuổi Kết quả nghiên cứu 108 con chó mắc VRTC do CPV2 (bảng 4.2) cho thấy có sự sai khác về tỷ lệ mắc CPV2 trên chó bị bệnh viêm ruột theo từng lứa tuổi 54 (P<0,05), trong đó tỷ lệ mắc VRTC do CPV2 ở lứa tuổi từ 2 đến 6 tháng là cao nhất với tỷ lệ 50%, tiếp theo là lứa tuổi từ 7 đến 12 tháng (28,7%) và thấp nhất là lứa tuổi dưới 2 tháng (6,48%). Theo Trần Thanh Phong (1996), chó con ở giai đoạn trên từ 2 đến 6 tháng tuổi là mẫn cảm nhất vì lúc này kháng thể do mẹ truyền sang con qua sữa đầu đã bắt đầu giảm dần, đây là thời điểm chó con trở nên dễ thụ cảm nhất với CPV2. Bảng 4.2. Tỷ lệ chó mắc viêm ruột tiêu chảy do CPV2 theo lứa tuổi Tháng tuổi Số chó mắc VRTC do CPV2 (con) Số chó mắc VRTC do CPV2 theo lứa tuổi (con) Tỷ lệ mắc (%) < 2 tháng 108 7 6,48 2-6 tháng 54 50,00 7-12 tháng 31 28,70 >12 tháng 16 14,82 Kết quả thu được trong nghiên cứu này cũng tương đồng với các kết quả nghiên cứu đã công bố trước đây của Simpson (1996); Behera & cs. (2015), Terzungwe & cs. (2018). Theo Nguyễn Thị Quyên & cs. (2018) tỷ lệ chó mắc bệnh do CPV2 đối với nhóm tuổi 2-6 tháng là cao nhất (51,35%). Kết quả nghiên cứu của Sử Thanh Long & cs. (2014) cũng cho thấy tỷ lệ chó mắc bệnh với nhóm tuổi này là 53,29%. Gombač & cs. (2008), đã nghiên cứu và báo cáo ở Slovenia, chó dưới sáu tháng tuổi có tỷ lệ mắc bệnh do CPV2 cao nhất, chiếm 67,6%, chó lớn hơn một năm tuổi có tỷ lệ mắc bệnh thấp nhất, chỉ 6,8%. Tuy nhiên kết quả này lại có sự khác biệt với các kết quả nghiên cứu trước đó của Kaur & cs. (2015) khi sử dụng kỹ thuật Nested polymerase chain reaction (nPCR) chẩn đoán bệnh CPV2. Theo Kaur & cs. (2015) đã báo cáo, tỷ lệ mắc VRTC do CPV2 trên chó cao nhất từ 0 đến 3 tháng tuổi là 60%; tiếp theo giai đoạn trên 3 đến 6 tháng tuổi là 30%; 6 đến 9 tháng tuổi là 4%; hơn 9 tháng tuổi là 6%. Kết quả nghiên cứu này cho thấy độ tuổi của chó có ảnh hưởng lớn đến tỷ lệ mắc VRTC do CPV2. Đây là một trong những dấu hiệu dịch tễ quan trọng trong việc sàng lọc ban đầu trên lâm sàng. So với các nghiên cứu trước đây, sự sai khác về tỷ lệ mắc VRTC do CPV2 có thể là do sự khác biệt về vùng miền dịch tễ và hơn nữa là do xã hội ngày nay người nuôi thú cưng từng bước đã biết cách cải thiện môi trường sống và nhu cầu dinh dưỡng của đàn chó theo hướng phù hợp với từng lứa tuổi đã giúp chúng phát triển tốt mạnh khỏe và ít bệnh. 55 4.1.3. Tỷ lệ chó mắc viêm ruột tiêu chảy do CPV2 theo giống Trong nghiên cứu này tỷ lệ chó mắc VRTC do CPV2 được phân tích theo giống chó nội và chó ngoại nhập (bao gồm giống ngoại thuần và lai) (bảng 4.3). Bảng 4.3. Tỷ lệ chó mắc bệnh viêm ruột tiêu chảy do CPV2 theo giống Giống Số chó mắc VRTC do CPV2 (con) Số chó mắc VRTC do CPV2 theo giống (con) Tỷ lệ mắc (%) Giống nội 108 27 25 Giống ngoại nhập 81 75 Qua khảo sát 108 chó mắc VRTC do CPV2, kết quả nghiên cứu cho thấy tỷ lệ nhiễm của các giống chó ngoại nhập là 75% cao hơn so với tỷ lệ mắc của các giống nội 25% (P<0.05). Kết quả của nghiên cứu này phù hợp với một số kết quả nghiên cứu đã công bố trước đây. Cụ thể kết quả nghiên cứu của Phan Thị Hồng Phúc & cs. (2019) cho thấy tỷ lệ mắc VRTC do CPV2 đối với chó ngoại là 39,90%, chó nội là 17,19%. Theo nghiên cứu của Võ Thị Hải Lê & Trần Thị Cúc (2019), tỷ lệ chó ngoại mắc bệnh do vi rút parvo cao (28,00%), chó nội có tỷ lệ mắc bệnh thấp hơn (25,41%). Đặng Thị Mai Lan & cs. (2019) cũng cho thấy tỷ lệ mắc bệnh CPV của giống chó nội là 22,54%, của giống chó ngoại là 31,12%. Nguyên nhân có thể là do giống bản địa có khả năng thích nghi và đề kháng với vi rút parvo mạnh hơn so với giống chó ngoại nhập. Nguyên nhân tiếp theo dẫn đến tỷ lệ mắc VRTC do CPV2 ở chó ngoại nhập cao hơn giống bản địa đó là điều kiện chăm sóc, nuôi dưỡng chưa tốt, người nuôi chó hầu hết chưa có kiến thức về tập tính hay nhu cầu dinh dưỡng, phương pháp chăm sóc cho ngoại. Nguyên nhân thường thấy đó là chó ngoại thường được nuôi nhốt, tập trung với mật độ cao tại các điểm mua bán nên nguy cơ lây nhiễm các loại bệnh cao hơn so với chó bản địa. Tuy nhiên kết quả về tỷ lệ lưu hành CPV2 theo giống chó thu được trong nghiên cứu này lại khác với các kết quả nghiên cứu của Castro & cs. (2007); Gombac & cs. (2008); Trần Ngọc Bích & cs. (2013). Cụ thể các công bố khoa học của các tác giả này cho thấy tỷ lệ chó mắc bệnh do CPV2 ở chó giống bản địa và chó giống ngoại nhập là tương đương nhau. 4.1.4. Tỷ lệ chó mắc viêm ruột tiêu chảy do CPV2 theo giới tính Một số nghiên cứu trước đây cho thấy tỷ lệ mắc VRTC do CPV2 ở chó đực luôn cao hơn chó cái. Cụ thể nghiên cứu của Trần Ngọc Bích & cs. (2013) cho 56 thấy tỷ lệ mắc VRTC do CPV2 trên chó đực là 53,01%, chó cái là 46,99%. Nghiên cứu của Nguyễn Văn Dũng & cs. (2018) tại thành phố Hồ Chí Minh cho thấy tỷ lệ chó đực bị bệnh do CPV2 là 51,06%, chó cái là 48,94%. Để đánh giá ảnh hưởng của giới tính đến tỷ lệ mắc VRTC do CPV2, trong nghiên cứu này, tiến hành khảo sát 108 chó mắc VRTC do CPV2 theo giới tính, nhận thấy tỷ lệ mắc vi rút parvo ở chó đực là (52,78%) cao hơn so với chó cái (47,22%) (bảng 4.4). Tuy nhiên sự sai khác này không có ý nghĩa về mặt thống kê (P> 0,05). Bảng 4.4. Tỷ lệ chó mắc bệnh viêm ruột tiêu chảy do CPV2 theo giới tính Số chó mắc VRTC do CPV2 (con) Số chó mắc VRTC do CPV2 theo giới tính (con) Tỷ lệ mắc (%) Đực 108 57 52,78 Cái 51 47,22 Kết quả thu được của nghiên cứu này tương đồng với kết quả nghiên cứu của Nguyễn Văn Dũng & cs. (2018) khi khảo sát 30 con chó bị tiêu chảy bằng phương pháp sinh học phân tử. Kết quả cho thấy có 13 con mắc CPV2 và không có sự khác biệt về tỷ lệ mắc theo giới tính. Theo Đặng Thị Mai Lan & cs. (2019), tỷ lệ mắc đối với chó đực là 26,82%, tỷ lệ này đối với giống chó cái là 28,92%. Kết quả nghiên cứu này cũng cho thấy, tỷ lệ mắc VRTC do CPV2 trên chó không phụ thuộc vào giới tính. 4.1.5. Tỷ lệ chó mắc bệnh viêm ruột tiêu chảy do CPV2 theo tình trạng tiêm vắc xin Xã hội ngày càng phát triển kéo theo nhu cầu giải trí tăng cao nên các nghiên cứu về chăm sóc nuôi dưỡng thú cưng càng ngày càng phát triển, người nuôi thú cưng được cung cấp nhiều kiến thức và kỹ năng chăm sóc, phòng trị bệnh cho đàn chó. Trong chăn nuôi thú cưng, việc tiêm phòng vắc xin để phòng bệnh là việc được chú trọng hàng đầu. Theo quy trình vắc xin, chó sẽ được tiêm mũi đầu tiên (5 trong 1) vào lúc 6 tuần, mũi thứ 2 vào lúc 9 tuần tuổi (7 trong 1) và mũi thứ 3 vào lúc 12 tuần tuổi (7 trong 1). Để đánh giá khả năng bảo hộ của vắc xin, tiến hành đánh giá tình hình tỷ lệ mắc VRTC do CPV2 ở chó theo tình trạng tiêm phòng, chó mắc VRTC do CPV2 được phân loại theo các tiêu chí: chưa tiêm vắc xin, đã tiêm 1 mũi vắc 57 xin, đã tiêm 2 mũi vắc xin, đã tiêm 3 mũi vắc xin. Kết quả khảo sát được thể hiện ở bảng 4.5. Bảng 4.5. Tỷ lệ chó mắc bệnh viêm ruột tiêu chảy do CPV2 theo tình trạng tiêm vắc xin Tình trạng Số chó mắc (con) Số chó mắc theo tình trạng vắc xin (con) Tỷ lệ mắc (%) Chưa được tiêm vắc xin 108 82 75,93 Đã được tiêm vắc xin mũi 1 18 16,67 Đã được tiêm vắc xin mũi 2 5 4,63 Đã được tiêm vắc xin mũi 3 3 2,77 Kết quả nghiên cứu cho thấy tỷ lệ mắc bệnh của chó đã được tiêm vắc xin (26/108) thấp hơn nhiều so với chó chưa được tiêm vắc xin (82/108) (P<0,05). Trong đó chó đã được tiêm 2 mũi vắc xin đã cho khả năng bảo hộ đối với vi rút parvo khá cao, tỷ lệ mắc bệnh chỉ 4,63%. Đối với nhóm chó đã được tiêm đầy đủ 3 mũi vắc xin tỷ lệ mắc bệnh thấp nhất (2,77%). Trong nghiên cứu này, 26 chó dù đã được tiêm vắc xin nhưng vẫn bị mắc VRTC do CPV2, đối với nhóm chó chỉ mới tiêm 1 mũi vắc xin, tỷ lệ mắc bệnh khá cao (16,68%), nguyên nhân có thể là do hàm lượng kháng thể sau khi tiêm 1 mũi chưa đ

Các file đính kèm theo tài liệu này:

  • pdfluan_an_nghien_cuu_dac_diem_benh_ly_cua_cho_mac_benh_viem_ru.pdf
  • pdfBLH&CBCN_TTLA_Vo Van Hai.pdf
  • pdfQD_HD cap Hoc vien_Vo Van Hai.pdf
  • docxTTT_Vo Van Hai.docx
  • pdfTTT_Vo Van Hai.pdf