Luận văn Cảm biến sinh học trên cơ sở composite polypyrrole và ống nanocacbon ứng dụng xác định gox và adn

MỞ ĐẦU. 1

CHƯƠNG I: CẢM BIẾN SINH HỌC. 3

I.1 GIỚI THIỆU CHUNG VỀ CẢM BIẾN SINH HỌC . 3

I.1.1 Cấu tạo cảm biến sinh học . 4

I.1.1.1 Cấu tạo chung. 4

I.1.1.2. Tác nhân cần phát hiện. 5

I.1.1.3. Đầu thu sinh học. 5

I.1.1.4. Tác nhân cố định . 7

I.1.1.5. Bộ phận chuyển đổi. 7

I.1.2. Ứng dụng của cảm biến sinh học. 9

I.1.3 Tiêu chuẩn đánh giá cảm biến sinh học. 10

I.2 CẢM BIẾN GOx. 11

I.2.1 Enzym glucose . 11

I.2.2 Nguyên tắc của phản ứng điện hoá. 12

I.2.3 Cố định enzyme . 12

I.2.4 Vật liệu nano . 13

I.3 CẢM BIẾN ADN. 15

I.3.1 Thành phần cấu tạo của ADN[53]:. 15

I.3.2 Nguyên lý hoạt động của cảm biến ADN:. 17

I.3.3 Các phương pháp phát hiện ADN. 17

CHƯƠNG II: POLYME DẪN, POLYPYRROLE VÀ

CACBONNANOTUBE . 19

II.1 POLYME DẪN. 19

II.2. PPy . 23

II.2.1 Monome Pyrrole (Py) . 23

II.2.2 Polyme PPy (PPy) . 23

II.2.3.1 Tổng họp PPy bằng phương pháp hóa học . 26

II.2.3.2 Tổng hợp PPy bằng phương pháp điện hóa . 26

II.2.3.3 Tổng hợp màng PPy. 28

pdf91 trang | Chia sẻ: honganh20 | Ngày: 25/02/2022 | Lượt xem: 282 | Lượt tải: 0download
Bạn đang xem trước 20 trang tài liệu Luận văn Cảm biến sinh học trên cơ sở composite polypyrrole và ống nanocacbon ứng dụng xác định gox và adn, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
iện cực Calomen - Các dụng cụ thí nghiêm cần thiết khác III.1.2 Hóa chất - Monome pyrrole: 99%, Aldrich Chemical Co - Ống nano carbontube (CNT), Trung Quốc, có đường kính ống φ = 40 ÷ 60nm với chiều dài cỡ vài µm. - NaCl PA, Merck - Enzym glucose (GOx) - β-D glucose, Merck - ADN dò (probe) có một đầu được gắn với monomer pyrrole có trình tự: 5’ GGCCATCGTTGAAGATGCCTCTGCC 3’ - ADN đích (target): 5’ GGCAGAGGCATCTTCAACGATGGCC 3’ - 33 - Cảm biến sinh học trên cơ sở composite PPy và ống nanocacbon xác định GOx và ADN Vũ thị Hồng Ân – Cao học Hóa lý-Hóa lý thuyết 2006-2008 III.1.3. Quy trình thực nghiệm III.1.3.1 Quy tình tổng hợp - cố định ADN dò lên màng PPy pha tạp và không pha tạp ống nanô cácbon CNT Chuẩn bị dung dịch Tất cả các hóa chất được dùng trong thực nghiệm đều có độ sạch cao nên được sử dụng ngay không qua quá trình xử lý nào. Tuy nhiên, ống nano cacbon (CNT–Trung Quốc) có đường kính ống φ=40-60 nm với chiều dài vài µm, để phân tán được chúng trong dung dịch chúng tôi phải tiến hành chức năng hóa trong môi trường axít trước khi sử dụng [66]. Hình 3. 1 Chức năng hóa CNT bằng hỗn hợp HNO3: H2SO4 (1:3) Quá trình này được thực hiện như sau: CNT đa lớp (MWCNTs) được rung siêu âm trong hỗn hợp dung dịch axit đậm đặc HNO3:H2SO4 (1:3) để tiến hành chức năng hóa đồng thời loại bỏ các ion kim loại nặng trong nhiều giờ. Hỗn hợp dung dịch được rửa bằng nước cất vài lần, sau đó rửa trong dung dịch NaOH 0,1M để đạt độ pH=7. Dung dịch màu đen sau khi chắt lọc được sấy khô qua đêm, thu được dưới dạng bột đen. Bột này chính là ống nano đã chức năng hoá (CNT). Sau khi được chức năng hóa, các mạch liên kết cacbon bị phá vỡ ở hai đầu ống, ống carbonnanotube trở thành cấu trúc hai đầu hở, thành ống trở thành cấu trúc MWCNT-COOH. Cấu trúc này ngoài việc giúp chúng phân tán tốt trong nước còn giúp cho các thành phần sinh học như các enzyme, các phân tử ADN... xâm nhập cố định trong ruột ống, hoặc đính trên bề mặt của ống [67]. ADN dò phát hiện chuyển gen trong đậu tương, chúng tôi sử dụng loại ADN dò có một đầu được gắn với monomer pyrrole (giúp cho quá trình cố định lên màng PPy được dễ dàng hơn). - 34 - Cảm biến sinh học trên cơ sở composite PPy và ống nanocacbon xác định GOx và ADN Vũ thị Hồng Ân – Cao học Hóa lý-Hóa lý thuyết 2006-2008 Màng PPy cố định ADN dò được tổng hợp trong dung dịch đệm bao gồm Py (nồng độ 0,3M), nồng độ ADN dò 1μl/1ml dung môi. Còn đối với màng Py pha tạp MWCNT cố định ADN thì ta cho thêm lượng MWCNT là 2mg/ml dung môi. Do Py khó tan trong nước nên chúng tôi tiến hành khuấy hỗn hợp chứa pyrrole khoảng 10h bằng máy khuấy từ. Sau đó cho ADN dò (với màng PPy không pha tạp) hoặc hỗn hợp ADN dò và MCNT (với màng PPy pha tạp) và rung hỗn hợp này trong khoảng 5 phút để giúp chúng phân tán tốt trong dung môi chứa pyrrole. Chuẩn bị hệ điện hoá Trên hình 4.1 trình bày sơ đồ hệ điện hóa ba điện cực sử dụng tổng hợp màng PPy pha tạp và không pha tạp sử dụng phát hiện chuyển gen trong đậu tương. Các điện cực sử dụng trong hệ điện hóa này bao gồm: (1) Điện cực làm việc là linh kiện QCM và vi điện cực răng lược; (2) Điện cực so sánh Ag/AgCl; (3) Điện cực đối là lưới Pt. Hình 3. 2 Sơ đồ hệ điện hóa ba điện cực sử dụng tổng hợp màng PPy pha tạp và không pha tạp ứng dụng xác định chuyển gen trong đậu tương. Hệ điện hóa, được ghép nối với thiết bị AUTOLAB - ECOCHEMIE PGSTAT 12 với chế độ phân cực thế tĩnh. Điện áp đặt trên điện cực làm việc trong khoảng 0,65 V đến 0,75 V so với điện cực Ag/AgCl. Thời gian tổng hợp 5000s. - 35 - Cảm biến sinh học trên cơ sở composite PPy và ống nanocacbon xác định GOx và ADN Vũ thị Hồng Ân – Cao học Hóa lý-Hóa lý thuyết 2006-2008 III.1.3.2 Quy tình tổng hợp - cố định enzyme glucose lên màng PPy pha tạp MWCNT Chuẩn bị dung dịch Quá trình chức năng hoá MWCNT được tiến hành tương tự như trên. Dung dịch điện ly sử dụng tổng hợp điện cực GOx bao gồm: monome Py (0,3M) được hòa tan trước trong nước đề iôn bằng máy khuấy từ khoảng 10 giờ. Sau đó cho CNT vào dung dịch này với tỷ lệ 3 mg CNT/ml dung dịch và đưa vào máy rung siêu âm trong 15 phút. Cuối cùng cho enzyme glucose GOx (glucose oxidase) với tỷ lệ 0,5 mg/ml vào trong hỗn hợp để tiến hành tổng hợp. III.2 PHƯƠNG PHÁP NGHIÊN CỨU III.2.1 Linh kiện vi cân tinh thể thạch anh (Quartz Crystal Microbalance- QCM) Năm 1880, Pierre và Jacques Curie đã phát hiện ra hiện tượng: khi đặt một áp lực lên tinh thể muối Rochell (NaKC4H4O6.4H2O) sẽ phát sinh ra điện áp và ngược lại khi đặt điện áp lên tinh thể thì sẽ gây biến dạng cơ học. Phát hiện này là tiền đề của hiệu ứng áp điện. Bộ dao động điều khiển tần số dựa trên tinh thể Quartz loại X-cut được sử dụng lần đầu vào năm 1921. Tuy nhiên loại tinh thể này có nhược điểm là khá nhạy cảm với nhiệt độ vì thế hiện nay không còn được sử dụng nhiều. Đến năm 1934 người ta phát hiện ra rằng tinh thể Quartz loại AT-cut ổn định với nhiệt độ. Nhờ đặc điểm này mà nó hầu như là lựa chọn hàng đầu để làm QCM. Khi đặt điện áp xoay chiều vào tinh thể AT-cut, hai bên điện cực sẽ sinh ra dao động trượt dọc theo bề mặt tinh thể. Dao động này sẽ cộng hưởng khi tần số dòng điện bằng tần số dao động riêng của tinh thể Quartz. Tất cả các ứng dụng của cảm biến sử dụng linh kiện QCM đều xoay quanh tần số dao động cộng hưởng của nó. Linh kiện QCM được ứng dụng nhiều trong lĩnh vực như: chế tạo các cảm biến khí, cảm biến mùi và bộ chỉ thị cho quá trình điện hóa, đo chiều dày của màng mỏng tạo thành trong quá trình chế tạo màng. Đặc biệt, linh kiện QCM được ứng dụng mạnh mẽ trong việc chế tạo cảm biến sinh học như: sử dụng để phát hiện virus - 36 - Cảm biến sinh học trên cơ sở composite PPy và ống nanocacbon xác định GOx và ADN Vũ thị Hồng Ân – Cao học Hóa lý-Hóa lý thuyết 2006-2008 gây bệnh, phát hiện chuyển gen ADNvv. Trong khuôn khổ đề tài này, chúng tôi sử dụng linh kiện QCM để phát hiện chuyển gen trong đậu tương. III.2.1.1 Tinh thể thạch anh Cấu trúc Trong điều kiện nhiệt độ phòng, tinh thể Quartz (SiO2) có cấu trúc trigonal (α- Quartz) và có hiệu ứng áp điện rất mạnh. Các ô đơn vị lặp lại tuần hoàn trong không gian. Tinh thể Quartz có nhiệt độ chuyển pha là 573 oC. Khi nhiệt độ lớn hơn 573 oC, tinh thể chuyển sang cấu trúc hexagonal (β-Quartz) và mất đi tính áp điện. Mạng tinh thể có các ion Si+ và O- , chúng được sắp xếp như trình bày trên hình 3.1. Hình 3. 3 Mô tả cấu trúc của tinh thể α-Quartz trong không gian (a) và trong mặt phẳng (b) Tính chất áp điện Nguồn gốc của hiện tượng áp điện xảy ra trong tinh thể α-Quartz là do sự dịch chuyển của các ion Si+ và O- trong mạng tinh thể khi có biến dạng. Khi chưa có ứng suất bên ngoài thì trọng tâm điện tích âm và điện tích dương trùng nhau nên tinh thể có tính trung hòa về điện. Khi có ứng suất bên ngoài, ứng suất này sẽ làm cho trọng tâm các điện tích dương và điện tích âm lệch nhau dẫn đến hình thành - 37 - Cảm biến sinh học trên cơ sở composite PPy và ống nanocacbon xác định GOx và ADN Vũ thị Hồng Ân – Cao học Hóa lý-Hóa lý thuyết 2006-2008 một momen phân cực điện. Sự xuất hiện của moment phân cực điện này sẽ tạo ra điện tích trái dấu giữa 2 mặt tinh thể. Khi đặt điện áp xoay chiều có tần số thích hợp lên hai mặt tinh thể, tinh thể sẽ dao động với tần số của điện áp và sinh ra một tín hiệu điều hòa, gọi là mode dao động của tinh thể Quartz. Mode dao động này phụ thuộc vào cách cắt tinh thể. Đối với tinh thể loại AT-cut, dao động tinh thể theo mode trượt (hình 3.6), tinh thể X- Cut có mode dao động co dãn tinh thể dọc theo hướng đặt điện áp (hình 3.7). Hình 3. 5 Mô tả mode dao động trượt theo bề dày của linh kiện QCM. Hình 3. 6 Mô tả một số mode dao động trượt bề dày, mode trượt bề măt và mode co giãn. Hình 3. 4 Cơ chế sinh ra hiện tượng áp điện trong tinh thể α- - 38 - Cảm biến sinh học trên cơ sở composite PPy và ống nanocacbon xác định GOx và ADN Vũ thị Hồng Ân – Cao học Hóa lý-Hóa lý thuyết 2006-2008 III.2.1.2. Linh kiện vi cân tinh thể thạch anh (QCM) Năm 1959, Sauerbrey đã phát hiện ra mối liên hệ giữa sự dịch chuyển tần số cộng hưởng của tinh thể Quartz với sự thay đổi khối lượng trên một đơn vị diện tích bể mặt của nó. Công trình này đã đặt nền móng cho việc chế tạo và sử dụng thể Quartz như một vi cân. Phương trình biểu diễn mối liên hệ giữa độ dịch tần số cộng hưởng và biến thiên khối lượng trên bề mặt được gọi là phương trình Sauerbrey : Δƒ0 = -cƒΔm (3-1) Trong đó, cƒ là hệ số tỉ lệ; Δm biểu diễn sự biến thiên khối lượng trên một đơn vị bề mặt diện tích của tinh thể; Δƒ0 là độ dịch tần số tương ứng với biến thiên khối lượng. Như vậy, dựa vào phương trình này chúng ta có thể xác định được độ tăng khối lượng hấp thụ trên bề mặt tinh thể. Ngoài ra, trong chất lỏng, độ dịch tần số tỉ lệ với căn bậc 2 của tích mật độ và độ nhớt dung dịch theo phương trình: 3/ 2 0 0 l l q q f f η ρ πη µ ∆ = − (3-2) Trong đó, ,l lη ρ lần lượt là độ nhớt và mật độ chất lỏng; ,q qη µ lần lượt là độ nhớt và modun trượt của tinh thể Quartz. Đây chính là cơ sở cho các ứng dụng của QCM trong việc xác định mật độ cũng như độ nhớt của môi trường. Trong thời gian gần đây, các nghiên cứu tập trung vào chế tạo các bề mặt điện cực chính xác và đặc biệt để làm detector đo nồng độ khí môi trường, làm sensor sinh học và dùng để nghiên cứu tương tác giữa các phân tử bề mặt. Ngoài ra, tinh thể Quartz còn nhạy đối với một số thay đổi khác trên bề mặt tinh thể như áp suất, nhiệt độ và độ nhám bề mặt. Lấy gần đúng bậc nhất coi độ dịch tần số bằng tổng độ dịch thành phần do các tác nhân khác nhau, ta có: 0 ass ensity/viscosity sim d compres on roughness tempraturef f f f f f∆ = ∆ + ∆ + ∆ + ∆ + ∆ (3-3) Ảnh hưởng của các thành phần khối lượng, độ nhớt của dung môi, nhiệt độ cũng như độ nhám bề mặt của tinh thể Quartz lên độ dịch tần số cộng hưởng được đánh giá như sau: - 39 - Cảm biến sinh học trên cơ sở composite PPy và ống nanocacbon xác định GOx và ADN Vũ thị Hồng Ân – Cao học Hóa lý-Hóa lý thuyết 2006-2008 Ảnh hưởng của khối lượng chất hấp phụ Khi một lượng chất hấp phụ lên bề mặt tinh thể Quartz thì lượng chất đó có thể coi như khối lượng cộng thêm vào tinh thể Quartz đồng thời làm tăng chiều dày tinh thể lên Δd, dẫn tới làm thay đổi tần số cộng hưởng của QCM một khoảng Δƒ0 theo phương trình (3-1) Ảnh hưởng của độ nhớt dung môi Khi tiếp xúc với chất lỏng, tần số của hộp cộng hưởng giảm do độ nhớt và nồng độ môi trường cao gây ra sự tiêu tán năng lượng. Tần số cộng hưởng của QCM tỷ lệ nghịch với tích độ nhớt và mật độ chất lỏng tiếp xúc với điện cực: (3-4) trong đó: ηl , ρl : độ nhớt và mật độ chất lỏng tiếp xúc ρq , μq : Mật độ và modun trượt tinh thể Quartz ρq = 2,648 g.cm-3, μq = 2,947. 1011 g.cm-1.s-2 Ảnh hưởng của nhiệt độ Tần số dao động của tinh thể Quartz cũng phụ thuộc nhiệt độ như trình bày trên hình 3.5. Tuy nhiên, sự phụ thuộc này đối với tinh thể Quart loại AT-cut là tương đối nhỏ. Trong thực tế, tinh thể loại AT-cut thường có hệ số nhiệt gần như bằng không ở nhiệt độ phòng. Trong khoảng nhiệt độ từ 0÷ 60 oC, sự phụ thuộc ƒ(Τ) là rất nhỏ, cỡ 1-3Hz/ oC và có thể coi như tuyến tính: Δƒtemprature = -cTƒ0 ΔT (3-5) Ảnh hưởng của độ nhám bề mặt Độ nhám bề mặt điện cực gây ra sự mất chính xác của phương trình Sauerbrey bởi khi đó sự phân bố khối lượng không còn đồng đều nữa. Hay nói cách khác là bề mặt điện cực không còn là một lớp màng với độ dày đồng đều. Khi độ nhám nhỏ hơn bước sóng âm hoặc độ nhám phân bố ngẫu nhiên thì mối liên hệ giữa 3 2 20 0 l l q q f f η ρ πρ µ ∆ = − - 40 - Cảm biến sinh học trên cơ sở composite PPy và ống nanocacbon xác định GOx và ADN Vũ thị Hồng Ân – Cao học Hóa lý-Hóa lý thuyết 2006-2008 độ dịch tần số cộng hưởng và khối lượng hấp thụ trên bề mặt tinh thể Quartz vẫn tuân thêo phương trình Sauerbrey (phương trình 3-1). Độ dịch tần số được tính theo công thức: (3-6) Trong đó: h là độ cao trung bình, L là khoảng cách trung bình giữa 2 mô nhám. & Ψ là một hàm của các tỉ số giữa các thông số a, L, h, δ Ảnh hưởng của ứng suất Từ biểu thức 202 /f q qc f ρ µ= có thể suy ra tần số của QCM tăng tuyến tính với áp suất do ảnh hưởng của áp suất tới modun đàn hồi của tinh thể.Độ dịch tần do áp suất được tính bằng công thức: (3-7) Trong đó P là áp suất tinh thể tính bằng đơn vị torr. III.2.1.3. Một số cấu trúc QCM Tùy theo mục đích sử dụng hiện nay người ta đã chế tạo ra nhiều kiểu cấu trúc QCM như planar, bi mesa, plano-convex. Cấu trúc QCM thường gặp là cấu trúc phẳng – planar (hình 3.9). Hình 3. 7 Cấu trúc của QCM Planar ( ) ( ) ( ) 3 1 2 2 0 ess 1 2 , ,l lroughn q q nf f a a L h a ρ η ψ δ πρ η    ∆ = −      0l l fδ η πρ= 9 ompression 01.4.10 . .cf f P −∆ = - 41 - Cảm biến sinh học trên cơ sở composite PPy và ống nanocacbon xác định GOx và ADN Vũ thị Hồng Ân – Cao học Hóa lý-Hóa lý thuyết 2006-2008 III.2.1.4. Cảm biến ADN trên cơ sở linh kiện QCM Cảm biến sinh học trên cơ sở linh kiện QCM là một trong những ứng dụng triển vọng trong nghiên cứu sinh học. Hiện nay, cảm biến sinh học QCM đã được nghiên cứu rộng rãi với rất nhiều ứng dụng cũng như chủng loại khác nhau: cảm biến ADN, cảm biến phát hiện tế bào, cảm biến điện hóa, cảm biến phát hiện các axit amin, vv. Tuy nhiên, chúng đều có nguyên tắc chung là: khi lớp màng đặc biệt phủ trên tinh thể Quartz hấp phụ, cố định các phần tử sinh học sẽ làm thay đổi khối lượng và do đó là thay đổi tần số cộng hưởng của linh kiện QCM. Cảm biến sinh học ADN trên cơ sở linh kiện QCM được ứng dụng trong rất nhiều lĩnh vực của cuộc sống như: chuẩn đoán di truyền học, phát hiện các tổ chức thay đổi gen, phát hiện vi khuẩn và các độc tố... Hơn nữa, chúng còn được sử dụng thành công trong các nghiên cứu về cơ chế sinh học phân tử như: động học lai hóa bề mặt ADN, phản ứng trùng hợp chuỗi ADN, phản ứng tách ADN, liên kết của protein với ADN, tương tác ADN thuốc, vv. III.2.2 Phương pháp phổ tổng trở điện hóa (Electrochemical impedance spectroscopy – EIS) Trong những năm gần đây, phương pháp phổ tổng trở điện hóa đã trở thành một phương pháp hết sức thông dụng và hiệu quả trong việc phân tích các tính chất của vật liệu. Từ các giá trị trở kháng đo được có thể khảo sát sự vận chuyển khối, tốc độ phản ứng hóa học, các tính chất của điện môi, độ dẫn của vật liệu III.2.2.1. Bản chất của phương pháp Bản chất của phương pháp là dựa trên việc nhận dạng các đường cong trở kháng đo được khi biểu diễn chúng dưới dạng phức: Z = ReZ + j ImZ (3-8) Đặt một điện áp hình sin U(ω) =Uoeiωt đặt lên hệ điện và dòng xoay chiều thu được I(ω) = Ioei(ωt+θ) với θ là góc lệch pha giữa điện áp và dòng điện. Trở kháng của vật liệu sẽ được biểu diễn như sau: - 42 - Cảm biến sinh học trên cơ sở composite PPy và ống nanocacbon xác định GOx và ADN Vũ thị Hồng Ân – Cao học Hóa lý-Hóa lý thuyết 2006-2008 Z(ω) =U(ω)/I(ω) = Uo/Ioe-iθ = Z e-iθ (3-9) Z(ω) là một số phức có thể được biểu diễn trong hệ toạ độ cực bởi biên độ Z và góc pha θ hoặc trong hệ toạ độ Đêcac (hình 3.9): Hình 3. 8 Biểu diễn vector Fresnel trong mặt phẳng phức. Trong đó ReZ và ImZ là phần thực và phần ảo của trở kháng Z(ω). Sự liên hệ của các đại lượng này được biểu diễn: Z 2 =(ReZ) 2 +(ImZ) 2 θ = Arctang( ZR ZI e m ) (3-10) Re.Z = Z cosθ Im.Z = Z sinθ Nếu tần số góc ω (hay θ)thay đổi, tập hợp các điểm M của vectơ tổng trở miêu tả trên mặt phẳng phức là đường cong đặc trưng cho hệ khảo sát(hình 3.12). Hình 3. 9 Tập điểm M vẽ nên một đường phổ tổng trở đặc trưng cho hệ khảo sát. Ngoài việc đo trở kháng tổng cộng của cả hệ rồi biểu diễn trên mặt phẳng phức Z’ = f (Z’’) (mặt phẳng Nyquist), ta có thể đo độ dẫn: Y (ω) = 1/Z(ω) (3-11) Mối quan hệ giữa Z(ω) và Y(ω) có thể biểu diễn: ωo Z’’ r r + R Z’ R/ 2 -Im (Z ) Re(Z) |Z| |Z |si nθ |Z|cosθ M-Im (Z ) |Z |si nθ - 43 - Cảm biến sinh học trên cơ sở composite PPy và ống nanocacbon xác định GOx và ADN Vũ thị Hồng Ân – Cao học Hóa lý-Hóa lý thuyết 2006-2008 22 22 )(Im)(Re 1)(Im)(Re Im Im Re Re YY ZZ Y Z Y Z + =+== (3-12) III.2.2.2. Nội dung phương pháp Bất kì một hệ điện hoá nào cũng có thể biểu diễn được bằng một sơ đồ mạch tương đương gồm có các điện trở và các điện dung. Mạch tương đương này thường chứa các phần tử sau: – Điện dung lớp kép: Cd – Tổng trở Pharaday: Zf – Điện trở dung dịch:RΩhay Rs – Điện trở chuyển điện tích:Rct Các thành phần này được biểu diễn trên một mạch điện như hình 3.13: Mạch tương đương nối song song có ý nghĩa vật lí là một mạch rẽ gồm quá trình Faraday if và quá trình nạp lớp kép ic Trong đó: i = if + ic (3-13) Các phần tử R, C trong mạch tương đương đều là hàm của thời gian. Bằng cách quét tần số một cách liên tục từ giá trị cao đến thấp trong một khoảng rộng với thế một chiều là cố định, đường phổ trở kháng phức Z’’ vs Z’ thực nghiệm sẽ được xử lý và mô phỏng bằng một mạch điện tương đương mà mỗi phần tử của mạch đại diện cho một tính chất điện của hệ điện phân. Kết quả trở kháng đo được sẽ được phần mềm xử lý và tính toán để vẽ lên đường phổ tương ứng, đồng thời cho phép xác định được giá trị của các phần tử mô phỏng. III.2.2.3. Tổng trở của polyme dẫn Với điện cực polyme dẫn thì có một thành phần rất quan trọng trong cấu tạo mạch tương đương đó là phân tử hằng số pha CPE: ZCPE = k.(jω)–p 0 ≤ p ≤ 1 (3-14) k – hằng số độc lập với tấn số ; k = Rct.(Cd/Rct)–p Hình 3. 10 Mạch điện tương đương Randles RΩ Zf ic + if ic if Zf RΩ Rct Zw≡ ≡ (a) (b) - 44 - Cảm biến sinh học trên cơ sở composite PPy và ống nanocacbon xác định GOx và ADN Vũ thị Hồng Ân – Cao học Hóa lý-Hóa lý thuyết 2006-2008 Khi đó mạch tương đương cho quá trình điện cực được thể hiện trên hình: 3.14 Rct Zf CPE RΩ Phổ tổng trở biểu diễn mạch tương của điện cực phủ polyme dẫn được thể hiện trên hình (Pm)+x + xe– ↔ Pmo Ở vùng tần số cao ω → ∞ đường biểu diễn là nửa vòng tròn bị nén với góc nén α đặc trưng cho quá trình chuyển điện tích vào màng polyme (hình 3.15). Ở vùng tần số trung bình đường biểu diễn nối với đoạn thẳng nghiêng 45o đặc trưng cho quá trình khuếch tán ion vào màng polyme.Còn ở vùng tần số thấp ω → 0 ứng với đường thẳng đứng tương ứng với quá trình cài ion vào mạng polyme. III.2.2.4. Mạch điện tương đương: Mô hình Randles là mạch thông dụng để mô phỏng hệ điện cực trong dung dịch điện ly lỏng. Trong đó các giá trị Rs, Rct, Cdl, W giải thích cho bản chất vật lý của hệ điện cực được mô tả giới thiệu theo sau: a) Điện trở dung dịch Rs Điện trở dung dịch giữa điện cực làm việc và điện cực chuẩn đóng vai trò quan trọng trong mạch điện mô phỏng phổ trở kháng phức. Điện trở của một dung dịch ion phụ thuộc nồng độ ion, loại ion, nhiệt độ và cấu trúc hình học của diện tích mà các ion này chảy qua. Hình 3. 11 Mạch tương đương cho tổng trở của polymer Cd = 1/(ω.Rct) -Z’’ RΩ RΩ + Rct -Z’ CL = -1/(ω.Z’’) α Hình 3. 12 Mạch tương đương cho tổng trở của polymer dẫn - 45 - Cảm biến sinh học trên cơ sở composite PPy và ống nanocacbon xác định GOx và ADN Vũ thị Hồng Ân – Cao học Hóa lý-Hóa lý thuyết 2006-2008 b) Điện dung lớp kép Điện dung lớp kép tồn tại ở bề mặt giao nhau của điện cực và dung dịch điện ly bao quanh nó. Lớp điện ly này được tạo ra do sự bám dính của các ion từ dung dịch lên bề mặt điện cực, các ion này gây ra sự phân cực điện tích và làm xuất hiện một lớp các ion trái dấu trên bề mặt điện cực. c) Trở kháng Warburg(W) Trong phép đo trở kháng thực tế, người ta còn thấy sự xuất hiện của các đường đặc trưng trở kháng trong mặt phẳng phức là những đường thẳng tuyến tính nghiêng 45o. Để mô phỏng đặc trưng này người ta thường đưa thêm vào hệ tương đương mọt thành phần trở kháng khác nữa để mô tả hệ vật liệu, đó là trở kháng Warburg (W). Trở kháng W đặc trưng cho hiện tượng khuếch tán của các hạt mang điện vào cấu trúc màng điện cực. Phụ thuộc độ sâu của lớp khuếch tán người ta phân biệt hai trường hợp khác nhau: lớp khuếch tán có chiều dài hữu hạn và lớp khuếch tán có chiều dài bán vô hạn tương ứng với các biểu thức khác nhau cho trở kháng Warburg. d) Điện trở trao đổi điện tích Xem xét một điện cực được nhúng vào dung dịch điện ly. Khi phản ứng điện cực xảy ra, các phân tử trên bề mặt điện cực bị oxy hóa theo phản ứng tổng quát Chất khử ↔ chất Oxi hóa + ne- Điện trở trao điện tích đặc trưng cho quá trình oxi hóa khử trên và có thể được mô tả bởi công thức: Rct = RT* (n2F2 A kct[S])-1 (*) [3-15] Trong đó: T: Nhiệt độ tuyệt đối F: Hằng số Faraday n: Số electron trao đổi trên mỗi phân tử chất trao đổi điện tích kct: Hằng số tốc độ trao đổi điện tích (phụ thuộc điện thế) A: Diện tích bề mặt điện cực [S]: Nồng độ chất tham gia phản ứng oxy hóa khử - 46 - Cảm biến sinh học trên cơ sở composite PPy và ống nanocacbon xác định GOx và ADN Vũ thị Hồng Ân – Cao học Hóa lý-Hóa lý thuyết 2006-2008 Khi trạng thái cân bằng ổn định xảy ra ở một tín hiệu nhỏ, điện trở này có thể viết dưới dạng đơn giản hơn: Rct = RT/(nFIo) [13] Với Io là mật độ dòng trao đổi và các thông số khác như trên Điện trở Rct là một thành phần quan trọng của hệ điện cực. Nó thể hiện độ dẫn của màng và tốc độ chuyển đổi tín hiệu của một cảm biến sinh học. Các quá trình nhận biết nồng độ ADN được thực hiện thông qua sự thay đổi giá trị của Rct. Vì thế chúng tôi tập trung các kết quả thực nghiệm trong việc phân tích đại lượng này. Tuy nhiên trong quá trình mô phỏng cần thực hiện một số hiệu chỉnh bởi tính chất không đồng nhất của màng điện cực, người ta hay dùng phần tử pha CPE để thay thế cho một số các phần tử mạch điện. e) Hằng số pha CPE Z = 1/[T(i*w)^P]; w: tần số góc Tham số: CPE-T(giá trị T), CPE-P(giá trị P) Thực chất, tất cả các phần tử trở kháng là các phần tử pha CPE với các góc lệch pha khác nhau ví dụ như tham số CPE-P bằng 1 (góc lệch pha 90o) tương đương với một phần tử điện dung và bằng 0 (góc lệch pha bằng 0o) tương đương với một điện trở. Thông thường do bán kính cung thu được có tâm nằm dưới trục thực (bán cung bị nén) nên để thực hiện quá trình hiệu chỉnh người ta thường sử dụng phần tử pha CPE để thay thế cho giá trị điện dung (hiệu chỉnh này do Cole tìm ra và CPE trường hợp này được gọi là một phần tử Cole). Lúc này hệ số CPE-P có giá trị trong khoảng từ 0 đến 1. Về bản chất vật lý, CPE thể hiện tính không đồng nhất của hệ trong trường hợp màng thu được có độ rỗng và xốp. CPE còn được sử dụng để thay thế cho phần tử trở kháng trong trường hợp tần số quét không đủ nhỏ ở vùng tần thấp cho việc khuếch tán sâu hơn của các hạt dẫn vào trong vật liệu màng hoặc màng vật liệu là đủ dày để tần số thấp nhất không đủ cho hạt dẫn đi sâu vào hoàn toàn trong vật liệu. CPE sẽ sinh ra một phổ trở kháng giống như của một phần tử Warburg ở vùng “tần cao”. - 47 - Cảm biến sinh học trên cơ sở composite PPy và ống nanocacbon xác định GOx và ADN Vũ thị Hồng Ân – Cao học Hóa lý-Hóa lý thuyết 2006-2008 Sau quá trình fit các giá trị Rct được ghi lại để thiết lập nên đường chuẩn thể hiện quan hệ giữa 1/Rct và nồng độ ADN cho cảm biến ADN. III.2.3 Phương pháp đo dòng (Amperometric) Phương pháp đo dòng (Amperometric) là một phương pháp của phân tích điện hoá, trong đó tín hiệu phân tích nhận được ở đầu ra là dòng hiện thời. Dòng hiện thời này phụ thuộc tuyến tính vào nồng độ nhất định của chất cần phân tích. Trong quá trình hoạt động của cảm biến các phản ứng oxi hoá khử sẽ xảy ra trên điện cực trơ, các điện tử đi chuyển từ dung dịch tới điện cực làm việc hoặc ngược lại. Hướng di chuyển của các điện tử phụ thuộc vào bản chất của chất phân tích và được kiểm soát bởi điện thế áp đặt vào hệ. Phương pháp đo dòng được thực hiện trên hệ điện hoá được thiết lập gồm hai hay ba điện cực. Điện cực đối thường là điện cực Au hay Pt, điện cực chuẩn có thế cố định thông thường là Ag/AgCl và điện cực làm việc. Điện thế được đặt giữa hai điện cực làm việc và điện cực so sánh, người ta sẽ đo dòng chạy qua tế bào. Khi điện thế đạt đến một giá trị nào đó (thường là điện thế oxi hoá), thì hiện tượng oxi hoá xuất hiện và các electron được sinh ra. Dòng điện thu được sẽ tỉ lệ với độ tập trung của các phân tử bị oxi hoá. Tiến hành đo đặc trưng đáp ứng dòng với sự thay đổi nồng độ glucose trong dung dịch tại các giá trị điện áp đặt vào điện cực Gox. Xây dựng đường chuẩn của cảm biến GOx tại các giá trị điện áp. - 48 - Cảm biến sinh học trên cơ sở composite PPy và ống nanocacbon xác định GOx và ADN Vũ thị Hồng Ân – Cao học Hóa lý-Hóa lý thuyết 2006-2008 CHƯƠNG IV: KẾT QUẢ VÀ THẢO LUẬN IV.1 TỔNG HỢP MÀNG PPy_CNT_Gox; PPy_ADN dò; PPy_CNT_ADN dò Trên hình 4.1 trình bày hình thái bề mặt màng composit cố định enzyme glucose bằng phư

Các file đính kèm theo tài liệu này:

  • pdfluan_van_cam_bien_sinh_hoc_tren_co_so_composite_polypyrrole.pdf
Tài liệu liên quan