Luận văn Đa dạng di truyền 5 quần thể gà nội

MỤC LỤC

MỞ ĐẦU 6

Chương 1 - TỔNG QUAN TÀI LIỆU 8

1.1 Nguồn gốc và phân loại gà nhà 8

1.2 Các kỹ thuật sinh học phân tử được sử dụng trong nghiên cứu 8

1.2.1 PCR 8

1.2.2 Kỹ thuật microsatellite 8

1.2.3 Một số nghiên cứu sử dụng kỹ thuật microsatellite 9

1.3 Các đặc điểm di truyền quần thể 10

1.3.1 Các đại lượng di truyền đặc trưng cho các quần thể gà 10

1.3.2 Mối quan hệ di truyền giữa các quần thể gà 12

Chương 2 - ĐỐI TƯỢNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU 15

2.1 Đối tượng nghiên cứu và địa điểm thu mẫu 15

2.1.1 Gà Trới 15

2.1.2 Gà Móng 15

2.1.3 Gà Tè (gà lùn) 15

2.1.4 Gà Tiên Yên 16

2.1.5 Gà Tò 16

2.2 Các kỹ thuật thực nghiệm được sử dụng trong nghiên cứu 17

2.2.1 Lấy mẫu máu, tách và đánh giá chất lượng ADN 17

2.2.2 PCR đa mồi và xác định kích thước alen 19

2.3 Phân tích thống kê 21

2.3.1 Các đại lượng di truyền đặc trưng cho các quần thể gà 21

2.3.2 Kiểm định ý nghĩa của các giá trị thống kê 22

2.3.3 Cây quan hệ di truyền 25

Chương 3 - KẾT QUẢ VÀ THẢO LUẬN 26

3.1 Kết quả tách ADN và phân tích đoạn 26

3.2 Kết quả đánh giá các đặc điểm di truyền 27

3.2.1 Thống kê từng locus và quần thể gà 27

3.2.2 Sự sai khác, khoảng cách và cây quan hệ di truyền 42

KẾT LUẬN 45

ĐỀ NGHỊ: 46

TÀI LIỆU THAM KHẢO 47

Tiếng Việt 47

Tiếng Anh 47

Tiếng Pháp 51

PHỤ LỤC 52

 

 

doc57 trang | Chia sẻ: mimhthuy20 | Lượt xem: 489 | Lượt tải: 0download
Bạn đang xem trước 20 trang tài liệu Luận văn Đa dạng di truyền 5 quần thể gà nội, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
0074 261-265 CGATGGTCGTAATTCTCACGT MCW 0078II 5 CCACACGGAGAGGAGAAGGTCT 60 L43686 135-147 TAGCATATGAGTGTACTGAGCTTC MCW 0111II 1 GCTCCATGTGAAGTGGTTTA 60 L48909 96-120 ATGTCCACTTGTCAATGATG MCW 0222II 3 GCAGTTACATTGAAATGATTCC 60 G31996 220-226 TTCTCAAAACACCTAGAAGAC LEI 0094II 4 GATCTCACCAGTATGAGCTGC 60 X83246 247-287 TCTCACACTGTAACACAGTGC MCW 0183II 7 ATCCCAGTGTCGAGTATCCGA 58 G31974 296-326 TGAGATTTACTGGAGCCTGCC ADL 0278III 8 CCAGCAGTCTACCTTCCTAT 60 G01698 114-126 TGTCATCCAAGAACAGTGTG LEI 0194III 1 TCCTTGGCATGTACATATGA 65-55 Z83779 ACTGCATGTTCTTTGATAGGC I, II, III: kí hiệu mix PCR đa mồi Khoảng alen: lấy theo dự án AVIANDIV(ảng 1 (tiếp): Các cặp mồi microsatellite được sử dụng trong nghiên cứu Locus NST Trình tự mồi (5' -> 3') xuôi (ở trên), mồi ngược (ở dưới) To gắn mồi Mã GeneBank Khoảng alen MCW 0069III 26 GCACTCGAGAAAACTTCCTGCG 60 L43684 158-176 ATTGCTTCAGCAAGCATGGGAGGA MCW 0034III 2 TGCACGCACTTACATACTTAGAGA 60 L43674 212-246 TGTCCTTCCAATTACATTCATGGG MCW 0103IV 3 AACTGCGTTGAGAGTGAATGC 64 G31956 266-270 TTTCCTAACTGGATGCTTCTG ADL 0268IV 1 CTCCACCCCTCTCAGAACTA 60 G01688 102-116 CAACTTCCCATCTACCTACT MCW 0037IV 3 ACCGGTGCCATCAATTACCTATTA 64 L43676 154-160 GAAAGCTCACATGACACTGCGAAA MCW 0067IV 10 GCACTACTGTGTGCTGCAGTTT 60 G31945 176-186 GAGATGTAGTTGCCACATTCCGAC MCW 0206V 2 ACATCTAGAATTGACTGTTCAC 60 AF030579 221-249 CTTGACAGTGATGCATTAAATG MCW 0248V W29 GTTGTTCAAAAGAAGATGCATG 60 G32016 205-225 TTGCATTAACTGGGCACTTTC MCW 0081V 5 GTTGCTGAGAGCCTGGTGCAG 60 L43636 112-135 CCTGTATGTGGAATTACTTCTC LEI 0166V 3 CTCCTGCCCTTAGCTACGCA 60 X85531 354-370 TATCCCCTGGCTGGGAGTTT MCW 0330V 17 TGGACCTCATCAGTCTGACAG 60 G32085 256-300 AATGTTCTCATAGAGTTCCTGC III, IV, V: kí hiệu mix PCR đa mồi Khoảng alen: lấy theo dự án AVIANDIV ( 2.3 Phân tích thống kê Dữ liệu microsatellite được xử lý bởi các phần mềm FSTAT v2.9.3 [20], Genetix v4.03 [46], Microsatellite Analyser (MSA) v4.05 [15], 2 chương trình neighbor và consensus thuộc gói phần mềm Phylip v3.69 [18]; và phần mềm Treeview v1.6.6 [29]. 2.3.1 Các đại lượng di truyền đặc trưng cho các quần thể gà Độ phong phú alen được tính theo công thức: , với Ni là số các alen loại i trong số 2N gen. Để tính Rt thì n được giữ nguyên, N sẽ là số lượng cá thể tất cả các mẫu được lập kiểu gen ở locus xem xét. Công thức tính độ đa dạng gen được đánh giá thông qua ước lượng không chệch theo Nei [28] như sau: , trong đó là cỡ của mẫu k, pik là tần số của allele Ai ở mẫu k và Hok là tỉ lệ dị hợp tử quan sát ở mẫu k. Hệ số cận huyết (Fis) được tính theo công thức: , với Fisk là hệ số cận huyết tại locus k ở một quần thể, Hok, Hsk lần lượt là tần số dị hợp tử quan sát và tần số dị hợp tử mong đợi, tính dựa trên tần số alen quan sát với giả định quần thể ở trạng thái cân bằng Hardy - Weinberg, tại locus k ở mỗi quần thể gà. Độ sai khác di truyền giữa các cặp quần thể gà được tính dựa trên giá trị Fst theo Weir và Cockerham [42]. Khoảng cách di truyền DS được tính theo công bố của Nei năm 1978 [27]. Do hai công thức tính Fst và DS rất phức tạp, chỉ phù hợp với các chương trình máy tính nên không được trình bày trong nghiên cứu này. 2.3.2 Kiểm định ý nghĩa của các giá trị thống kê Theo hệ quả của định luật Hardy - Weinberg thì với Fis = 0, quần thể ở trạng thái cân bằng Hardy - weinberg. Nhưng giá trị quan sát này ở các quần thể tự nhiên hầu hết đều khác 0, và ta cần phải xác định ý nghĩa thống kê của sự khác 0 đó bằng việc đặt ra và kiểm định giả thiết H0 và đối thiết H1 tương ứng (bảng 2). Các giả thiết H0 được lần lượt kiểm định tại 3 mức ý nghĩa α = 0.05, 0.01, 0.001, tương ứng với 2300, 11500 và 115000 quần thể ảo được phần mềm FSTAT giả lập phù hợp với giả thiết H0. Để thực hiện các giả lập, phần mềm FSTAT lấy ngẫu nhiên các alen giữa các cá thể ở các quần thể gà tùy theo tần số alen quan sát. Một phân phối gồm 2300, 11500, và 115000 giá trị Fis giả lập tương ứng sẽ được so sánh với giá trị Fis quan sát. Việc so sánh này sẽ cho ra giá trị P, là tỉ lệ giữa số lượng giá trị Fis giả lập ≥ giá trị Fis quan sát, cung cấp một ước lượng không chệch cho xác suất đúng của giả thiết H0. Nếu giá trị P < α, ta bác bỏ giả thiết H0 chấp nhận đối thiết H1: giá trị Fis quan sát ≠ 0 có ý nghĩa thống kê tại mức ý nghĩa α, và quần thể không cân bằng Hardy - Weinberg. Nếu giá trị P ≥ α, ta chấp nhận giả thiết H0: giá trị Fis quan sát khác 0 do sai số ngẫu nhiên, và quần thể ở trạng thái cân bằng Hardy-Weinberg ở mức ý nghĩa α. Bảng 2. Giả thiết H0 và đối thiết H1 trong kiểm định cân bằng Hardy - Weinberg Giả thiết H0 Đối thiết H1 Fis gà Trới ≠ 0 do sai số ngẫu nhiên Fis gà Trới ≠ 0 có ý nghĩa thống kê Fis gà Móng ≠ 0 do sai số ngẫu nhiên Fis gà Móng ≠ 0 có ý nghĩa thống kê Fis gà Tè ≠ 0 do sai số ngẫu nhiên Fis gà Tè ≠ 0 có ý nghĩa thống kê Fis gà Tiên Yên ≠ 0 do sai số ngẫu nhiên Fis gà Tiên Yên ≠ 0 có ý nghĩa thống kê Fis gà Tò ≠ 0 do sai số ngẫu nhiên Fis gà Tò ≠ 0 có ý nghĩa thống kê Nếu Fst = 0 thì các quần thể không sai khác di truyền. Các giá trị Fst trong thực tế hầu hết đều > 0, và ta cần phải xác định ý nghĩa thống kê của sự lớn hơn đó bằng việc đặt ra và kiểm định giả thiết H0 và đối thiết H1 tương ứng (bảng 3). Bảng 3. Giả thiết H0 và đối thiết H1 trong kiểm định sai khác di truyền Giả thiết H0 Đối thiết H1 Fst (Trới-Móng) > 0 do sai số ngẫu nhiên Fst (Trới-Móng) > 0 có ý nghĩa thống kê Fst (Trới-Tè) > 0 do sai số ngẫu nhiên Fst (Trới-Tè) > 0 có ý nghĩa thống kê Fst (Trới-Tiên Yên) > 0 do sai số ngẫu nhiên Fst (Trới-Tiên Yên) > 0 có ý nghĩa thống kê Fst (Trới-Tò) > 0 do sai số ngẫu nhiên Fst (Trới-Tò) > 0 có ý nghĩa thống kê Fst (Móng-Tè) > 0 do sai số ngẫu nhiên Fst (Móng-Tè) > 0 có ý nghĩa thống kê Fst (Móng-Tiên Yên) > 0 do sai số ngẫu nhiên Fst (Móng-Tiên Yên) > 0 có ý nghĩa thống kê Fst (Móng-Tò) > 0 do sai số ngẫu nhiên Fst (Móng-Tò) > 0 có ý nghĩa thống kê Fst (Tè-Tiên Yên) > 0 do sai số ngẫu nhiên Fst (Tè-Tiên Yên) > 0 có ý nghĩa thống kê Fst (Tè-Tò) > 0 do sai số ngẫu nhiên Fst (Tè-Tò) > 0 có ý nghĩa thống kê Fst (Tiên Yên-Tò) > 0 do sai số ngẫu nhiên Fst (Tiên Yên-Tò) > 0 có ý nghĩa thống kê Phần mềm genetix tạo một quần thể ảo bằng cách hoán vị các kiểu gen dựa theo tần số các kiểu gen quan sát được giữa các cặp quần thể gà với nhau. Sau đó nó sẽ tính giá trị Fst ảo, và thực hiện 10000 lần như vậy để tạo ra một phân phối 10000 giá trị Fst ảo. Tỉ lệ các Fst ảo ≥ Fst quan sát sẽ cung cấp một ước lượng không chệch cho xác suất đúng của giả thiết H0 tại mức ý nghĩa α. Nếu DS giữa 2 quần thể bằng 0 thì giữa chúng không có sự biệt hóa. Hầu hết giá trị DS giữa các quần thể trong tự nhiên thu được đều > 0, và ta cần phải xác định ý nghĩa thống kê của sự lớn hơn đó bằng việc đặt ra và kiểm định giả thiết H0 và đối thiết H1 tương ứng (bảng 4). Bảng 4. Giả thiết H0 và đối thiết H1 trong kiểm định khoảng cách di truyền Giả thiết H0 Đối thiết H1 DS (Trới -Móng) > 0 do sai số ngẫu nhiên DS (Trới-Móng) > 0 có ý nghĩa thống kê DS (Trới -Tè) > 0 do sai số ngẫu nhiên DS (Trới-Tè) > 0 có ý nghĩa thống kê DS (Trới-Tiên Yên) > 0 do sai số ngẫu nhiên DS (Trới-Tiên Yên) > 0 có ý nghĩa thống kê DS (Trới-Tò) > 0 do sai số ngẫu nhiên DS (Trới-Tò) > 0 có ý nghĩa thống kê DS (Móng-Tè) > 0 do sai số ngẫu nhiên DS (Móng-Tè) > 0 có ý nghĩa thống kê DS (Móng-Tiên Yên) > 0 do sai số ngẫu nhiên DS (Móng-Tiên Yên) > 0 có ý nghĩa thống kê DS (Móng-Tò) > 0 do sai số ngẫu nhiên DS (Móng-Tò) > 0 có ý nghĩa thống kê DS (Tè-Tiên Yên) > 0 do sai số ngẫu nhiên DS (Tè-Tiên Yên) > 0 có ý nghĩa thống kê DS (Tè-Tò) > 0 do sai số ngẫu nhiên DS (Tè-Tò) > 0 có ý nghĩa thống kê DS (Tiên Yên-Tò) > 0 do sai số ngẫu nhiên DS (Tiên Yên-Tò) > 0 có ý nghĩa thống kê Phần mềm genetix sẽ tiến hành 10000 hoán vị ngẫu nhiên các cá thể giữa 2 quần thể để tạo ra một miền nhiều giá trị DS giả lập phù hợp với giả thiết H0. Tỉ lệ các giá trị DS giả lập ≥ giá trị DS quan sát cung cấp một ước lượng cho xác xuất đúng của giả thiết H0. Nếu tỉ lệ so sánh này thấp hơn mức ý nghĩa α, ta bác bỏ giả thiết H0, chấp nhận đối thiết H1. Và ngược lại, nếu tỉ lệ so sánh này cao hơn hoặc bằng mức ý nghĩa α, ta chấp nhận giả thiết H0, bác bỏ đối thiết H1. 2.3.3 Cây quan hệ di truyền Việc vẽ cây quan hệ di truyền được thực hiện theo quy trình sau: phần mềm MSA tiến hành 1000 lần bootstrap tạo ra 1000 ma trận giá trị DS tính theo Nei [27]; chương trình neighbor thuộc gói phần mềm phylip dựng cây dựa vào ma trận trên theo phương pháp neighbor joining [34], dữ liệu thu được từ chương trình neighbor được xử lý bằng chương trình consensus cũng thuộc gói phần mềm phylip; cuối cùng là phần mềm treeview được dùng để chỉnh sửa và xuất ảnh cây vừa lập được. Chương 3 - KẾT QUẢ VÀ THẢO LUẬN 3.1 Kết quả tách ADN và phân tích đoạn Tổng số 250 mẫu máu gà đã được tách ADN và điện di kiểm tra trên gel agarose 1%. Ảnh điện di (hình 9) thể hiện ADN được tập trung thành một vạch sáng rõ chứng tỏ ADN không bị đứt gẫy trong quá trình tách. Giá trị OD (260/280) thu được phần lớn đều từ 1.8 đến 2.0 nên dung dịch ADN thu được đạt yêu cầu [36]. Hình 9. Ảnh điện di ADN trên gel agarose Sản phẩm PCR đa mồi được đưa vào máy CEQ8000 để xác định kích thước từng alen ở mỗi locus (hình 10), sau đó kết quả phân tích được tập hợp lại để tiến hành các phân tích thống kê. Hình 10. Ảnh phân tích đoạn sản phẩm mix multiplex PCR 5 mồi Hình 10 biểu thị kết quả phân tích đoạn sản phẩm PCR mix I của một cá thể gà Tè gồm: locus MCW0295 có 2 alen (87 và 95 bp), locus ADL0112 có 2 alen (124 và 130bp), locus MCW0216 có 2 alen (143 và 145bp), locus MCW0014 có 2 alen (163 và 178bp), và locus MCW0098 có 1 alen (255bp). 3.2 Kết quả đánh giá các đặc điểm di truyền 3.2.1 Thống kê từng locus và quần thể gà Dải alen quan sát được trình bày ở bảng 5, tần số alen được trình bày từ hình 11 đến hình 33, số alen quan sát và độ phong phú alen (Rs, Rt) được thể hiện ở bảng 6. Các giá trị Heobs, Heexp, và Fis được trình bày ở bảng 7. Bảng 5. Dải alen quan sát ở 5 quần thể gà Tên locus Dải alen quan sát (số bp của các alen) MCW0295 ADL0112 MCW0216 MCW0014 MCW0098 MCW0111 MCW0078 MCW0222 LEI0094 MCW0183 ADL0278 LEI0194 MCW0069 MCW0034 MCW0103 ADL0268 MCW0037 MCW0067 MCW0206 MCW0081 MCW0248 LEI0166 MCW0330 87-89-91-95-97-99-101-103 124-128-130 139-141-143-145 163-173-177-185 255-257 97-99-101-103-105-111 140-142-144 218-220-224 249-255-261-263-265-273-279-283 291-295-297-303-305-307-311-319 111-117-119 -121 125 -129 -135 -153-157-161-167-173-179 153-161-165-167-169-173 220-222-224-226-228-230-232-234-236-240 266-270 102-108-110-112-114 1153 -151-153-155 173-175-179 220-222-2243 -226-228-230-234-242 1061 -110-112-118-128-132-1442 215-219-221-223 248-252-344-348-3501 -352 256-266-268-274-276-286-2883 1, 2, 3: alen riêng ở gà Trới, gà Tè và gà Tò theo thứ tự. Căn cứ vào bảng 5 ta thấy, cả năm quần thể gà nghiên cứu có 118 alen chung và 6 alen riêng trong tổng số 124 alen. Quần thể gà Tò chiếm 3 alen riêng gồm alen 115bp (locus MCW0037), alen 224bp (locus MCW0206) và alen 288bp (locus MCW0330). Quần thể gà Trới có 2 alen riêng gồm alen 106bp (locus MCW0081) và 350bp (locus LEI0166). Quần thể gà Tè có một alen riêng là alen 144bp (locus MCW0081). Hai quần thể gà Móng và gà Tiên Yên không có alen riêng nào. Bảng 6. Số alen, độ phong phú alen trên mỗi locus ở mỗi quần thể gà Quần thể Gà Gà Trới Gà Móng Gà Tè Gà Tiên Yên Gà Tò Tổng số Số alen Rs Số alen Rs Số alen Rs Số alen Rs Số alen Rs Số alen Rt MCW0295 ADL0112 MCW0216 MCW0014 MCW0098 MCW0111 MCW0078 MCW0222 LEI0094 MCW0183 ADL0278 LEI0194 MCW0069 MCW0034 MCW0103 ADL0268 MCW0037 MCW0067 MCW0206 MCW0081 MCW0248 LEI0166 MCW0330 8 3 4 4 2 6 3 3 8 7 4 9 6 8 2 5 3 3 7 5 4 6 6 7.4 2.9 4.0 4.0 2.0 6.0 2.9 2.9 7.7 6.2 4.0 8.4 5.5 7.0 2.0 4.6 3.0 3.0 6.8 4.7 4.0 5.0 5.4 8 3 4 4 2 5 3 2 8 6 4 5 5 9 2 5 3 3 5 4 4 3 6 7.1 2.5 4.0 4.0 2.0 4.1 2.6 2.0 7.6 5.5 3.9 5.0 4.3 7.8 2.0 4.8 3.0 3.0 4.6 4.0 4.0 2.6 6.0 7 3 3 4 2 5 2 3 7 6 4 3 5 6 2 4 3 3 5 5 4 2 5 6.9 3.0 3.0 4.0 2.0 5.0 2.0 3.0 6.6 6.0 4.0 3.0 4.4 5.7 2.0 4.0 3.0 3.0 4.7 4.9 4.0 2.0 4.6 8 3 4 4 2 6 3 3 8 6 4 9 5 9 2 5 3 3 7 5 4 5 6 7.5 2.5 3.9 4.0 2.0 5.9 2.7 3.0 6.7 5.0 3.5 7.4 5.0 7.7 2.0 4.7 3.0 3.0 5.8 4.4 4.0 4.2 5.8 6 2 4 4 2 5 2 3 7 4 4 7 5 8 2 5 4 3 5 4 4 2 5 6.0 2.0 4.0 4.0 2.0 5.0 2.0 3.0 6.8 4.0 4.0 6.9 5.0 7.7 2.0 4.8 4.0 3.0 5.0 4.0 4.0 2.0 5.0 8 3 4 4 2 6 3 3 8 8 4 9 6 10 2 5 4 3 8 7 4 6 7 7.3 2.6 4.0 4.0 2.0 5.8 2.6 3.0 7.9 6.4 3.9 8.5 5.2 8.6 2.0 4.6 3.2 3.0 6.9 4.9 4.0 3.8 6.5 Tổng số 116 109.4 103 96.4 93 90.8 114 103.7 97 96.2 124 110.7 Rs, Rt được tính trên 29 cá thể Bảng 6 cho ta thấy số alen quan sát ở mỗi locus dao động từ 2-9 ở gà Trới, gà Móng và gà Tiên Yên; từ 2-7 ở gà Tè; và từ 2-8 ở gà Tò. Tổng alen quan sát giảm từ gà Trới (116 alen), đến gà Tiên Yên (114 alen), gà Móng (103 alen), gà Tò (97 alen) và gà Tè (93 alen). Độ phong phú alen từng locus dao động từ 2.0-8.4 ở gà Trới, từ 2.0-7.8 ở gà Móng, từ 2.0-6.9 ở gà Tè, từ 2.0-7.7 ở gà Tiên Yên và gà Tò. Gà Trới phong phú alen nhất (109.4 alen), rồi đến gà Tiên Yên (103.7 alen), gà Móng (96.4 alen), gà Tò (96.2 alen) và gà Tè (90.8 alen). Cả 5 quần thể gà có từ 2-10 alen quan sát ở mỗi locus, tổng alen quan sát là 124, độ phong phú alen từng locus dao động từ 2.0-8.6, và có 21 locus đa hình chiếm 91.3%. Hình 11. Tần số alen thuộc locus MCW0295 Hình 12. Tần số alen thuộc locus ADL0112 Hình 13. Tần số alen thuộc locus MCW0216 Hình 14. Tần số alen thuộc locus MCW0014 Hình 15. Tần số alen thuộc locus MCW0098 Hình 16. Tần số alen thuộc locus MCW0111 Hình 17. Tần số alen thuộc locus MCW0078 Hình 18. Tần số alen thuộc locus MCW0222 Hình 19. Tần số alen thuộc locus LEI0094 Hình 20. Tần số alen thuộc locus MCW0183 Hình 21. Tần số alen thuộc locus ADL0278 Hình 22. Tần số alen thuộc locus LEI0194 Hình 23. Tần số alen thuộc locus MCW0069 Hình 24. Tần số alen thuộc locus MCW0034 Hình 25. Tần số alen thuộc locus MCW0103 Hình 26. Tần số alen thuộc locus ADL0268 Hình 27. Tần số alen thuộc locus MCW0037 Hình 28. Tần số alen thuộc locus MCW0067 Hình 29. Tần số alen thuộc locus MCW0206 Hình 30. Tần số alen thuộc locus MCW0081 Hình 31. Tần số alen thuộc locus MCW0248 Hình 32. Tần số alen thuộc locus LEI0166 Hình 33. Tần số alen thuộc locus MCW0330 Từ hình 11 đến hình 33 trình bày biểu đồ tần số alen của 23 locus microsatellite. Các số ở trục hoành là kích thước của các alen tính theo bp. Tần số alen của các quần thể gà tại locus MCW0295 (hình 11) như sau: gà Trới (0.009 - 0.284), gà Móng (0.009 - 0.443), gà Tè (0.000 - 0.298), gà Tiên Yên (0.008 - 0.297) và gà Tò (0.000 - 0.485). Gà Tè không xuất hiện alen có kích thước 99bp, gà Tò không xuất hiện alen có kích thước 91bp và 99bp. Tần số alen tại locus ADL0112 (hình 12) của các quần thể gà như sau: gà Trới (0.026-0.629), gà Móng (0.009-0.731), gà Tè (0.036-0.655), gà Tiên Yên (0.008-0.678) và gà Tò (0.000-0.773). Gà Tò không xuất hiện alen có kích thước 130bp. Tần số alen tại locus MCW0216 (hình 13) của 5 quần thể gà như sau: gà Trới (0.051-0.737), gà Móng (0.056-0.796), gà Tè (0.000-0.476), gà Tiên Yên (0.035-0.763), và gà Tò (0.045 - 0.591). Gà Tè không xuất hiện alen có kích thước 139 bp. Tần số alen tại locus MCW0014 (hình 14) của 5 quần thể gà như sau: gà Trới (0.043 - 0.534), gà Móng (0.139-0.380), gà Tè (0.037-0.634), gà Tiên Yên (0.059-0.585), và gà Tò (0.030-0.621). Tại locus MCW0098 (hình 15), cả 5 quần thể gà đều có 2 alen có kích thước là 255 và 257bp, tần số alen dao động từ 0.076 - 0.924. Tần số alen tại locus MCW0111 (hình 16) của 5 quần thể gà như sau: gà Trới (0.050-0.233), gà Móng (0.000-0.481), gà Tè (0.000-0.381), gà Tiên Yên (0.025-0.237) và gà Tò (0.000-0.394). Gà Móng, gà Tè và gà Tò không xuất hiện các alen có kích thước lần lượt là 105bp, 103bp, và 105bp. Tần số alen tại locus MCW0078 (hình 17) của 5 quần thể gà như sau: gà Trới (0.033-0.558), gà Móng (0.010-0.578), gà Tè (0.000-0.583), gà Tiên Yên (0.017-0.517), và gà Tò (0.000-0.606). Gà Tè và Gà Tò đều không xuất hiện alen có kích thước 142bp. Tần số alen tại locus MCW0222 (hình 18) của 5 quần thể gà như sau: gà Trới (0.025, 0.700), gà Móng (0.000-0.585), gà Tè (0.083-0.762), gà Tiên Yên (0.068 - 0.610) và gà Tò (0.030 - 0.818). Gà Móng không xuất hiện alen có kích thước 224bp. Tần số alen tại locus LEI0094 (hình 19) của các quần thể gà giao động như sau: gà Trới (0.018 - 0.384), gà Móng (0.011-0.337), gà Tè (0.000 - 0.417), gà Tiên Yên (0.009-0.509) và gà Tò (0.000 - 0.485). Các alen không xuất hiện ở gà Tè và gà Tò có kích thước lần lượt là 255bp và 273bp. Tần số alen tại locus MCW0183 (hình 20) của các quần thể gà giao động như sau: gà Trới (0.000 - 0.518), gà Móng (0.000 - 0.813), gà Tè (0.000 - 0.444), gà Tiên Yên (0.000 - 0.644) và gà Tò (0.000 - 0.545). Gà Trới không xuất hiện alen có kích thước 291bp, gà Móng không xuất hiện alen có kích thước 297 và 319bp, gà Tè không xuất hiện alen có kích thước 305 và 319bp, gà Tiên Yên không xuất hiện alen có kích thước 291, 305bp, gà Tò không xuất hiện alen có kích thước 303, 305, 307 và 319bp. Tần số alen tại locus ADL0278 (hình 21) của các quần thể gà như sau: gà Trới (0.111-0.533), gà Móng (0.028 - 0.585), gà Tè (0.036 - 0.690), gà Tiên Yên (0.009 - 0.395) và gà Tò (0.044 - 0.838). Tần số alen tại Locus LEI0194 (hình 22) của các quần thể gà giao động như sau: gà Trới (0.011 - 0.457), gà Móng (0.000 - 0.453), gà Tè (0.000 - 0.552), gà Tiên Yên (0.010 - 0.567) và gà Tò (0.000 - 0.621). Quần thể gà Móng không xuất hiện 4 alen có kích thước lần lượt là 157, 161, 173 và 179bp, quần thể gà Tè không xuất hiện 6 alen có kích thước lần lượt là 129, 135, 161, 167, 173 và 179bp. Quần thể gà Tò không xuất hiện 2 alen có kích thước lần lượt là 157 và 161bp. Tần số alen tại locus MCW0069 (hình 23) của các quần thể gà như sau: gà Trới (0.009 - 0.562), gà Móng (0.000 - 0.657), gà Tè (0.000 - 0.607), gà Tiên Yên (0.000 - 0.542) và gà Tò (0.000 - 0.333). Gà Móng và gà Tè không xuất hiện alen có kích thước 165bp, gà Tiên Yên và gà Tò không xuất hiện alen có kích thước 169bp. Tần số alen tại locus MCW0034 (hình 24) của các quần thể gà như sau: gà Trới (0.000 - 0.627), gà Móng (0.000 - 0.537), gà Tè (0.000 - 0.595), gà Tiên Yên (0.000 - 0.648) và gà Tò (0.000 - 0.545). Quần thể gà Trới không xuất hiện 2 alen có kích thước là 226 và 234bp. Quần thể gà Móng không xuất hiện alen có kích thước 224bp. Quần thể gà Tè không xuất hiện 4 alen có kích thước lần lượt là 226, 232, 234 và 236bp. Quần thể gà Tiên Yên không xuất hiện alen có kích thước 236bp. Quần thể gà Tò không xuất hiện 2 alen có kích thước lần lượt là 226 và 228bp. Locus MCW0103 (hình 25) chỉ có 2 alen ở 5 quần thể gà có kích thước là 266 và 270bp. Tần số các alen dao động từ 0.258 - 0.742. Tần số alen tại locus ADL0268 (hình 26) của các quần thể gà như sau: gà Trới (0.017 - 0.483), gà Móng (0.028 - 0.566), gà Tè (0.000 - 0.738), gà Tiên Yên (0.017 - 0.322) và gà Tò (0.014 - 0.400). Gà Tè không xuất hiện alen có kích thước 110bp. Tần số alen tại locus MCW0037 (hình 27) của các quần thể gà như sau: gà Trới (0.000 - 0.483), gà Móng (0.000 - 0.433), gà Tè (0.000 - 0.451), gà Tiên Yên (0.000 - 0.525) và gà Tò (0.029 - 0.514). Locus này có 1 alen riêng thuộc quần thể gà Tò có kích thước là 115bp với tần số 0.029. Tần số alen tại locus MCW0067 (hình 28) của các quần thể gà như sau: gà Trới (0.190 - 0.422), gà Móng (0.226 - 0.528), gà Tè (0.202 - 0.476), gà Tiên Yên (0.127 - 0.441) và gà Tò (0.229 - 0.500). Tần số alen tại locus MCW0206 (hình 29) của các quần thể gà như sau: gà Trới (0.000 - 0.457), gà Móng (0.000 - 0.448), gà Tè (0.000 - 0.415), gà Tiên Yên (0.000 - 0.526) và gà Tò (0.000 - 0.586). Alen riêng của locus này có kích thước 224bp với tần số 0.186 thuộc quần thể gà Tè. Gà Trới không xuất hiện alen có kích thước 224bp. Gà Móng và gà Tè không xuất hiện alen có kích thước 224, 226 và 228bp. Gà Tiên Yên không xuất hiện alen có kích thước 224bp. Gà Tò không xuất hiện alen có kích thước 220, 226 và 228bp. Tần số alen tại locus MCW0081 (hình 30) của các quần thể như sau: gà Trới (0.000 - 0.719), gà Móng (0.000 - 0.792), gà Tè (0.000 - 0.655), gà Tiên Yên (0.000 - 0.788) và gà Tò (0.000 - 0.571). Tại locus này gà Trới có một alen riêng với kích thước 106bp với tần số 0.018, gà Tè có một alen riêng với kích thước là 144bp với tần số 0.024. 3 quần thể gà Trới, gà Móng, gà Tè không xuất hiện alen có kích thước 128bp. Tần số alen tại locus MCW0248 (hình 31) của các quần thể như sau: gà Trới (0.127 - 0.585), gà Móng (0.057 - 0.557), gà Tè (0.085 - 0.415), gà Tiên Yên (0.068 - 0.534) và gà Tò (0.071 - 0.643). Tần số alen tại locus LEI0166 (hình 32) của các quần thể như sau: gà Trới (0.008 - 0.559), gà Móng (0.000 - 0.837), gà Tè (0.000 - 0.512), gà Tiên Yên (0.000 - 0.568) và gà Tò (0.000 - 0.686). Tại locus này có một alen riêng thuộc gà Trới có kích thước là 350bp với tần số 0.017. Gà Móng không xuất hiện alen có kích thước 248bp và 252bp. Gà Tè và gà Tò không xuất hiện 3 alen có kích thước 248, 252 và 352bp. Tần số alen tại locus MCW0330 (hình 33) của các quần thể như sau: gà Trới (0.000 - 0.518), gà Móng (0.000 - 0.385), gà Tè (0.000 - 0.464), gà Tiên Yên (0.000 - 0.466) và gà Tò (0.000 - 0.515). Locus này có một alen riêng thuộc quần thể gà Tò có kích thước là 288bp với tần số 0.147. Gà Tè không xuất hiện alen có kích thước là 274bp. Gà Tò không xuất hiện 2 alen có kích thước là 256 và 274bp. Nhìn chung tồn tại đồng thời các alen có tần số cao và các alen có tần số thấp ở các locus. Một số quần thể gà thiếu alen ở một (vài) locus. Quần thể gà Tò có 1 alen riêng với tần số thấp (2.9%) và có 2 alen riêng với tần số cao (18.6%, 14.7%). Quần thể gà Trới có 2 alen riêng với tần số thấp (1.8% và 1.7%) và gà Tè có 1 alen riêng với tần số thấp (2.9 %,). Bảng 7. Giá trị Heobs, Heexp và Fis ở từng locus và từng quần thể gà Locus Quần thể gà Trới Quần thể gà Móng Quần thể gà Tè Quần thể gà Tiên Yên Quần thể gà Tò Heobs Heexp Fis Heobs Heexp Fis Heobs Heexp Fis Heobs Heexp Fis Heobs Heexp Fis MCW0295 ADL0112 MCW0216 MCW0014 MCW0098 MCW0111 MCW0078 MCW0222 LEI0094 MCW0183 ADL0278 LEI0194 MCW0069 MCW0034 MCW0103 ADL0268 MCW0037 MCW0067 MCW0206 MCW0081 MCW0248 LEI0166 MCW0330 0.862 0.379 0.356 0.483 0.153 0.850 0.417 0.267 0.732 0.727 0.622 0.404 0.517 0.441 0.383 0.638 0.638 0.586 0.569 0.386 0.576 0.475 0.545 0.819 0.490 0.436 0.630 0.171 0.810 0.526 0.439 0.783 0.659 0.647 0.753 0.670 0.576 0.386 0.646 0.637 0.641 0.707 0.454 0.606 0.587 0.657 -0.053NS 0.225*** 0.183*** 0.234*** 0.106NS -0.050NS 0.207NS 0.392*** 0.065NS -0.103NS 0.039NS 0.463*** 0.228*** 0.235*** 0.008NS 0.012NS -0.001NS 0.086NS 0.195*** 0.150NS 0.048NS 0.191*** 0.169*** 0.566 0.352 0.241 0.704 0.148 0.547 0.471 0.453 0.674 0.354 0.491 0.349 0.481 0.593 0.426 0.566 0.615 0.528 0.708 0.358 0.434 0.288 0.558 0.730 0.402 0.356 0.723 0.282 0.617 0.501 0.491 0.793 0.332 0.585 0.711 0.517 0.667 0.455 0.577 0.651 0.616 0.665 0.359 0.607 0.279 0.755 0.225*** 0.124NS 0.324*** 0.027NS 0.474*** 0.114NS 0.061NS 0.077NS 0.151*** -0.067NS 0.162NS 0.510*** 0.068NS 0.111NS 0.064NS 0.020NS 0.054NS 0.143NS -0.065NS 0.003NS 0.285*** -0.034NS 0.262*** 0.619 0.500 0.366 0.537 0.190 0.833 0.500 0.405 0.667 0.667 0.500 0.207 0.548 0.452 0.595 0.476 0.610 0.548 0.683 0.500 0.561 0.452 0.619 0.795 0.480 0.584 0.527

Các file đính kèm theo tài liệu này:

  • docluanvanthacsi_dinhdangword_380_6627_1869935.doc
Tài liệu liên quan