Luận văn Phân tích cộng đồng vi khuẩn phân hủy rơm rạ bằng kỹ thuật pcr - Dgge và tạo dõng

LỜI CAM ĐOAN. i

LỜI CẢM ƠN .ii

LỜI NÓI ĐẦU .iii

DANH MỤC CÁC KÝ HIỆU VÀ CHỮ VIẾT TẮT.iv

DANH MỤC CÁC BẢNG. v

DANH MỤC CÁC HÌNH ẢNH, ĐỒ THỊ.vi

MỤC LỤC.vii

CHưƠNG 1. TỔNG QUAN TÀI LIỆU. 1

1.RƠM RẠ, THÀNH PHẦN CẤU TẠO VÀ GIÁ TRỊ KINH TẾ. 1

1.1. Rơm rạ . 1

1.2. Thành phần cấu tạo rơm rạ. 3

1.3. Giá trị kinh tế của rơm rạ . 6

1.2. HỆ ENZYME CELLULASE VÀ VI SINH VẬT PHÂN GIẢI RƠM 9

1.2.1. Hệ Enzyme cellulase và cơ chế phân giải cellulose . 9

1.2.2. Hệ vi sinh phân giải cellulose . 11

1.3.KỸ THUẬT SINH HỌC PHÂN TỬ ĐỊNH LOÀI VI SINH. 12

1.3.1. Các phương pháp ly trích và thu nhận DNA vi sinh vật. 12

1.3.2. Các kỹ thuật sinh học phân tử trong định danh . 14

1.3.2.1. Kỹ thuật PCR trong trong định danh vi khuẩn. 16

1.3.2.2. Kỹ thuật PCR-DGGE trong định danh vi khuẩn. 18

1.3.2.3. Kỹ thuật tạo dòng. 20

CHưƠNG 2. VẬT LIỆU VÀ PHưƠNG PHÁP NGHIÊN CỨU. 21

2.1.VẬT LIỆU, HÓA CHẤT VÀ THIẾT BỊ NGHIÊN CỨU . 22

Hóa chất. 23

Thiết bị và dụng cụ. 24

2.2.CÁC PHưƠNG PHÁP NGHIÊN CỨU . 24

pdf69 trang | Chia sẻ: honganh20 | Ngày: 04/03/2022 | Lượt xem: 363 | Lượt tải: 2download
Bạn đang xem trước 20 trang tài liệu Luận văn Phân tích cộng đồng vi khuẩn phân hủy rơm rạ bằng kỹ thuật pcr - Dgge và tạo dõng, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
c khỏe. [37]. So sánh các phƣơng pháp ly trích DNA từ vi khuẩn trong đất, vùng rễ, phƣơng pháp SDS cho kết quả tốt nhất cả về khối lƣợng lẫn độ tinh sạch. Phƣơng pháp SDS cho kết quả tốt là do sử dụng proteinase K phá vỡ hiệu quả thành tế bào của vi sinh vật để giải phóng DNA dễ dàng. Phƣơng pháp CTAB mặc dù không làm giảm khối lƣợng DNA chiết xuất từ đất vùng rễ nhƣng độ tinh sạch chƣa cao và DNA bị ảnh hƣởng bởi nồng độ muối cao. Phƣơng pháp 14 đóng băng và tan băng it gây đứt gãy DNA nhƣng hiệu quả ly trích lại thấp. báo cáo rằng sự kết hợp giữa việc nghiền, phƣơng pháp đóng băng và tan băng, và phƣơng pháp SDS có thể thu đƣợc khối lƣợng DNA cao hơn nhiều mà không ảnh cũng loại hƣởng đến độ nguyên vẹn về cấu trúc DNA [38]. Nhiều nghiên cứu phƣơng pháp ly trích và thu nhận DNA bộ gene vi khuẩn trực tiếp từ mẫu rơm nhằm để giữ nguyên cộng đồng vi sinh hiện diện trong mẫu, trong các điều kiện hiều khí và yếm khí đang đƣợc các nhà khoa học quan tâm nghiên cứu. Việc ủ rơm và phân tích trong các giai đoạn khác nhau sẽ cho ra các kết quả về cộng đồng vi sinh khác nhau. Ngoài ra, pH của mẫu cũng làm thay đổi cộng đồng vi sinh đã đƣợc kiểm tra bằng cách sử dụng phƣơng pháp in vitro [39, 40]. DNA vi khuẩn có trong rơm trƣớc khi ủ và trong các giai đoạn ủ dài ngày, sử dụng kết hợp các phƣơng pháp nghiền mẫu trong nitơ lỏng, dùng đệm ly trích CTAB, đóng băng và tan băng, sau đó bổ sung proteinase K và SDS [41]. DNA tổng số thu đƣợc đem tinh sạch bằng phƣơng pháp của sử dụng Sephadex G-200. Một nghiên cứu khác về ly trích DNA của vi sinh vật phân giải cellulose bằng phƣơng pháp Benzyl Chloride, sau đó để loại bỏ thành phần tạp có trong mẫu chiết xuất bằng cách sử dụng Genclean spin kit (BIO101, Carlsbad, Calif.) ở giai đoạn tinh sạch [42]. 1.3.2. Các kỹ thuật sinh học phân tử và vùng gene trong định danh Để xác định tất cả các loài đã sống hoặc tồn tại trên hành tinh trái đất này, một số tiêu chí ban đầu nhƣ đặc điểm hình thái hình thành nên cơ sở của nhận dạng nhƣng sau đó các tính năng khác nhƣ sinh hóa, sinh lý và sinh học phân tử đƣợc ghi nhận phải có. Cho đến nay, hơn 1,5 triệu loài động vật, thực vật và vi sinh vật đã đƣợc định danh và ƣớc tính số lƣợng các loài sống chƣa đƣợc mô tả có thể là hơn 3 triệu, đa số là nhóm vi sinh vật. Các nhà phân loại học cho rằng ít nhất 50 triệu loài sinh vật khác nhau đã bị tuyệt chủng trong quá trình tiến hóa. Mỗi loài sinh vật có thể tồn tại ở nhiều dạng khác nhau, chúng có thể đƣợc tìm thấy ở hai giới tính khác nhau, nhóm tuổi, hình thức theo mùa và các biến thể kiểu hình khác. Trong phân loại phân tử, có thể nghiên cứu cả DNA và RNA, các kỹ thuật chính đã đƣợc sử dụng trong hệ thống bao gồm xây dựng bản đồ giới 15 hạn và phân tích RAPD, RFLP, lai DNA-DNA, lai DNA-RNA và giải trình tự bộ gene. Kỹ thuật RFLP đƣợc coi là phƣơng pháp nhạy cảm nhất để xác định chủng và một số sinh vật đã đƣợc nghiên cứu rộng rãi bằng cách sử dụng kỹ thuật này. RFLP là một kỹ thuật khai thác các biến thể trong chuỗi DNA tƣơng đồng. Phƣơng pháp PFGE và PCR đƣợc sử dụng để mô tả các loài sinh vật, trong đó PFGE sử dụng các enzyme cắt giới hạn phân tử DNA để tạo ra một kiểu đặc trƣng nhằm so sánh hai loài khác nhau dựa trên tính tƣơng đồng hoặc không giống nhau giữa chúng. Phƣơng pháp PCR, một đoạn DNA duy nhất đƣợc khuếch đại có thể là một gen mã hóa protein hoặc gen rRNA cụ thể hoặc một phần của nó trong vùng gene bảo tồn phân loại. Lai phép DNA với DNA dựa trên mức độ tái tổ hợp hai mạch với nhau với các thành viên của cùng một loài cho thấy sự lai tạo cao nhất và xa loài cho tỷ lệ lai ít hơn. Trình tự RNA cũng cung cấp cơ sở cho việc xác định hai loài riêng biệt, 16S rRNA và 18 SrRNA là một phần của tiểu đơn vị ribosome của tế bào nhân sơ và tế bào nhân chuẩn đƣợc phân lập và giải trình tự [43, 44]. Phân loại gene RNA ribosome là tiêu chuẩn vàng cho nghiên cứu phân loại phân tử trong nhiều thập kỷ. Đặc biệt, gene tiểu đơn vị ribosome 16S (16S rRNA), đã đƣợc sử dụng rộng rãi để nghiên cứu và mô tả các thành phần cộng đồng vi khuẩn trong nhiều loại hệ sinh thái bao gồm các cộng đồng liên kết với vật chủ, nhƣ hệ vi sinh vật nội sinh của con ngƣời, vật chủ các cộng đồng tự do, nhƣ môi trƣờng đất và đại dƣơng. Đầu tiên, nó có mặt khắp nơi trong cuộc sống thuộc nhóm Prokaryotic. Thứ hai, kích thƣớc và mức độ bảo tồn chức năng cao của nó dẫn đến tỷ lệ đột biến trong suốt quá trình tiến hóa của sinh vật nhân sơ. Thứ ba, và quan trọng nhất, gen 16S rRNA bao gồm cả các khu vực đƣợc bảo tồn, có thể đƣợc sử dụng để thiết kế các đoạn mồi khuếch đại trên khắp các đơn vị phân loại, cũng nhƣ 9 khu vực (V1 - V9), có thể đƣợc sử dụng một cách hiệu quả để phân biệt giữa các đơn vị phân loại. Hiện nay các nghiên cứu hiện đại thƣờng dựa vào phân tích các chuỗi RNA ribosome 16S để xác định phân loại các chủng vi khuẩn, loại phân tích này đã trở thành một tiêu chuẩn thực tế cho phân loại sinh vật nhân sơ. Trong đó gene rRNA 16S dài khoảng 1600bp và bao gồm 9 vùng có khả năng bảo 16 tồn khác nhau (V1-V9). Trong đó các khu vực bảo thủ hơn rất hữu ích để xác định các phân loại cao hơn, trong khi các khu vực tiến hóa nhanh hơn có thể giúp xác định chi hoặc loài. Phân tích so sánh các cộng đồng vi khuẩn từ các vùng sinh thái riêng biệt ở hồ Baikal đƣợc tiết lộ bằng phân tích siêu dữ liệu sử dụng các đoạn V2-V3 và V3-V4 của gen rRNA 16S. Tổng DNA đƣợc chiết xuất từ các mẫu sinh học, đƣợc khuếch đại độc lập bằng cách sử dụng các cặp mồi đƣợc thiết kế cho các đoạn V2-V3 và V3-V4 và đƣợc giải trình tự, sau đó ƣớc tính thành phần cộng đồng và đa dạng vi khuẩn bằng phƣơng pháp tin sinh học. Kết quả của nghiên cứu cho thấy rằng để ƣớc tính cộng đồng vi khuẩn đa dạng phân loại bằng cách sử dụng 16S rRNA, trong đó đoạn V2-V3 có độ phân giải cao nhất cho các phân loại bậc thấp (loài và chi). Điều này cho biết rằng các công bố sự dụng gene 16S rRNA và vùng gene V3 cho việc định danh loài có độ chính xác cao [73]. Kỹ thuật sinh học phân tử ngày nay đã phát triển mạnh và giúp đƣa những nghiên cứu đi sau vào vai trò chứng năng nguồn gốc của gene, trong đó đóng góp rất lớn trong định danh loài ngày càng chính xác hơn ở các vùng gene phân loại loài. 1.3.2.1. Kỹ thuật PCR trong trong định danh vi khuẩn Ở lĩnh vực sinh học phân tử thì PCR là một kỹ thuật có mặt khắp nơi đƣợc sử dụng rộng rãi cho mục đích chẩn đoán và nghiên cứu sinh học phân tử. PCR là sự khuếch đại trong ống nghiệm của các chuỗi axit nucleic cụ thể bằng enzyme DNA polymerase. Kỹ thuật PCR đƣợc Kary Mullis chuyển đổi vào năm 1983, khi ông mở rộng việc sử dụng một loại polymerase bền nhiệt với chu kỳ nhiệt độ. Phổ biến của PCR là nó khuếch đại một lƣợng nhỏ các chuỗi axit nucleic mục tiêu, thu đƣợc một lƣợng sản phẩm có thể phát hiện đƣợc bằng các phƣơng pháp trực tiếp quan hóa axit nucleic trên gel agarose và kết quả là hàng triệu bản sao của mẫu gốc [45, 46]. Kỹ thuật PCR ngày càng đƣợc sử dụng rộng rãi trong các nghiên cứu sinh học và cả y học phục vụ nhiều mục đích khác nhau, nhƣ phát hiện các bệnh di truyền, nhận dạng vân tay DNA, phát hiện vi khuẩn hay virus ở nồng độ thấp trong các mẫu môi trƣờng và bệnh phẩm, tách dòng gen, và xác định 17 huyết thống. Đó là những ƣu điểm mà từ khi kỹ thuật PCR đƣợc ứng dụng cho tới ngày nay. Trong một số trƣờng hợp việc nuôi cấy không thể thực hiện đƣợc với nhiều loài vi sinh vật hoặc virus hoặc trong trƣờng hợp khác là cần thời gian nuôi cấy vi sinh vật để có đủ DNA cho việc lai hoặc xác định loài. PCR ra đời đã khắc phục đƣợc những khó khăn này, khuếch đại những đoạn gen đặc trƣng của các loài vi sinh vật nghiên cứu dựa trên những cặp mồi đặc trƣng của từng loài vi sinh vật. Mỗi vi sinh vật đều có những cặp mồi chuyên biệt để có thể dựa vào đó chúng ta có thể dễ dàng xác định đƣợc chúng. Ví dụ phƣơng pháp PCR xác định một số bệnh nấm trên lúa mì đƣợc nêu trong bảng 1.5 [47]. Bảng 1.5. Phƣơng pháp PCR với mồi chuyên biệt xác định một số loài gây bệnh trên lúa mì. Cặp mồi Gene mục tiêu Trình tự đoạn mồi Chiều dài gene Tác giả Fusarium graminearum UBC85F410 SCAR GCAGGGTTTGAATCCGAGAC 332 Schilling et al., 1996 UBC85R410 AGAATGGAGCTACCAACGGC Fg16F SCAR CTCCGGATATGTTGCGTCAA 400 – 500 Nicholson et al., 1998 Fg16R GGTAGGTATCCGACATGGCAA Fgr-F IGS GTTGATGGGTAAAAGTGTG 500 Jurado et al., 2005 Fgc-R CTCTCATATACCCTCCG GOFW gaoA ACCTCTGTTGTTCTTCCAGACGG 435 Biazio et al., 2008 GORV CTGGTCAGTATTAACCGTGTGTG Fusarium culmorum OPT18F470 SCAR ATGGTGAACTCGTCGTGGC 472 Schilling et al., 1996 OPT18R470 CCCTTCTTACGCCAATCTCG Fc01F SCAR ATGGTGAACTCGTCGTGGC 570 Nicholson et al., 1998 Fc01R CCCTTCTTACGCCAATCTCG Fcg17F SCAR TCGATATACCGTGCGATTTCC 340 Nicholson et al., 1998 Fcg17R TACAGACACCGTCAGGGGG 175F ITS TTTTAGTGGAACTTCTGAGTAT 245 Mishra et al., 18 2003 430R AGTGCAGCAGGACTGCAGC Fcu-F IGS GACTATCATTATGCTTGCGAGAG 200 Jurado et al., 2005 Fgc-R CTCTCATATACCCTCCG Fc03 SCAR TTCTTGCTAGGGTTGAGGATG 144 Sanoubar et al., 2015 Fc02 GACCTTGACTTTGAGCTTCTTG Tƣơng tự ứng dụng PCR cho định danh trên nhóm vi khuẩn, sử cặp mồi 27F và 1495R để khảo sát vùng 16S-rDNA của các dòng vi khuẩn nội sinh phân lập từ nho [48], cũng sử dụng cặp mồi này khảo sát vùng 16S-rDNA của họ vi khuẩn Azotobacteraceae gồm 7 loài thuộc chi Azotobacter và 3 loài thuộc chi Azomonas [49]. PCR với một cặp mồi, U1 (5’- CCA GCA GCC GCG GTA ATA CG-3’) và U2 (5’- ATC GG(C/T) TAC CTT GTT CAG ACT TC-3’) có khả năng khuếch đại một phần của gen 16S rRNA của Eubacteria [50]. Với cặp mồi Xan1330 đƣợc thiết kế trên vùng 16S-23S xác định Xanthomonas sp [51]. Tuy nhiên phƣơng pháp PCR cũng còn nhiều hạn chế vì tính đặc hiệu phân loại chƣa cao, cùng với nhiều phƣơng pháp mới có độ đặc hiệu cao hơn. 1.3.2.2. Kỹ thuật PCR-DGGE trong định danh vi khuẩn PCR-DGGE là kỹ thuật sinh học phân tử cơ bản, đƣợc công bố lần đầu đầu tiên bởi Fischer và Lerman [52], phƣơng pháp này dựa trên sự thay đổi về nucleotide trong cấu trúc mạch DNA. Phƣơng pháp PCR-DGGE là sự kết hợp của kỹ thuật PCR cho phép khuếch đại các gene đặc hiệu và kỹ thuật DGGE điện di biến đổi liên tục nồng độ gel acrylamide cho phép phân tách các sản phẩm PCR có sự thay đổi nucleotides trong mạch DNA. Kỹ thuật DGGE cho phép phân tách các sản phẩm đoạn gene có cùng kích thƣớc nhƣng có sự thay đổi nucleotides trong mạch gene đó. Phƣơng pháp này cũng đã đƣợc ứng dụng khá phổ biến trong việc xác định đa dạng cộng đồng vi sinh vật trong môi trƣờng với các điều kiện sinh thái khác nhau. Phân tích cộng đồng vi khuẩn bằng kỹ thuật DGGE đƣợc áp dụng rộng rãi để nghiên cứu đa dạng hệ vi khuẩn bằng sinh học phân tử liên quan đến đoạn gen 16S-rDNA, những đoạn gen thể hiện cả cộng đồng vi sinh nên tránh 19 việc phân tích một hệ vi sinh quá rộng, ngƣời ta thƣờng thực hiện nghiên cứu trên đoạn ngắn đặc hiệu hơn cho vi khuẩn là vùng V3 của đoạn 16S-rDNA đƣợc chọn trong phân tích DGGE [53]. Các nghiên cứu cộng đồng vi khuẩn liên quan đến các vùng biến đổi trên đoạn gen16S-rDNA với những cặp mồi đã đƣợc ứng dụng rất đa dạng nhƣ phân tích cộng đồng vi sinh vật trong hồ chứa dầu nhiệt độ cao [54]. Một số nghiên cứu gần đây nhƣ, xác định cộng đồng xạ khuẩn trong đất Antarctic từ vùng Barrientos của Island bằng PCR- DGGE [55]. Phân tích cộng đồng tuyến trùng từ đất bằng kỹ thuật DGGE [56]. So sánh trực tiếp phƣơng pháp SSCP và DGGE tới đặc điểm cộng đồng vi sinh dựa trên đọan gene 16S rRNA [57]. Khảo sát sự đa dạng hệ vi sinh vật trong biểu mô dạ cỏ của bò bằng phƣơng pháp DGGE [58]. Sử dụng DGGE phân tích đoạn 16S rDNA cộng đồng vi sinh vật cổ sinh khí methan từ đất ruộng [58]. Ngoài ra tác giả Cheon đã ứng dụng phƣơng pháp Tạo dòng ngẫu nhiên phân tích cộng đồng vi khuẩn trong phân giải kỵ khí ở quy mô công nghiệp [59]. Một nghiên cứu của đã thành công khi sử dụng kỹ thuật PCR - DGGE phân tích hệ vi sinh vật lên men kỵ khí rơm rạ. Cùng nghiên cứu về hệ vi sinh phân giải rơm rạ có báo cáo cũng đã sử dụng kỹ thuật này xác định và giải trình tự các chủng vi khuẩn lên men kỵ khí rơm rạ trong quá trình phát triển của chúng [60]. Sử dụng cặp mồi 357F-GC và 517R xây dựng cây di truyền cộng đồng vi khuẩn có trong mẫu rơm rạ trƣớc khi ủ và trong quá trình ủ lâu ngày [61]. Còn nhiều nghiên cứu cặp mồi 341F-GC và 581R cho sản phẩm khuếch đại ở cả 6 dòng vi khuẩn nuôi thuần chủng. Sau đó, cặp mồi này đƣợc dùng để nghiên cứu về cộng đồng vi khuẩn có trong thức ăn, ruột và phân giun. Kích thƣớc trung bình của sản phẩm khuếch đại là 600bp có thể quá dài để phân tích DGGEđạt hiệu quả, cho nên việc dùng cặp mồi 341F-GC và 581R là phù hợp hơn cho kỹ thuật này vì sản phẩm khuếch đại khoảng 240bp của vùng V3 trên đoạn gen 16S-rDNA.Từ những nghiên cứu tƣơng tự đó, có thể so sánh hệ vi khuẩn trong các nghiên cứu và làm tiền đề cho các nghiên cứu tiếp theo. Các công trình công bố trong nƣớc hiện nay về kỹ thuật DGGE trong những năm gần đây đã đƣợc ứng dụng trong nghiên cứu đa dạng vi sinh ở các mẫu vật và hệ sinh cảnh khác nhau cũng nhƣ; xác định đa dạng vi khuẩn trong 20 bùn hồ khu vực nhiễm chất diệt cỏ chứa dioxin tại sân bay Đà Nẵng bằng kỹ thuật PCR-DGGE [62], sử dụng kỹ thuật điện di trên gel gradient biến tính để nghiên cứu đa dạng vi sinh vật [63], sử dụng phƣơng pháp điện di gel gradient biến tính để xác định mức độ đa dạng của vi sinh vật trong các công thức thử nghiệm xử lý đất ô nhiễm chất độc hóa học [64], phân tích cộng đồng vi khuẩn trong phân ủ bằng phƣơng pháp DGGE và sử dụng kỹ thuật PCR- DGGE phân tích cộng đồng vi khuẩn trong Rơm rạ tại huyện Lai Vung, tỉnh Đồng Tháp [65,66]. Những dữ liệu nghiên cứu đã công bố trên đây cho thấy tính hữu dụng của phƣơng pháp DGGE ngày càng đƣợc nhiều sự quan tâm nghiên cứu ứng dụng đa dạng hơn, trong đó có ứng dụng trong định loài tính đa dạng của cộng đồng vi sinh. 1.3.2.3. Kỹ thuật tạo dòng Phƣơng pháp tạo dòng chủ yếu tập trung vào các nghiên cứu phân lập và kiểm tra sự biểu hiện gene. Xác định thành phần, cấu trúc của protein đƣợc mã hóa bởi đoạn DNA cụ thể, biểu hiện gen của eukaryote trong tế bào prokaryote, nghiên cứu sự biểu hiện của mRNA, cDNA (complementary DNA, copy DNA) đƣợc tạo từ mRNA trƣởng thành (mature mRNA) sử dụng enzyme phiên mã ngƣợc là Reverse transcriptase. Thƣ viện cDNA nhất thiết phải tạo dòng cDNA tức là tạo số lƣợng lớn bản sao cDNA dựa vào cấu trúc của mRNA hoặc lƣợng nhỏ cDNA. Việc thực hiện công việc tổng hợp cDNA nguồn từ mRNA bằng kỹ thuật RT-PCR, chủ yếu dựa vào 2 phƣơng pháp tạo dòng cDNA: phƣơng pháp tạo dòng cDNA bằng plasmid với vật chủ là E.coli, và phƣơng pháp tạo dòng cDNA bằng bacteriophage lambda [67]. Ứng dụng tạo dòng trong nhân bản gen đã tạo ra một tác động to lớn đến tốc độ nghiên cứu sinh học và nó đang gia tăng sự hiện diện của nó trong một số lĩnh vực của cuộc sống hàng ngày nhƣ; nhân bản vô tính là phƣơng pháp tạo ra các gen giống hệt nhau. Ứng dụng y tế nhƣ trong y học, trị liệu ung thƣ, sinh học phân tử, lập bản đồ gen và genom ở động vật, di truyền cây và bộ gen, bộ gen chuột, nghiên cứu bộ gen, tiến bộ trong hóa học protein và sinh học cấu trúc, tổng hợp vitamin, hormone và kháng sinh. Ứng dụng nông 21 nghiệp: nhân bản vô tính trong vi khuẩn tạo điều kiện cố định đạm trong cây, chuyển gene kháng bệnh. Tuy nhiên, phần lớn các nghiên cứu ứng dụng kỹ thuật tạo dòng hiện nay chủ yếu dùng vào việc chuyển gene nhằm sản xuất sản phẩm thứ cấp hay kiểm tra biểu hiệu gene mục tiêu là chủ yếu. Hiện nay sự kết nghiên cứu sử dụng kỹ thuật tạo dòng và PCR-DGGE để phân tích cộng đồng vi khuẩn chƣa công bố. Mục tiêu của nghiên cứu này là sử dụng cả hai kỹ thuật PCR- DGGE và tạo dòng trong cùng một phân tích cộng đồng vi khuẩn trong rơm rạ. Nhằm định hƣớng sử dụng các công cụ sinh học phân tử hiện đại phân tích cộng đồng vi khuẩn, đánh giá sự hiện diện và biến động đa dạng vi khuẩn trong mẫu. 22 CHƢƠNG 2. VẬT LIỆU VÀ PHƢƠNG PHÁP NGHIÊN CỨU 2.1. VẬT LIỆU, HÓA CHẤT VÀ THIẾT BỊ NGHIÊN CỨU Đề tài đƣợc thực hiện tại phòng Vi sinh Ứng dụng của Viện Sinh học Nhiệt Đới, số 9/621 Xa Lộ Hà Nội, Khu phố 6, phƣờng Linh Trung, quận Thủ Đức, Tp. Hồ Chí Minh và Phòng nghiên cứu GSALS, Đại Học Tokyo, Nhật Bản. Vật liệu nghiên cứu: Mẫu rơm rạ dùng làm cơ chất trồng nấm Rơm thu nhận tại ấp Định Mỹ, xã Phong Hòa, huyện Lai Vung, tỉnh Đồng Tháp. Một số hình ảnh thu nhận mẫu rơm chƣa ủ ngay sau thu hoạch và gom lại trong ngày xem hình 2.1.A và thu nhận mẫu rơm sau khi ủ và trƣớc khi lên luống trồng nầm Rơm ở hình 2.1E ở độ sau trong ụ rơm ủ khoảng 50cm. Các thông số diện tích của ụ rơm ủ có chiều dài khoảng 17-20m, chiều rộng 5-6m và chiều cao 1.2-1.5m xem hình 2.1C. Nhiệt độ đo ụ rơm ủ trong suốt giai đoạn ủ. Hình 2.1. Một số hình ảnh thu nhận lấy mẫu Rơm. A. Hình ảnh thu mẫu Rơm trƣớc khi ủ. 23 B. Hình ảnh ngƣời dân chuyển Rơm từ ghe lên nơi ủ. C. Hình ảnh ụ rơm chuẩn bị ủ. D. Hình ảnh đo nhiệt độ suốt trong giai đoạn ủ. E. Hình ảnh thu mẫu Rơm sau hoàn tất giai đoạn ủ trƣớc khi trồng Nấm Rơm. F. Hình ảnh luống Rơm chuẩn bị cấy meo Nấm rơm. Hóa chất Agar CMC 1% (Carboxymethylcellelose Sodium Salt): CMC 10g, Agar 20g, Nƣớc cất vừa đủ 1000 ml. Thuốc nhuộm Congo red 0.1%: Congo red 0,5 g/500ml H2O. Các hóa chất dùng trong ly trích DNA: Lysis buffer (100 mM Tris HCl, pH = 8; 100 mM sodium EDTA, pH = 8; 100 mM, sodium phosphate, pH = 8; 1,5 M NaCl và 1% CTAB), Proteinase K (10 mg/ml), SDS 20%, Chloroform/isoamyl alcohol (24:1), isopropanol, ethanol 70% lạnh, nƣớc cất 2 lần. Các hóa chất dùng trong tinh sạch DNA: Bộ Kit QIAquick PCR Purification Kit (hãng QIAGEN) tinh sạch sản phẩm PCR vùng V3 của đoạn gen 16S-rDNA. Bộ Kit Gel Extraction of QIAEX II Kit (hãng QIAGEN) tinh sạch và thu nhận DNA từ gel polyacrylamide. Các hóa chất dùng trong điện di: Agarose, TAE (Tris, Acid acetic, EDTA), Ethidium bromide, loading dye 6X. Các hóa chất dùng trong phản ứng PCR: Nƣớc khử ion, dNTPs, Buffer 10X, MgCl2, Taq polymerase. Các mồi đƣợc sử dụng trong bảng 2.1. Bảng 2.1. Các cặp mồi cho vi khuẩn sử dụng trong nghiên cứu. Gene Tên mồi Trình tự Tác giả 24 16S- rDNA 27F 1492R 5’- AGAGTTTGATCCTGGCTCAG - 3’ 5’- GGTTACCTTGTTACGACTT - 3’ Lane, 1991 V3 357F- GC 517R 5’-CGCCCGCGCGCGGCGGGCGGG GCGGGGGCACGGGGGCCTACGGGA GGCAGCAG - 3’ 5’ - ATTACCGCGGCTGCTGG - 3’ Muyzer, 1993 V3 357F 517R 5’ - CCTACGGGAGGCAGCAG - 3’ 5’ - ATTACCGCGGCTGCTGG - 3’ Muyzer, 1993 Các hóa chất dùng trong kỹ thuật DGGE: Gel polyacrylamide, TAE, thuốc nhuộm SYBR Green, chất làm đông tụ gel TEMED, APS 10%, loading dye 6X. Thiết bị và dụng cụ Các thiết bị và dụng cụ đƣợc sử dụng trong thí nghiệm sau: Máy khuấy từ, lò điện, máy vortex, máy đo pH, bể ổn nhiệt, tủ sấy Prolabo, máy ly tâm lạnh của hãng JiCa, bộ điện di, hộp đèn soi UV Uvitec, tủ lạnh, tủ đông -200C Alaska, lò viba, hệ thống chụp hình điện di BioRad, máy PCR Sprint Thermo Cycle, bộ điện di trong phân tích DGGE của hãng BioRad gồm các tấm kính dùng làm khuôn gel, lƣợc, buồng điện di và bộ nguồn. Các dụng cụ đƣợc sử dụng: Các loại pipetteman có dung tích từ 0,5 - 1.000 µl và các đầu type tƣơng ứng, cân phân tích, ống ly tâm lớn, ống tube loại 1 ml và 1,5 ml, các loại dụng cụ thủy tinh chịu nhiệt, buồng điện di, găng tay, khẩu trang, đồ bảo hộ. 2.2. CÁC PHƢƠNG PHÁP NGHIÊN CỨU Qui trình chung thực hiện các phƣơng pháp và kỹ thuật cho nghiên cứu xem hình 2.2. 25 Hình 2.2. Qui trình thực hiện trong nghiên cứu. 26 2.2.1.Phƣơng pháp ly trích và thu nhận DNA Quy trình ly trích và thu nhận DNA bộ gene vi sinh vật từ mẫu Rơm nghiên cứu thực hiện theo hình 2.3. Hình 2.3. Qui trình ly trích và thu nhận DNA từ mẫu Rơm. 27 2.2.2. Phƣơng pháp PCR nhân bản gene 16S rDNA và vùng gene V3 Phản ứng khuếch đại đoạn gen16S-rDNA đƣợc thực hiện với cặp mồi chuyên biệt cho nhóm vi khuẩn là 27F và 1492R. Thành phần phản ứng PCR với tổng thể tích 25µl và chu trình nhiệt ở bảng 2.2và bảng 2.3. Bảng 2.2. Thành phần phản ứng PCR. Thành phần phản ứng Thể tích (µl) Buffer 10X 2,5 MgCl2 (25 mM) dNTPs (2,5 mM) 2 2 Primer 27F (100 µM) 0,1 Primer 1492R (100 µM) DNA khuôn (200ng/µl) 0,1 1 Nƣớc khử ion 17,3 Tổng thể tích 25 Bảng 2.3. Chu trình nhiệt phản ứng PCR. Số chu kì lặp lại Nhiệt độ (0C) Thời gian (phút) 1 95 15 30 95 54 72 1 1 2 1 72 10 28 Sản phẩm PCR đƣợc kiểm tra qua bộ điện di trong gel agarose 1% và dƣới ánh sáng UV. Bƣớc 1. Chuẩn bị bộ điện di. Bƣớc 2. Chuẩn bị gel agarose 1%; Cân 1g agarose cho vào chai thủy tinh có chứa 100ml TAE 1X. Đun cho đến khi agarose tan hoàn toàn, lắc đều, để nguội cho đến khoảng 50 - 600C thì đổ vào khuay gel. Bƣớc 3. Cho gel vào bồn điện di và nạp mẫu vào giếng gel với thể tích 2µl Loading dye và 5µl mẫu, chạy điện di 45 phút với nguồn điện 110Volt. Bƣớc 4. Sau điện di, thực hiện nhuộm gel với Ethidium Bromide trong 15 phút. Bƣớc 5. Quan sát kết quả sản phẩm PCR dƣới hộp đèn UV. Nhân bản vùng gene V3: Vùng V3 thuộc đoạn 16S-rDNA đƣợc khuếch đại với cặp mồi chuyên biệt cho nhóm vi khuẩn là 517R và 357F - GC. Thành phần phản ứng với tổng thể tích 25µl và chu trình nhiệt đƣợc trình bày ở bảng 2.4 và bảng 2.5. Bảng 2.4. Thành phần phản ứng PCR vùng gene V3. Thành phần phản ứng Thể tích (µl) Buffer 10X 2,5 MgCl2 (25 mM) dNTPs (2,5 mM) 2 2 Primer 357F-GC (100 µM) 0,1 Primer 517R (100 µM) DNA khuôn 0,1 0,5 Nƣớc khử ion 17,8 Tổng thể tích 25 29 Bảng 2.5. Chu kỳ nhiệt phản ứng PCR gene V3. Số chu kì lặp lại Nhiệt độ (0C) Thời gian 1 94 3 phút 30 94 55 72 1 phút 1 phút 1 phút 30 giây 1 72 8 phút Tƣơng tự nhƣ ở kiểm tra sản phẩm PCR đƣợc kiểm tra qua bộ điện di nhƣ trong gel agarose 2% và dƣới ánh sáng UV. 2.2.3. Phƣơng pháp tinh sạch sản phẩm gene V3 Trƣớc khi phân tích DGGE đoạn gen đã đƣợc khuếch đại, mẫu DNA đƣợc tinh sạch nhằm loại bỏ các tạp chất còn lại sau phản ứng PCR bằng bộ kit QIAGen PCR Purification Kit. Quy trình tinh sạch nhƣ sau: Bƣớc 1. Chuyển sản phẩm PCR vào ống tube 1.5ml, thêm buffer PB vào mẫu với tỉ lệ 5:1(v/v) rồi trộn đều (vortex). Nếu màu của hỗn hợp là màu cam hay tím thì thêm 10µl Sodium Acetate 3M, pH 5,0 và trộn đều cho hỗn hợp chuyển về màu vàng. Bƣớc 2. Sau khi trộn đều chuyển toàn bộ dịch vào ống spin column tube 2ml, ly tâm 13.000rpm/1phút ở 40C. Bƣớc 3. Chuyển cột lọc sau ly tâm sang ống tube 2ml mới, thêm vào cột spin column thể tích 750µl buffer PE. Ly tâm 13.000rp/1phút ở 40C, sau đó tiếp tục chuyển cột spin column sang ống tube 2ml mới và ly tâm 13.000prm/phút trong 1 phút để loại bỏ hoàn toàn PE. Bƣớc 4. Cho thêm 500µl dung dịch đệm Capture vào cột spin column, ly tâm 13.000rpm/phút trong 30 giây ở 40C. 30 Bƣớc 5. Loại bỏ phần dịch và thu cột spin column. Bƣớc 6. Thêm 500µl dung dịch Wash buffer vào giữa cột spin column, ly tâm 13.000rpm/phút trong 30 giây ở 40C. Bƣớc 6. Tiếp tục loại bỏ phần dịch, thu cột spin column và đặt vào ống tube mới. Bƣớc 7. Thêm 50µl Tris - HCl 10mM hoặc nƣớc khử ion. Bƣớc 8. Ủ trong khoảng 10 phút ở nhiệt độ phòng. Bƣớc 9. Ly tâm 6.000rpm/phút trong 30 giây. Bƣớc 10. Thu dịch chứa sản phẩm DNA. 2.2.4. Phƣơng pháp thực hiện kỹ thuật DGGE 2.2.4.1. Qui trình chuẩn bị gel polyacrylamine và thực hiện DGGE Chuẩn bị bộ gel polyacrylamine dùng trong kỹ thuật DGGE với nồng độ gel polyacrylamine đƣợc pha theo bảng 2.6. Bảng 2.6. Chuẩn bị cách pha nồng độ bảng gel polyacrylamine. Thành phần trong gel 0% UF 6% BA 50% UF 6% BA 0% UF 12% BA 80% UF 12% BA 50X TAE (ml) 2 1 1 2 Acrylamine (g) 6 3 6 12 Bis-Acrylamine (g) 0,162 0,081 0,162 0,324 Urea (g) 0 10,5 0 33,6 Formamide (ml) 0 10 0 32 Tổng thể tích (ml) 100 50 50 100 31 Sau khi pha gel polyacrylamide theo bảng 2.6, tiến hành phối trộn các nồng độ trên vào hai xilanh: - Xilanh 1: Tƣơng ứng với nồng độ polyacrylamide thấp. - Xilanh 2: Tƣơng ứng với nồng độ polyacrylamide cao. Tỷ lệ phối trộn vào 2 xilanh nhƣ bảng 2.7. Bảng 2.7. Tỷ lệ phối trộn nồng độ gel polyacrylamide vào hai xilanh. Các bƣớc thực hiện trong kỹ thuật DGGE. Bƣớc 1: Chuẩn bị dung dịch đệm và pha gel polyacrylamide. Dung dịch đệm thƣờng sử dụng trong bản gel polyacrylamide là TAE 0,5X. Gel polyacrylamide đƣợc pha theo tỷ lệ phối trộn nhƣ bảng 3.7, sau đó lọc qua màng lọc có kích thƣớc khoảng 0.2µl và chất làm đông gel 10µl TEMED với 50µlAPS. Hút vào ống xilanh với hai nồng độ khác nhau, sau đó lắp vào hệ thống phân phối gel tiến hành đổ gel, sau hoàn tất nạp gel vào bảng gel chờ khoảng 3 giờ để gel đông tụ. Bƣớc 2: Lắp gel vào bồn điện di, nhiệt độ ổn định trong bể là 600C. Nạp mẫu vào mỗi giếng

Các file đính kèm theo tài liệu này:

  • pdfluan_van_phan_tich_cong_dong_vi_khuan_phan_huy_rom_ra_bang_k.pdf
Tài liệu liên quan