Tóm tắt Luận án Chọn tạo giống lúa tính trạng hàm lượng Amylose thấp bằng chỉ thị phân tử SSR trên quần thể lai hồi giao - Hồ Văn Được

Bốn mươi mốt chỉ thị phân tử được sử dụng để đánh giá đa dạng

di truyền giữa các giống lúa bố mẹ, bao gồm 1 chỉ thị phân tử đánh

dấu gen quy định hàm lượng amylose và 40 chỉ thị liên quan đến các

thành phần năng suất và năng suất.

Chỉ thị Wx được dùng kiểm tra gen liên quan hàm lượng

amylose thấp trên các giống lúa. Với chỉ thị Wx, kết quả khuếch đại

PCR cho băng hình ở hai kích thước khác nhau 210 bp và 220 bp

(Hình 3.6). Ở kích thước 220 bp, các giống KDML105, Jasmine85 và

OM7347 thể hiện băng hình ở vị trí này, đây cũng là kích thước của

gen wx. Các giống như IR64, OM5930, OM6073 và OM6976 cho

băng hình ở kích thước 210 bp. Các giống này biểu hiện không mang

gen wx.

pdf27 trang | Chia sẻ: trungkhoi17 | Lượt xem: 431 | Lượt tải: 0download
Bạn đang xem trước 20 trang tài liệu Tóm tắt Luận án Chọn tạo giống lúa tính trạng hàm lượng Amylose thấp bằng chỉ thị phân tử SSR trên quần thể lai hồi giao - Hồ Văn Được, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
điểm thí nghiệm Các thí nghiệm được thực hiện tại Viện Lúa ĐBSCL. Thời gian thực hiện từ tháng 10/2013 đến tháng 06/2017. 5. Những đóng góp mới của luận án 4 Đề tài đã đánh giá và khai thác hiệu quả nguồn vật liệu bố mẹ mà các nghiên cứu trước đây ở Việt Nam còn nhiều hạn chế. Bên cạnh mục tiêu chọn tạo giống có hàm lượng amylose thấp, đề tài còn chú ý đến năng suất cao và thời gian sinh trưởng phù hợp. Điều này là điều kiện quyết định để các sản phẩm giống lúa có thể ứng dụng và phát triển rộng khi đề tài kết thúc. Kết hợp giữa lai tạo truyền thống, sinh học phân tử và tin sinh học trong nghiên cứu. 6. Bố cục của luận án Luận án dài 166 trang, gồm phần giới thiệu, tổng quan tài liệu, phương pháp nghiên cứu, kết quả thảo luận và phần kết luận và đề nghị và phần phụ lục. Luận án có 12 bảng, 33 hình và 156 tài liệu tham khảo. Chương 2: PHƯƠNG PHÁP NGHIÊN CỨU 2.1. Vật liệu thí nghiệm Giống lúa: 88 giống lúa mùa thu thập từ các tỉnh ĐBSCL và 71 giống lúa cao sản được thu thập từ ngân hàng gen của Bộ môn Di truyền-Chọn giống, Viện Lúa ĐBSCL. 2.2. Phương pháp thí nghiệm 2.2.1. Nội dung 1: Đánh giá vật liệu bố mẹ sử dụng trong nghiên cứu chọn tạo giống lúa phẩm chất cao có hàm lượng amylose thấp. 2.2.1.1. Đánh giá hàm lượng amylose Phân tích hàm lượng amylose trên lúa gạo được thực hiện bằng phương pháp sinh hóa của Seko (2003). Hình 2.1. Phản ứng màu của các giống lúa phân tích hàm lượng amylose. 5 Bảng 2.1. Tiêu chuẩn đánh giá hàm lượng amylose trên hạt (IRRI, 1996). Hàm lượng amylose (%) Tiêu chuẩn Phân loại 0-2 2-20 20-25 > 25 Rất thấp Thấp Trung bình Cao Nếp Gạo dẻo Gạo mềm cơm Gạo cứng cơm 2.2.1.2. Đánh giá các đặc tính nông học, các thành phần năng suất và năng suất Đánh giá các đặc tính nông học, các thành phần năng suất và năng suất theo QCVN01-55:2011/BNNPTNT. 2.2.1.3. Phân nhóm đa dạng di truyền kiểu hình Phân tích kết quả phân nhóm bằng phần mềm NTSYSpc theo (Rohlf, F.J. (1992). 2.2.1.4. Đa dạng nguồn gen trên các giống lúa bố mẹ ❖ Ly trích ADN từ cây lúa: Phương pháp ly trích ADN thực hiện theo quy trình của IRRI (1996). ❖ Khuếch đại gen mục tiêu thông qua phương pháp PCR-SSR: Sản phẩm PCR được khuếch đại thông qua microsatellite (SSR) theo phương pháp của IRRI (1996) và Nguyễn Thị Lang (2002). 2.2.2. Nội dung 2: Đánh giá hiệu quả di truyền của các tổ hợp lai 2.2.2.1. Lai tạo lúa trong nhà lưới - Chọn bố mẹ: Đối với cây mẹ, bông phải trổ khỏi bẹ từ 50- 60%. Đối với cây bố, bông lúa trổ vươn ra khỏi bẹ và các hoa lúa nở để lộ các nhị đực vàng ra bên ngoài vỏ trấu. - Khử đực trên cây mẹ: thời gian khử đực thường vào lúc chiều mát (khoảng 15 đến 17 giờ). Bông lúa được tách nhẹ nhàng ra khỏi bẹ đòng, sau đó được xử lý bằng cách dùng kéo cắt bỏ các hoa đã nở ở chóp bông (nhị đực đã phơi ra) và những hoa còn non ở cuối bông. Các bông lúa đã khử đực được bao bọc lại bằng giấy bóng mờ, không thấm nước, cố định và ghi thông tin lên bao giấy (Hình 2.2). 6 Hình 2.2. Thao tác khử đực trên cây mẹ (Hồ văn Được, Viện Lúa ĐBSCL, 2013). Cách phủ phấn: thời gian phủ phấn lúc có nắng tốt (thường khoảng 9-10 giờ). Chăm sóc bông lai: kiểm tra hạt lai sau 3 - 4 ngày phủ phấn. Hình 2.3. Sự thụ phấn và tạo hạt lai (Hồ văn Được, Viện Lúa ĐBSCL, 2013). 2.2.2.2 Đánh giá hiệu quả chọn lọc tính trạng mục tiêu dựa trên các quần thể lai F2 Đánh giá sự di truyền và hiệu quả chọn lọc của các cặp bố mẹ ở thế hệ F2 nhằm chọn lọc các tổ hợp lai phù hợp để chuyển các gen mục tiêu từ cây bố vào hệ gen của cây mẹ. Các chỉ số di truyền bao gồm: Phương sai kiểu gen: σ2g = [(TrMS - EMS) / r] Phương sai kiểu hình: σ2p = [σ 2 g + EMS] Hệ số di truyền: h2BS = [σ 2 g / σ 2 p] Hiệu quả chọn lọc: GA = i . h2BS . (σ 2 p) -1 Trong đó: σ2g: phương sai kiểu gen; σ 2 p: phương sai kiểu hình; TrMS: trung bình bình phương của nghiệm thức; EMS: trung bình bình phương của sai số; r: số lần lặp lại của thí nghiệm; h2BS: hệ số di truyền theo nghĩa rộng; GA: hiệu quả chọn lọc; i: giá trị chuẩn của cường độ chọn lọc (i(10%)=1,76). 7 Quần thể F2 nào có giá trị hệ số di truyền càng cao và hiệu quả chọn lọc càng cao thì quần thể đó cho hiệu quả lai tạo và di truyền kiểu gen càng tốt. 2.2.3 Nội dung 3: Chọn tạo quần thể lai hồi giao có hàm lượng amylose thấp thông qua MAS Lai tạo và chọn lọc các quần thể lai hồi giao nhờ các chỉ thị phân tử (BC1F1- BCnF1). 8 Hình 2.5. Sơ đồ quy tụ gen waxy trên quần thể lai hồi giao thông qua MAS. - BC1F1 RP X MAS Giống mẹ (giống nhận gen - RP) Giống bố (giống cho gen - DP) - Năng suất trung bình đến khá - Hàm lượng amylose thấp - Chỉ thị Wx - Cây BC1F1 dị hợp tử gen waxy - Đồng hợp tử gen đánh dấu trên cây mẹ - Chỉ thị Wx - Cây BC1F1 dị hợp tử gen waxy - Đồng hợp tử gen đánh dấu trên cây mẹ BCnF1 - Chỉ thị Wx - Cây BC1F1 dị hợp tử gen waxy - Đồng hợp tử tất cả các gen đánh dấu trên cây mẹ BCnF2 - Chỉ thị phân tử cho đa hình trên 12 nhiễm sắc thể - Lập bản đồ GGT đánh giá sự tái tổ hợp gen trên quần thể con lai. BCnF3 - Đánh giá kiểu hình và kiểu gen - Chọn lọc và nhân rộng X F1 RP - Chỉ thị Wx (210bp-220bp) - Cây F1 dị hợp tử gen waxy MAS BC2F1 RP X - Chỉ thị Wx - Cây BC1F1 dị hợp tử gen waxy - Đồng hợp tử gen đánh dấu trên cây mẹ MAS BC3F1 - Năng suất cao, ổn định - Hàm lượng amylose cao 9 Bước 1: Chọn lọc bố mẹ phù hợp. Đánh giá đa hình kiểu gen giữa giống bố (giống cho gen, donor, DP) và giống mẹ (giống nhận gen, recipient, RP) đối với gen waxy và các gen được đánh dấu trên cá thể mẹ (gen tái tổ hợp). Bước 2: Lai tạo quần thể lai hồi giao. Các cá thể F1 được lựa chọn cho lai hồi giao là các cá thể mang gen waxy dị hợp tử. Cây F1 được lai lại với giống mẹ (RP) tạo quần thể BC1F1. Các cá thể BC1F1 được chọn lọc thông qua MAS (dị hợp tử trên gen waxy và đồng hợp tử trên các gen tái tổ hợp) được cho lai với cây mẹ (RP) để tạo quần thể BC2F1. Bước 3: Chọn lọc dòng thuần các quần thể lai hồi giao. Các dòng hồi giao mang gen waxy dị hợp tử và mang gần như toàn bộ nền di truyền của cây mẹ (các gen tái tổ hợp đồng hợp như cây mẹ đạt khoảng 90%) được cho tự thụ để đạt được quần thể BCnF2. Đối với gen mục tiêu (waxy), ở thế hệ này, các cá thể thể hiện gần như toàn bộ các alen và việc chọn lọc gen đích là hiệu quả nhất. Các thế hệ của quần thể được cho tự thụ và chọn lọc liên tục cho đến dòng thuần. 2.3.4 Nội dung 4: Chọn lọc các quần thể hồi giao BCnF2 thông qua lập bản đồ GGT 2.3.4.1 Kiểm tra kiểu gen của quần thể con lai trên 12 nhiễm sắc thể dựa trên các chỉ thị phân tử đa hình giữa cây bố và mẹ Phương pháp ly trích ADN, PCR, kiểm tra sản phẩm PCR được thực hiện tương tự như phần 2.3.1.4. 2.3.4.2 Lập bản đồ GGT đánh giá sự di truyền của quần thể con lai, qua đó chọn lọc các cá thể mang gen mục tiêu mong muốn. Phương pháp GGT do Young and Tanksley đề xuất (1989). Phương pháp lập bản đồ GGT thông qua các bước như sau: (1) Lập file dữ liệu trên Excel: mã hóa gen của quần thể với A, B là kiểu gen đồng hợp tử của cây bố mẹ; H là kiểu gen dị hợp tử; U là kiểu gen chưa được xác định. (2) Nhập dữ liệu vào cửa sổ GGT: chuyển đổi dữ liệu Excel sang dữ liệu GGT. (3)Xử lý số liệu trong GGT, (4) Đăng xuất kết quả. 2.2.5 Nội dung 5: Đánh giá và chọn lọc cá thể có hàm lượng amylose và năng suất cao trên các quần thể lai hồi giao BCnF3 2.2.5.1 Phương pháp bố trí thí nghiệm 10 Các cá thể của quần thể BCnF3 được trồng trên ruộng thí nghiệm. Chọn dòng triển vọng được bố trí theo kiểu tuần tự, không lặp lại, cấy 1 tép với khoảng cách 20 x 15 cm. 2.2.5.2 Đánh giá kiểu hình và kiểu gen liên quan hàm lượng amylose trên quần thể con lai Phân tích hàm lượng amylose (%): Phương pháp thực hiện tương tự như phần 2.2.1.1. Phân tích độ trở hồ (cấp): Phân tích độ trở hồ được thực hiện theo phương pháp của IRRI (1996). Bảng 2.2. Thang điểm đánh giá nhiệt trở hồ theo tiêu chuẩn của IRRI (1996). Thang điểm Độ lan rộng Độ trong suốt Phân lọai 1 Hạt gạo còn nguyên Hạt gạo trắng bột Cao 2 Hạt gạo phòng lên Hạt gạo trắng bột, viền vừa tươm bột Cao 3 Hạt gạo phồng lên, viền còn nguyên hay rõ nét Hạt gạo trắng bột, viền nhòe như bong gòn Cao 4 Hạt gạo phồng lên, viền còn nguyên và nở rộng. Tâm nhòe như bong gòn, viền còn đục Trung bình 5 Hạt rã ra viền hoàn toàn và nở rộng Tâm nhòe như bong gòn, viền trong suốt Trung bình 6 Hạt tan ra hòa chung với viền Tâm đục, viền trong suốt Thấp 7 Hạt hòa tan hoàn toàn và quyền vào nhau Tâm và viền trong suốt Thấp Phân tích độ bền gel (mm): Phân tích độ bền gel theo phương pháp của Tang et al. (1991). Bảng 2.3. Phân loại độ bền thể gel theo tiêu chuẩn SES (IRRI, 1996) Phân loại độ bền gel Chiều dài gel (mm) Mềm Trung bình Cứng 61 – 100 41 – 60 < 40 2.2.5.3 Đánh giá các thành phần năng suất và năng suất để chọn lọc các dòng con lai ưu tú vừa có hàm lượng amylose thấp vừa có năng suất cao 11 Phương pháp đánh giá các thành phần năng suất và năng suất tương tự như mục 2.2.1.1. 2.2.6. Phương pháp xử lý số liệu Số liệu được nhập và lưu trữ bằng chương trình Microsoft Ofice Excel 2013. Phân tích và thống kê số liệu (ANOVA, DUCAN) bằng Microsoft Ofice Excel, Cropstat 7.2, STAR. Phân nhóm di truyền sử dụng phần mềm NTSYSpc. Vẽ biểu đồ sử dụng Microsoft Ofice Excel, R-studio. Chọn lọc cá thể của quần thể thông qua phân tích Graphical genotypes 2 (GGT 2.0). Chương 3: KẾT QUẢ VÀ THẢO LUẬN 3.1. Nội dung 1: Đánh giá vật liệu bố mẹ sử dụng trong nghiên cứu chọn tạo giống lúa phẩm chất cao có hàm lượng amylose thấp Trong nghiên cứu này, 88 giống lúa mùa và 71 giống lúa cao sản lần lượt được đánh giá hàm lượng amylose, các tính trạng nông học, các thành phần năng suất và năng suất. Những giống lúa có đặc tính tốt, phù hợp với mục tiêu nghiên cứu sẽ được chọn để làm vật liệu lai. 3.1.1. Đánh giá hàm lượng amylose trên bộ giống vật liệu lai Trên bộ giống lúa cao sản, kết quả đánh giá hàm lượng amylose được ghi nhận như sau: 17 giống có hàm lượng amylose thấp (chiếm 24%), 27 giống có hàm lượng amylose trung bình (chiếm 38%) và 27 giống có hàm lượng amylose cao (chiếm 38%). Trong khi đó, đối với bộ lúa địa phương, 1 giống có hàm lượng amylose rất thấp (3,67%) (chiếm 1,1%), 31 giống có hàm lượng amylose thấp (chiếm 35,2%), 34 giống có hàm lượng amylose trung bình (chiếm 38,7%) và 22 giống có hàm lượng amylose cao (chiếm 25,0%) (Hình 3.1). Kết quả này hợp lý với các thí nghiệm trước đây, thông thường các giống lúa mùa thường có hàm lượng amylose thấp hơn các giống lúa cao sản. 12 Hình 3.1. Hàm lượng amylose (%) các giống lúa của bộ vật liệu lai. Ghi chú: A) Hàm lượng amylose của các giống cao sản B) Hàm lượng amylose của các giống lúa mùa địa phương. 3.1.2. Đánh giá đặc tính nông học trên bộ giống lúa vật liệu lai Đối với bộ lúa cao sản, thời gian sinh trưởng dao động trong khoảng 88-110 ngày, trong đó, các giống có thời gian sinh trưởng 90- 95 ngày chiếm tỷ lệ cao nhất (42,3%) (Hình 3.2a). Đối với bộ lúa địa phương, thời gian sinh trưởng dài hơn dao động trong khoảng 128-166 ngày, trong đó, các giống có thời gian sinh trưởng 150-160 ngày chiếm tỷ lệ cao nhất (36,4%) (Hình 3.2b). So với bộ lúa địa phương, thời gian sinh trưởng của các giống lúa cao sản ngắn hơn rõ rệt. Do đó, các giống lúa cao sản này cũng được tập trung xem xét tuyển chọn làm vật liệu bố mẹ cho lai tạo các giống ngắn ngày hiện nay. Hình 3.2. Thời gian sinh trưởng (ngày) được ghi nhận trên các giống lúa của bộ lúa địa phương (a) và bộ lúa cao sản (b). Ghi chú: a) Thời gian sinh trưởng của các giống lúa cao sản. b) Thời gian sinh trưởng của các giống lúa địa phương. 24% 38% 38% 0% 1,1% 38,7% 35,2% 25,0% A) B) 13 3.1.3. Đánh giá các thành phần năng suất và năng suất trên bộ giống lúa vật liệu lai Qua đánh giá năng suất thực tế của các giống lúa cho thấy các giống cao sản cho năng suất cao hơn các giống lúa địa phương trên cùng một diện tích đất canh tác, năng suất các giống lúa cao sản dao động trong khoảng 2,0-7,7 tấn/ha trong khi ở các giống lúa địa phương năng suất chỉ đạt trong khoảng 1,0-5,2 tấn/ha (Hình 3.3). Các giống lúa cao sản cho năng suất cao bao gồm: OM6976, OM5930, Jasmine 85, OM6073 và OM7347. Các giống lúa mùa cho năng suất cao bao gồm: Trắng hòa bình, Lùn đỏ, HTA88086, Đức hoà và KDM105. Hình 3.3. Năng suất thực tế (tấn/ha) của các giống lúa trong bộ vật liệu lai. 3.1.4. Phân tích đa dạng di truyền kiểu hình của bộ giống lúa vật liệu lai. Các giống lúa được phân nhóm di truyền kiểu hình trên phần mềm NTSYSpc 2.1 (Hình 3.4 và Hình ...) dựa trên chỉ tiêu hàm lượng amylose và năng suất thực tế giữa các giống. Hệ số tương quan giữa các giống lúa cao sản là 0,02-4,56 trong khi giữa các giống lúa mùa là 0,07-8,37. Điều này cho thấy quan hệ di truyền của các giống lúa mùa đa dạng hơn so với các giống lúa cao sản. Đối với bộ lúa cao sản, hàm lượng amylose dao động trong khoảng 16-32%, năng suất đạt từ 2,0- 7,5 tấn/ha. Về quan hệ di truyền, bộ lúa cao sản được phân thành hai nhóm chính ở hệ số tương quan 3,70-4,56, bao gồm: nhóm I (nhóm có hàm lượng amylose từ 23-32%) và nhóm II (nhóm có hàm lượng amylose 16-22%). Đối với bộ lúa mùa, hàm lượng amylose dao động 14 từ 3-31%.%. Tuy nhiên, năng suất của bộ lúa mùa nhìn chung thấp hơn các giống cao sản, năng suất dao động trong khoảng 1,0-5,0 tấn/ha. Có hai nhóm di truyền chính: Nhóm I là nhóm có hàm lượng amylose cực thấp (3-18%), tuy nhiên, năng suất các giống này khá thấp (chỉ đạt 1-4 tấn/ha). Nhóm II có hàm lượng amylose rất đa dạng từ thấp đến cao (18-31%). 17 Coefficient 0.02 1.16 2.29 3.42 4.56 Jasmine85 AS996 OM10385 OM10041 OM6840 TLR204 OM7L TLR368 TLR602 TLR393 TLR390 OM10105 TLR605 TLR392 OM10258 TLR594 OM8108 TLR395 OM3673 OM10357 OM7340 OM10396 OM10383 OM6526 OM10418 OM138 OM6842 OM6707 TLR444 TLR397 TLR604 OM7341 OM8370 OM5930 OM6073 OM6976 OM10050 OM10373 OM8900 OM8901 CanTho2 OM10236 TLR394 OM10450 OM6564 TLR465 OM10000 OM10043 OMCS2012 TLR462 OM7345 TLR458 TLR459 TLR464 OM10040 TLR601 OM10042 OM10252 TLR369 TLR456 TLR606 CanTho3 TLR457 OM10029 TLR460 OM6328 OM70L TLR402 TLR461 TLR463 Jasmine85 OM7347 I: AC trung bình đến cao 23-32% II: AC thấp16-22% I.1: AC 23-27% I.2: AC 27-32% NS 3,5-5,5 tấn/ha I.1.1: ns 2,0-5,5 tấn/ha I.1.2: ns 7-8 tấn/ha II.1: AC 19-22% NS 3-6 tấn/ha tấn/ha II.2: AC 16-19% II.2.1: NS 3-5 tấn/ha II.2.2: ns 6,5-7,5 tấn/ha Hình 3.4: Phân nhóm kiểu hình các giống lúa cao sản trong bộ vật liệu lai bằng NTSYSpc 2.0 (Ghi chú: NS: năng suất; AC: hàm lượng amylose) 18 Coefficient 0.07 2.15 4.22 6.30 8.37 B12 B12 B51 B34 B32 B60 B59 B61 B16 B4 B15 B9 B45 B46 B28 B11 B43 B17 B36 B58 B50 B86 B30 B52 B10 B66 B84 B57 B2 B54 B8 B40 B26 B47 B72 B27 B31 B68 B48 B6 B77 B73 B62 B29 B78 B87 B65 B21 B55 B1 B71 B13 B3 B63 B56 B20 B81 B7 B82 B88 B14 B79 B25 B19 B49 B85 B44 B76 B80 B67 B37 B18 B33 B53 B38 B22 B69 B83 B70 B74 B24 B39 B23 B75 B41 B35 B64 B5 B42 II: AC trung bình đến cao 18-31% II.1: AC 18-25% I: AC thấp 3-18% I.1: AC 3-10% I.2: AC 10-18% II.2: AC 25-31% II.1.1 AC 18,0-20,5% II.1.2: AC 20,5-5,0% Hình 3.5: Phân nhóm kiểu hình các giống lúa mùa trong bộ vật liệu lai bằng NTSYSpc 2.0 (Ghi chú: NS: năng suất; AC: hàm lượng amylose) 19 Qua đánh giá các đặc tính nông học, năng suất và thành phần năng suất của các giống lúa cho thấy: giống có thể làm mẹ bao gồm OM5930, OM6073, OM6976 (các giống năng suất cao, thời gian sinh trưởng ngắn), các giống có thể làm bố bao gồm: OM7347, Jasmine 85 (các giống có hàm lượng amylose thấp, năng suất cao, thời gian sinh trưởng ngắn). Đối với bộ lúa mùa, giống KDML105 được lựa chọn vì có nhiều đặc tính phù hợp làm giống bố. 3.1.5. Đa dạng nguồn gen trên các giống lúa bố mẹ Bốn mươi mốt chỉ thị phân tử được sử dụng để đánh giá đa dạng di truyền giữa các giống lúa bố mẹ, bao gồm 1 chỉ thị phân tử đánh dấu gen quy định hàm lượng amylose và 40 chỉ thị liên quan đến các thành phần năng suất và năng suất. Chỉ thị Wx được dùng kiểm tra gen liên quan hàm lượng amylose thấp trên các giống lúa. Với chỉ thị Wx, kết quả khuếch đại PCR cho băng hình ở hai kích thước khác nhau 210 bp và 220 bp (Hình 3.6). Ở kích thước 220 bp, các giống KDML105, Jasmine85 và OM7347 thể hiện băng hình ở vị trí này, đây cũng là kích thước của gen wx. Các giống như IR64, OM5930, OM6073 và OM6976 cho băng hình ở kích thước 210 bp. Các giống này biểu hiện không mang gen wx. Trong số 40 chỉ thị được sử dụng thì chỉ có 4 chỉ thị cho kết quả đa hình giữa các giống (Bảng 3.1, Hình 3.7). Các chỉ thị đa hình này sẽ được dùng để đánh dấu các gen liên quan đến năng suất và thành phần năng suất trên các giống mẹ. Các con lai được chọn trong đề tài Hình 3.6. Sản phẩm PCR của các giống lúa bố mẹ với chỉ thị Wx trên gel agarose 3% Ghi chú: M: Thang chuẩn DNA (1Kb) 20 phải mang gen hàm lượng amylose thấp (gen waxy) đồng thời phải biểu hiện các gen đánh dấu giống với mẹ. Bảng 3.1. Kết quả đánh giá đa hình các chỉ thị phân tử liên kết các gen liên quan đến năng suất và thành phần năng suất trên các giống lúa bố mẹ. STT Chỉ thị NST Trình tự (5’-3’) Đánh giá Kích thước (bp) 1 RM240 2 ccttaatgggtagtgtgcac tgtaaccattccttccatcc Đa hình (CT)21 150- 200 2 RM162 6 gccagcaaaaccagggatccgg caaggtcttgtgcggcttgcgg Đa hình (AC)20 250- 300 3 RM256 8 gacagggagtgattgaaggc gttgatttcgccaagggc Đa hình (CT)21 100- 200 4 RM257 9 cagttccgagcaagagtactc ggatcggacgtggcatatg Đa hình (CT)24 150- 250 3.2. Nội dung 2: Đánh giá hiệu quả di truyền của các tổ hợp 3.2.1. Tạo các quần thể F1 Dựa vào kết quả đánh giá trên bộ vật liệu lai, các giống OM6976, OM5930 và OM6073 được chọn làm giống mẹ (♀, recipient, nhận gen), và các giống Jasmine85, KDML105 và OM7347 được dùng làm bố (♂, donor, cho gen). Thế hệ F1 của các quần thể lai (OM6976/Jasmine85, OM6976/KDML105, OM6976/OM7347, OM5930/Jasmine85, OM5930/KDML105, OM5930/OM7347, OM6073/Jasmine85, OM6073/KDML105 và OM6073/OM7347) được tạo ra (Bảng 3.2 ). Hình 3.7. Kết quả đa hình của các giống bố mẹ với các chỉ thị cho gen liên quan đến các thành phần năng suất và năng suất trên gel agarose 3%. Ghi chú: 1: OM6976; 2: OM6073; 3: OM5930; 4: KDML 105; 5: Jasmine 85; 6: OM7347. M: Thang chuẩn DNA (1Kb) 21 Bảng 3.2. Số lượng các cá thể F1 của các quần thể lai được tạo ra ♀ ♂ OM6976 OM5930 OM6073 Jasmine 85 215 226 177 KDML105 257 126 264 OM7347 186 310 193 Các cá thể F1 của 9 quần thể lai này tiếp tục cho tự thụ, tạo quần thể F2 và được đánh giá hiệu quả di truyền đối với các gen đích. Qua đó, các tổ hợp lai có hiệu quả di truyền cao được chọn lọc để tiếp tục lai hồi giao tạo các thế hệ con lai mới. 3.2.2. Đánh giá hiệu quả chọn lọc tính trạng mục tiêu dựa trên các quần thể lai F2 Dựa trên các thông số di truyền và hiệu quả chọn lọc của các tổ hợp lai ở Bảng 3.3, cho thấy: Tính trạng hàm lượng amylose (%), các tổ hợp có hệ số di truyền cao nhất bao gồm: OM6976/Jasmine85 (89%), OM6976/KDML105 (84%) và OM5930/OM7347 (78%). Các tổ hợp này đồng thời có hiệu quả chọn lọc (GA) cao nhất. Điều này có nghĩa là so với các tổ hợp khác, khả năng cho gen của giống bố và khả năng nhận gen của giống mẹ hay khả năng phối hợp của bố mẹ cho gen mục tiêu là tốt nhất. Cho nên, 3 tổ hợp này được lựa chọn cho tính trạng hàm lượng amylose thấp (≤20%). Về năng suất, dựa trên các thông số di truyền ghi nhận rằng các tổ hợp có hệ số di truyền cao nhất bao gồm: OM5930/OM7347 (0,71), OM6976/Jasmine85 (0,60), OM6976/KDML105 (0,52), OM6073/KDML105 (0,40). Bảng 3.3. Các thông số di truyền và hiệu quả chọn lọc của các tổ hợp lai Tính trạng Tổ hợp Nhỏ nhất Lớn nhất Trung bình SD PSKG PSKH h2BS GA Hàm lượng amylose (%) 1 13,97 25,59 19,44 2,50 5,63 6,32 0,89 3,94 2 15,72 25,27 18,82 2,13 3,88 4,61 0,84 3,18 3 16,20 31,77 22,49 2,99 2,00 8,91 0,22 1,18 4 17,58 28,38 23,06 2,74 0,88 7,62 0,12 0,56 5 17,07 27,38 22,80 2,88 3,02 8,28 0,36 1,85 6 16,34 25,00 20,20 1,82 2,61 3,36 0,78 2,50 7 18,13 26,02 23,52 1,94 1,09 3,80 0,29 0,99 8 17,26 26,10 22,76 2,81 2,81 7,86 0,36 1,76 9 17,32 26,96 23,33 2,11 1,16 3,79 0,31 1,05 Năng suất (tấn/ha) 1 8,27 8,88 8,55 0,15 0,01 0,02 0,60 0,16 2 7,67 8,72 8,16 0,24 0,03 0,06 0,52 0,23 3 6,36 9,32 8,00 0,83 0,25 1,17 0,22 0,41 22 4 5,59 8,40 7,14 0,65 0,16 0,76 0,20 0,31 5 5,25 8,00 6,86 0,87 0,36 1,50 0,24 0,52 6 7,91 8,58 8,22 0,18 0,02 0,03 0,71 0,23 7 5,77 8,34 7,13 0,81 0,30 1,23 0,23 0,47 8 6,28 6,99 6,57 0,18 0,01 0,03 0,40 0,12 9 5,63 7,26 6,57 0,35 0,03 0,17 0,17 0,12 Chú thích: 1: OM6976/Jasmine85; 2: OM6976/KDML105; 3: OM6976/OM7347; 4: OM5930/Jasmine85; 5: OM5930/KDML105; 6: OM5930/OM7347; 7: OM6073/Jasmine85; 8: OM6073/KDML105; 9: OM6073/OM7347 SD: độ lệch chuẩn PSKH: phương sai kiểu hình PSKG: phương sai kiểu gen Như vậy, với mục tiêu lai tạo các giống có hàm lượng amylose thấp đồng thời đạt năng suất cao, 3 tổ hợp được lựa chọn để tiếp tục nghiên cứu là: OM6976/Jasmine 85, OM6976/KDML105 và OM5930/OM7347. 3.3. Nội dung 3: Chọn tạo quần thể lai hồi giao có hàm lượng amylose thấp thông qua MAS 3.3.1. Kết quả lai tạo quần thể hồi giao OM6976/Jasmine85//OM6976. Qua đánh giá kiểu gen tái tổ hợp, có 10 cá thể tổ hợp được cả 4 gen được đánh dấu bởi các chỉ thị RM240, RM162, RM256 và RM257 là BC4F1-22, BC4F1-93, BC4F1-94, BC4F1-95, BC4F1-103, BC4F1-108, BC4F1-110, BC4F1-112, BC4F1-118 và BC4F1-172, chiếm tỷ lệ 12,8%.Các cá thể BC4F1 mang gen dị hợp tử waxy từ bố và đồng hợp tử ở cả 4 chỉ thị phân tử (RM240, RM162, RM256 và RM257) cho các gen đánh dấu trên cá thể mẹ này được cho tự thụ phấn và chọn lọc các dòng con lai triển vọng cho các thí nghiệm tiếp theo. 3.3.2. Kết quả lai tạo quần thể hồi giao OM6976/KDML//OM6976. Tương tự, ở thế hệ BC4F1, 37 cá thể biểu hiện gen waxy dị hợp tử từ 100 cá thể được đánh giá kiểu gen. Trong đó, 2 cá thể (BC4F1-16 và BC4F1-58) mang cả gen waxy dị hợp tử và mang 4 gen được đánh dấu, chiếm tỷ lệ 5,4%. Các cá thể này được lựa chọn cho tự thụ phấn và tiến hành chọn lọc dòng thuần. 3.3.3. Kết quả lai tạo quần thể hồi giao OM5930/OM7347//OM5930. Các cá thể BC4F1 mang gen dị hợp tử waxy từ bố và đồng hợp tử ở cả 4 chỉ thị phân tử (RM240, RM162, RM256 và RM257) cho các gen đánh dấu trên cá thể mẹ này được cho tự thụ phấn và chọn lọc các dòng con lai ưu thế cho các thí nghiệm tiếp theo. 23 3.4. Nội dung 4: Chọn lọc các quần thể hồi giao BC4F2 thông qua lập bản đồ GGT. Để đánh giá mức độ di truyền của quần thể con lai theo mục tiêu mang gen đích đồng thời di truyền theo tính trạng cây mẹ, phân tích GGT được sử dụng để đánh giá di truyền kiểu gen trên quần thể con lai. 27 chỉ thị phân tử định vị trên 12 nhiễm sắc thể của cây lúa có sự đa hình trên bố mẹ đã được sử dụng trong đánh giá này. Trong đó 2 chỉ thị đánh dấu trên mỗi nhiễm sắc thể. Riêng nhiễm sắc thể số 6, 5 chỉ thị được sử dụng bao gồm: RM469 (2,3 cM), Wx (8,2 cM), RM402 (25,6 cM), RM162 (60,1 cM) và RM1031 (122,3 cM). 3.4.1. Chọn lọc các cá thể BC4F2 của quần thể lai hồi giao OM6976/ Jasmine85//OM6976. Kết quả kiểm tra trên toàn bộ 12 nhiễm sắc thể của cây lúa, chỉ có 4 dòng (BC4F2-1, BC4F2-3, BC4F2-20 và BC4F2-25) đạt yêu cầu và được chọn lọc. Các dòng này là các dòng triển vọng được tuyển chọn để tiếp tục phát triển các thế hệ kế tiếp cho đến dòng thuần chủng. 3.4.2. Chọn lọc các cá thể BC4F2 của quần thể lai hồi giao OM6976/KDML105//OM6976 Hình 3.8 Sự đa dạng di truyền các gen từ bố mẹ của quần thể lai hồi giao OM6976/ Jasmine85// OM6976 trên nhiễm sắc thể số 6. Chú thích: màu xanh dương: kiểu gen theo cây bố (Jasmine 85), màu đỏ: kiểu gen theo cây mẹ (OM6976), màu xám: kiểu gen dị hợp tử, khung màu xanh lá cây: đánh dấu các cá thể được lựa chọn, 1-50: các cá thể của quần thể lai hồi giao OM6976/Jasmine85//OM6976 24 Kết quả kiểm tra trên toàn bộ 12 nhiễm sắc thể, duy nhất cá thể BC4F2-44 đạt yêu cầu. Cá thể này được chọn lọc cho việc đánh giá các tính trạng khác ở thế hệ tự thụ tiếp

Các file đính kèm theo tài liệu này:

  • pdftom_tat_luan_an_chon_tao_giong_lua_tinh_trang_ham_luong_amyl.pdf
Tài liệu liên quan