Tóm tắt Luận án Nghiên cứu đa hình hệ gen các dòng tôm sú (Penaeus Monodon) Việt Nam nhằm phục vụ công tác chọn giống tôm

Kỹ thuật GBS và ứng dụng trong chọn giống

GBS (Genotyping By Sequencing: Kỹ thuật xác định kiểu gen bằng phương pháp giải trình tự) là một ứng dụng mới của kỹ thuật NGS (Next Generation Sequencing: công nghệ giải trình tự thế hệ mới) để phát hiện SNP. Những cải tiến không ngừng của các hóa chất giải trình tự và các công cụ phần mềm cho phép các kỹ thuật NGS cung cấp những thông lượng lớn về dữ liệu giải trình tự trong mỗi lần thực hiện, nhờ đó giảm giá thành, khiến cho GBS trở thành giải pháp thay thế có tính cạnh tranh so với các phương pháp phân tích gen khác. NGS cho phép tạo ra các bản đồ SNP mật độ cao được dự đoán sẽ là hướng ứng dụng rộng rãi trong nhiều chương trình chọn giống. Các nhà chọn giống có thể giải trình tự các bộ gen lớn và xây dựng các bản đồ liên kết mật độ cao từ các quần thể chọn giống. Các ứng dụng trong tương lai của GBS đối với việc cải thiện giống cây trồng, vật nuôi có thể cho phép các nhà chọn giống kiểm soát được các chương trình MAS (chọn giống dựa trên CTPT) hay GS (chọn lọc hệ gen) trên phôi mầm hay loài mới mà không cần phát triển các công cụ phân tử trước đó. Khi việc phân tích gen dựa trên việc giải trình tự có thể thực hiện được đối với toàn bộ các lĩnh vực nghiên cứu về hệ gen thì GBS sẽ trở thành nhân tố chính trong di truyền và chọn giống (He et al., 2014).

1.4. Phương pháp PCR đặc hiệu alen cạnh tranh (KASP)

KASP là một dạng biến đổi của kỹ thuật PCR để phân tích hệ gen dựa trên sự kéo dài chuỗi oligo đặc hiệu alen và sự chuyển năng lượng cộng hưởng huỳnh quang để tạo ra tín hiệu (Kumpatla et al., 2012; He et al., 2014). Công nghệ này có nhiều ứng dụng trong phân tích kiểm soát chất lượng hệ gen, lập bản đồ QTL, chọn giống dựa trên CTPT (MAS).

Chương 2. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU

2.1. Vật liệu

* Các mẫu tôm sú sử dụng cho nghiên cứu đa hình AFLP do Viện Nghiên cứu NTTS I cung cấp. Mẫu được thu từ 3 quần đàn tự nhiên khác nhau: Quần đàn Bắc Trung Bộ (kí hiệu: BTB) thu mẫu tại vùng biển tỉnh Nghệ An, Quần đàn Nam Trung Bộ (NTB) thu mẫu tại vùng biển tỉnh Khánh Hòa và Quần đàn Nam Bộ (NB) thu mẫu tại vùng biển tỉnh Bạc Liêu. Mỗi quần đàn thu trên 50 mẫu.

* Các mẫu tôm sú sử dụng cho nghiên cứu sàng lọc SNP do Viện Nghiên cứu NTTS II cung cấp: Vật liệu gốc bao gồm 4 dòng tôm sú bố mẹ có nguồn gốc địa lý khác nhau, trong đó 3 dòng có nguồn gốc tự nhiên là tôm sú Ấn Độ Dương (kí hiệu: A) - Nhập từ Thái Lan (vùng biển Amanda) và từ Myanmar, tôm sú Thái Bình Dương (T) - Nhập từ Singapore, tôm tự nhiên của Việt Nam (thu thập từ Cà Mau, Đà Nẵng, Phú Yên) - gọi chung là tôm nội địa (N) và dòng tôm Gia hóa (G) được cung cấp bởi Công ty Moana Ninh Thuận - Đây là dòng tôm được thương mại hóa dùng làm tôm bố mẹ sản xuất tôm giống phục vụ cho nuôi thương phẩm. Tôm sú thế hệ Go và G1 được tạo ra từ các đàn tôm bố mẹ này bằng cách lai hỗn hợp giữa bốn dòng tôm bố mẹ.

Từ các cá thể trong đàn con của các gia đình tôm sú thế hệ Go¬ và G1, chọn ra các cá thể (bao gồm cả tôm cái - và tôm đực - ) thuộc hai nhóm khác nhau theo tiêu chí mức độ tăng trưởng: tăng trưởng nhanh (F) và tăng trưởng chậm (S) để sử dụng cho nghiên cứu sàng lọc SNP. 40 mẫu tôm sú cái lớn nhanh thế hệ G1 được chọn để thực hiện kỹ thuật KASP.

* Các hóa chất và kit tinh sạch được sử dụng của các hãng: Sigma Aldrich, Qiagen, Invitrogen, Life Technologies, Fermentas, Promega; Các hóa chất thông dụng khác trong phòng thí nghiệm đạt độ tinh khiết cần thiết cho các nghiên cứu.

* Các thiết bị sử dụng trong nghiên cứu thuộc Phòng Vi sinh vật học phân tử và Phòng thí nghiệm trọng điểm Công nghệ gen, Viện Công nghệ sinh học, Viện hàn lâm Khoa học và Công nghệ Việt Nam.

 

doc28 trang | Chia sẻ: trungkhoi17 | Lượt xem: 373 | Lượt tải: 0download
Bạn đang xem trước 20 trang tài liệu Tóm tắt Luận án Nghiên cứu đa hình hệ gen các dòng tôm sú (Penaeus Monodon) Việt Nam nhằm phục vụ công tác chọn giống tôm, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
là Nội địa và Thái Bình Dương, tỷ lệ tôm đực và tôm cái tham gia sinh sản tạo thế hệ Go là tương đương nhau (lần lượt là 17 tôm cái và 14 tôm đực ở dòng N; 13 tôm cái và 13 tôm đực ở dòng T). Sự chênh lệch cũng thể hiện rõ ở tỷ lệ đóng góp tôm mẹ (nhóm Ấn Độ Dương là 34,5% so với nhóm Gia hóa là 10,9%) và tôm bố (nhóm Ấn Độ Dương là 18,9% so với nhóm Gia hóa là 30,2%) giữa bốn nhóm vật liệu ban đầu. Tôm bố mẹ Go được ghép cặp để sản xuất các gia đình G1 cùng cha mẹ (full-sibs family) và các cặp gia đình cùng cha khác mẹ (half-sibs group). Tổng cộng có 246 cá thể tôm thế hệ Go (bao gồm 112 tôm cái và 134 tôm đực) thuộc 69 gia đình Go được sử dụng làm tôm bố mẹ để sản xuất thế hệ G1. Kết quả đã tạo được 76 gia đình thế hệ G1. Số lượng các nhóm gia đình và số lượng cá thể tương ứng được trình bày ở Bảng 3.4. Bảng 3.4. Số lượng các nhóm gia đình tôm sú thế hệ G1 Kiểu gia đình Tôm bố Tôm mẹ Số lượng tôm con Tôm bố x tôm mẹ Số lượng nhóm gia đình cùng cha khác mẹ Số lượng gia đình cùng cha mẹ Tổng Cùng cha khác mẹ 15 50 5.155 1 x 2 6 12 50 1 x 3 3 9 1 x 4 3 12 1 x 5 2 10 1 x 7 1 7 Cùng cha mẹ 26 26 2.257 26 Tổng 7.412 76 Kết quả ở Bảng 3.4 cho thấy: Trong tổng số 76 gia đình của thế hệ G1 có 15 nhóm gia đình cùng cha khác mẹ (bao gồm 50 gia đình, chiếm tỷ lệ 65,8%) và 26 gia đình cùng cha mẹ (không có nhóm cùng cha khác mẹ tương ứng), chiếm tỷ lệ 34,2%. Tổng số cá thể tôm sú thế hệ G1 thu được là 7.412, trong đó có 5.155 cá thể (chiếm tỷ lệ 69,5%) thuộc nhóm gia đình cùng cha khác mẹ và 2.257 cá thể (chiếm tỷ lệ 30,5%) thuộc nhóm gia đình cùng cha mẹ. Tôm sú thế hệ Go, G1 ở các giai đoạn khác nhau (từ ấu trùng đến giai đoạn thành thục) được ương nuôi trong điều kiện kiểm soát nghiêm ngặt về các thông số môi trường sống. Tất cả mẫu của các gia đình lai đều được sàng lọc mầm bệnh và đều cho kết quả âm tính với mầm bệnh virus. Các quần đàn tôm lai thế hệ Go và thế hệ G1 sẽ là nguồn vật liệu được sử dụng cho các nghiên cứu tiếp theo nhằm sàng lọc các chỉ thị phân tử (SNP) liên kết với tính trạng tăng trưởng. Hình 3.2. Phân bố độ dài các contig sau tinh sạch Các contig có kích thước 70 - 150 bp chiếm số lượng nhiều nhất (211.389), ít nhất là các contig có kích thước >450 bp, loại bỏ các contig kích thước ngắn < 70bp. Số lượng contig Phân bố độ dài contig 3.3. Sàng lọc đa hình nucleotide đơn (SNP) liên quan đến tính trạng tăng trưởng ở tôm sú 3.3.1. Giải trình tự, kết nối các đoạn trình tự và thiết lập hệ gen tham chiếu tạm thời Giải trình tự hệ gen tôm sú thuộc hai nhóm tôm tăng trưởng nhanh và tôm tăng trưởng chậm trên hệ thống Illumina NextSeq®500 thu được 145.836.644 đoạn trình tự thô (raw read); trong số đó có 120.438.739 (83%) đoạn trình tự mang barcode và điểm cắt của ApeKI. Sau khi tinh sạch thu được 102.505.713 (70,2%) đoạn trình tự có chất lượng tốt để sử dụng cho việc kết nối contig và thiết lập hệ gen tham chiếu tạm thời, với dung lượng dữ liệu ~100 GB. Từ 102.505.713 đoạn trình tự sau khi kết nối thu được 510.076 contig với sự phân bố kích thước các contig được thể hiện ở Hình 3.2. Các contig có chiều dài 70-150bp chiếm số lượng lớn nhất (211.389), tiếp đến là các contig có chiều dài 150 - 300 bp và ít nhất là các contig có chiều dài 450 - 547 bp. Các contig kích thước ngắn dưới 70 bp bị loại bỏ. Hệ gen tham chiếu tạm thời của tôm sú có kích thước 76.299.742 bp (được thiết lập từ dữ liệu giải trình tự các đoạn DNA có chất lượng tốt nhất), được sử dụng để sàng lọc SNP. Bảng 3.5. Tóm tắt kết quả xử lý dữ liệu giải trình tự GBS Chỉ số phân tích Giá trị Độ sâu giải trình tự 50x Dung lượng dữ liệu (GB) 100 Số lượng đoạn trình tự thô (raw reads) 145.836.644 Số lượng đoạn trình tự (read) sử dụng kết nối contig 102.505.713 Tổng số contig 510.076 Kích thước hệ gen tham chiếu tạm thời (bp) 76.229.742 B C A Hình 3.3. Số lượng SNP ở hai nhóm tôm tăng trưởng nhanh và tăng trưởng chậm A- Số lượng SNP ở nhóm tôm sú lớn nhanh (1799), B- Số lượng SNP ở nhóm tôm sú lớn chậm (587), C- Số lượng SNP ở cả hai nhóm (501). 3.3.2. Sàng lọc SNP Tổng cộng có 2887 SNP đã được phát hiện, trong đó có 1799 SNP chỉ xuất hiện ở nhóm tôm lớn nhanh, 587 SNP chỉ xuất hiện ở nhóm tôm lớn chậm và 501 SNP xuất hiện ở cả hai nhóm (Hình 3.3). Hình 3.4. Kết quả chú giải gen chức năng Có 2377 contig chứa SNP không cho kết quả chú giải, 510 contig chứa SNP cho kết quả chú giải, trong đó: 287 contig chứa SNP ở nhóm tôm sú lớn nhanh, 126 contig chứa SNP ở nhóm tôm sú lớn chậm và 97 contig chứa SNP ở cả hai nhóm. 3.3.3. Chú giải gen chức năng từ dữ liệu giải trình tự tôm sú Từ dữ liệu giải trình tự và dữ liệu sàng lọc SNP, chỉ những đoạn trình tự chứa SNP được sử dụng để chú giải nhằm tìm kiếm sự tương đồng với các trình tự gen chức năng được lưu trữ ở GenBank (NCBI). Toàn bộ 2887 đoạn trình tự chứa SNP ở cả hai nhóm tôm sú Lớn nhanh và Lớn chậm được chú giải. Kết quả có 510 (17,67%) contig chứa SNP có trình tự nucleotide tương đồng với các trình tự trên cơ sở dữ liệu nr-NCBI (với tham số E-value < 1e-6); trong đó có 287 (56,27 %) trình tự contig chứa SNP thuộc nhóm tôm sú Lớn nhanh, 126 (24,71 %) trình tự contig chứa SNP thuộc nhóm tôm sú Lớn chậm và 97 (19,02 %) trình tự contig chứa SNP thuộc cả hai nhóm. Một lượng lớn (85,33%) contig của nghiên cứu này không cho kết quả chú giải gen chức năng (Hình 3.4). Bảng 3.6. Kết quả chú giải các gen liên quan tính trạng tăng trưởng ở tôm sú Contig được chú giải Gen bank ID Protein tương ứng Loài tương ứng Trình tự nucleotide (đối với contig83953 là trình tự bổ sung) Contig83953 (98 bp) gi|343183153|dbj|BAK61429.1| Myosin heavy chain type a Marsupenaeus japonicus CAAGGTCGTCGATCTTCAGCTTCCATTCAGAGATGATCTTATCGAAGTTCTTCTGTTTCTTCTCAGCGGAGTTGGCCAGAGTCTGTGCACGTTCAGCA Cluster260347 (80 bp) gi|410509306|dbj|BAM65719.1| Myosin heavy chain type 1 Penaeus monodon CTCGTCTCGAGGAAGCCGAAATGCAGATTGAGTCTCTCAATGTTAAGAACTTGCATTTGGAGAAGACCAAGATGCGTGCG Từ kết quả BlastX, chúng tôi thu được danh sách chú giải gồm các protein đã biết chức năng hoặc các protein dự đoán cùng với tên loài tương ứng. Với mục tiêu nghiên cứu là tìm kiếm và xác định sự liên quan giữa các gen mã hóa các protein có liên quan đến tăng trưởng ở tôm sú với các SNP đã sàng lọc được, chúng tôi đã đối chiếu lần lượt 22 protein liên quan đến tính trạng tăng trưởng trong họ giáp xác (Jung et al., 2013) với các protein đã chú giải được để rà soát và tìm ra loại protein tương ứng với trình tự contig chứa SNP của hai nhóm tôm sú nghiên cứu. Kết quả đã xác định được hai contig (contig83953 dài 98 bp và contig260347 dài 80 bp) ở nhóm tôm sú tăng trưởng nhanh có trình tự amino acid tương ứng tương đồng với trình tự amino acid của protein Myosin Heavy Chain (MHC). Trong đó, contig83953 tương đồng với MHC type a (MHCa) và contig260347 tương đồng với MHC type 1 (MHC1). Trong nghiên này, chúng tôi không tìm thấy contig nào của nhóm tôm sú Lớn chậm có sự tương đồng với 22 protein liên quan đến tính trạng tăng trưởng trong họ giáp xác đã được công bố bởi nhóm tác giả Jung et al. (2013). Trình tự nucleotide của contig83953 và contig260347 được trình bày ở Bảng 3.6. 3.3.4. Xác định chỉ thị SNP và tương quan giữa các contig chứa SNP với gen MHC Từ các kết quả sàng lọc SNP và kết quả chú giải protein liên quan đến tính trạng tăng trưởng ở tôm sú (chỉ các contig chứa SNP được chọn để chú giải gen chức năng, sau đó so sánh trình tự của contig chứa SNP với trình tự của gen chức năng tương ứng để xác định loại nucleotide thay thế), chúng tôi đã xác định được vị trí SNP trên contig83953 và contig260347 như sau (Bảng 3.6): SNP T àC tại vị trí nucleotide thứ 20 trên mạch bổ sung với contig83953, tức là SNP A àG trên mạch gốc contig83953 và SNP G àA tại vị trí nucleotide thứ 19 trên contig260347. Bảng 3.7. Kết quả xác định SNP trên contig83953 và contig260347 Tên Contig Ký pháp HGVS của SNP tương ứng Nucleotide thay thế Nucleotide tham chiếu Ghi chú Contig83953 Contig83953:g.20T>C C T Trình tự bổ sung G A Trình tự mạch gốc Contig260347 Contig260347:g.19G>A A G Mạch gốc Để xác định tương quan giữa các contig83953 và contig260347 chứa SNP với gen mã hóa protein MHC liên quan đến tăng trưởng ở tôm sú, chúng tôi đã tiến hành dịch mã các trình tự nucleotide của contig83953 và contig260347 thành các chuỗi amino acid tương ứng, sau đó so sánh với trình tự amino acid của gen mã hóa protein MHC. Kết quả dịch mã được trình bày ở Bảng 3.8. Bảng 3.8. Trình tự amino acid tương ứng của contig83953 và contig260347 Tên contig Trình tự amino acid tương ứng ( Tổng số amino acid của chuỗi Contig83953 AERAQTLANSAEKKQKNFDKIISEWKLKIDDL 32 Contig260347 RLEEAEMetQIESLNVKNLHLEKTKMetRA 30 Để kiểm tra sự chính xác của các trình tự amino acid, chúng tôi đã tiến hành Blast (Basic Local Alignment Search Tool) bằng công cụ Uniprot ( với cả hai loại dữ liệu đầu vào là trình tự amino acid và trình tự nucleotide của contig83953 và contig260347. Kết quả thu được từ hai loại dữ liệu đầu vào hoàn toàn trùng khớp nhau về tỷ lệ tương đồng giữa chuỗi amino acid của contig83953 và contig260347 so với protein MHC ở các loài khác nhau (Bảng 3.9 và Bảng 3.10). Kết quả ở Bảng 3.9 cho thấy: trình tự amino acid tương ứng của contig83953 đạt tỷ lệ tương đồng cao nhất (90,6%) với trình tự amino acid của protein MHCa ở loài tôm P. japonicus, tỷ lệ tương đồng với MHC1 ở hai loài tôm khác là P. monodon và L. vannamei cũng tương đối cao (đều đạt 87,5%). Kết quả ở Bảng 3.10 cho thấy: trình tự amino acid tương ứng của contig260347 đạt tỷ lệ tương đồng cao nhất (96,2%) với trình tự amino acid của protein MHC ở cả ba loài tôm P.monodon, P. japonicus và L. vannamei. Bảng 3.9. Các tỷ lệ tương đồng cao nhất giữa contig83953 với protein MHC STT GenBank ID Protein MHC (loài tương ứng) Tỷ lệ tương đồng (%) Vị trí amino acid trên protein MHC 1 F8WR03 Myosin heavy chain type a  (Penaeus japonicus) 90,6% 1431-1462 2 K4Q111 Myosin heavy chain type 1 (Litopenaeus vannamei) 87,5% 1431-1462 3 K4Q4N8 Myosin heavy chain type 1 (Penaeus monodon) 87,5% 1432-1463 4 Q6XGZ8 Slow muscle myosin S1 heavy chain (Homarus americanus) 83,9% 30-60 5 B0W188 Myosin heavy chain  (Culex quinquefasciatus) 80,6% 1399-1429 Bảng 3.10. Các tỷ lệ tương đồng cao nhất giữa contig260347 với protein MHC STT GeneBank ID Protein MHC (loài tương ứng) Tỷ lệ tương đồng (%) Vị trí amino acid trên protein MHC 1 K4Q4N8 Myosin heavy chain type 1 (Penaeus monodon) 96,2 1396-1425 2 F8WR03 Myosin heavy chain type a (Penaeus japonicus) 96,2 1395-1420 3 K4Q111 Myosin heavy chain type 1 (Litopenaeus vannamei) 96,2 1395-1420 4 K4Q2Y1 Myosin heavy chain type 2 (Penaeus monodon) 76,0 1396-1418 5 K4Q2S1 Myosin heavy chain type 2 (Litopenaeus vannamei) 76,0 1396-1418 3.3.5. Xác định vùng tương đồng giữa contig chứa SNP so với gen mã hóa protein MHC, xác định codon chứa SNP và vị trí tương ứng của chỉ thị SNP trên gen MHC Bằng cách so sánh các chuỗi trình tự (nucleotide, amino acid) của contig83953 và contig260347 với trình tự của gen MHCa và MHC1 để xác định vùng tương đồng giữa chúng, chúng tôi đã xác định được vị trí phân vùng chức năng trên gen MHCa và MHC1 phù hợp với trình tự các contig83953 và contig260347 chứa SNP, đồng thời xác định chính xác codon chứa SNP cũng như sự biến đổi của amino acid có thể xảy ra do sự xuất hiện SNP (Hình 3.5, Hình 3.6, Hình 3.7, Hình 3.8). Kết quả ở Hình 3.5 và Hình 3.6 cho thấy: vùng tương đồng về amino acid của contig83953 ở tôm sú P. Monodon trong nghiên cứu này so với protein MHCa ở tôm he Nhật bản P. Japonicus nằm trong khoảng vị trí amino acid 1431 - 1462; vị trí nucleotide tương đồng từ 4408 - 4505. Vùng tương đồng này thuộc phân vùng chức năng LMM (light meromyosin) trên phân tử protein myosin. Kết quả ở Hình 3.7 và Hình 3.8 cho thấy: vùng tương đồng về amino acid của contig260347 ở tôm sú P. monodon trong nghiên cứu này so với protein MHC1 ở tôm sú trên genBank nằm trong khoảng vị trí amino acid 1396 - 1422; vị trí nucleotide tương đồng từ 4302 - 4379. Vùng tương đồng này cũng thuộc phân vùng chức năng LMM (light meromyosin) trên phân tử protein myosin. Các kết quả chỉ ra trên Hình 3.5, Hình 3.6, Hình 3.7, Hình 3.8 cho thấy rõ các codon chứa các SNP. Cụ thể như sau: SNP T à C tại vị trí nucleotide thứ 20 trên mạch bổ sung với contig83953 [Contig83953:g.20T>C], tức là SNP A à G trên mạch gốc contig83953 được xác định là vị trí SNP A4486G trên gen MHCa (Hình 3.5). SNP này là nucleotide thứ 3 trong bộ ba (codon) mã hóa amino acid, làm biến đổi codon AAA thành AAG. Cả hai codon này đều mã hóa amino acid Lysine (K) với vị trí amino acid tương ứng trên protein MHCa là K1456K (Hình 3.6). Nói cách khác, SNP này không làm thay đổi amino acid tương ứng. SNP G à A tại vị trí nucleotide thứ 19 trên contig260347 [Contig260347:g.19G>A] được xác định là vị trí SNP G4320A trên gen MHC1 (Hình 3.7). SNP này là nucleotide thứ 2 trong bộ ba mã hóa amino acid, làm biến đổi codon GGA (mã hóa amino acid Glycine - G) thành GAA (mã hóa amino acid Glutamic - E). Vị trí amino acid tương ứng trên protein MHC1 là G1401E (Hình 3.8). Như vậy, với việc sử dụng hệ gen tham chiếu tạm thời của tôm sú P. monodon được thiết lập de novo để sàng lọc SNP, nghiên cứu của chúng tôi đã xác định được hai SNP ở nhóm tôm sú tăng trưởng nhanh. Hai SNP này nằm trong phân vùng chức năng LMM của gen MHC liên quan đến tính trạng tăng trưởng. Hình 3.5. Vùng tương đồng nucleotide giữa mạch bổ sung của contig83953 của tôm sú P. monodon so với trình tự gen MHCa ở tôm he Nhật Bản P. japonicus (vị trí nucleotide 4408 - 4505) Contig 83953 Contig 83953 Contig 83953 Hình 3.6. Ánh xạ trình tự amin oacid thể hiện vùng tương đồng giữa contig83953 của tôm sú P. monodon với protein MHCa ở tôm he Nhật Bản P. japonicus (vị trí amino acid 1431 - 1462) LMM S2 Contig 83953 Contig 83953 Contig 83953 Hình 3.8. Ánh xạ trình tự acid amin thể hiện vùng tương đồng giữa contig260347 với MHC1 ở tôm sú P. monodon (vị trí acid amin 1396 - 1422) LMM S2 Contig260347 Contig260347 Hình 3.7. Vùng tương đồng nucleotide giữa contig260347 so với trình tự gen MHC1 ở tôm sú P. monodon (vị trí nucleotide 4302 - 4379) Contig260347 Contig260347 3.4. Sàng lọc chỉ thị SNP G>A ở tôm sú tăng trưởng nhanh bằng phương pháp KASP Kết quả kiểm tra trên 40 mẫu tôm sú cái tăng trưởng nhanh thế hệ G1 (Hình 3.9) cho thấy: hầu hết mẫu tôm sú tăng trưởng nhanh (28/40 mẫu) chứa SNP dạng đồng hợp tử A:A (màu xanh dương); chỉ có 2/40 mẫu chứa SNP dạng đồng hợp tử G:G (màu đỏ); còn lại là 10/40 mẫu chứa SNP dạng dị hợp tử G:A (màu xanh lá cây). Kết quả này cho thấy: việc sử dụng các mồi xuôi và mồi ngược được thiết kế đặc hiệu với trình tự DNA chứa SNP G>A, trong đó trình tự mồi xuôi đặc hiệu với alen kiểu dại được gắn HEX-tail (màu đỏ) và trình tự mồi xuôi đặc hiệu với alen đột biến được gắn FAM-tail (màu xanh dương) đã phát hiện thấy đột biến G4320A thuộc gen MHC1 có mặt ở 38 trong số 40 mẫu tôm sú được kiểm tra (chiếm 95%). Trong số 38 cá thể tôm sú mang đột biến G4320A, có 28 cá thể mang kiểu gen đồng hợp tử (tương ứng với 28 tín hiệu huỳnh quang màu xanh dương) và có 10 cá thể mang kiểu gen dị hợp tử (tương ứng với 10 tín hiệu huỳnh quang màu xanh lá cây). Hình 3.9. Kết quả phân tích tín hiệu huỳnh quang trong kỹ thuật KASP sàng lọc chỉ thị SNP G>A thuộc gen MHC1 ở tôm sú tăng trưởng nhanh Các chấm màu xanh dương thể hiện các mẫu tôm sú tăng trưởng nhanh có đồng hợp tử A:A (28/40 mẫu); Các chấm màu đỏ thể hiện các mẫu tôm tăng trưởng nhanh có đồng hợp tử G:G 2/40 mẫu; Các chấm màu xanh lá cây thể hiện các mẫu tôm tăng trưởng nhanh có dị hợp tử G:A 10/40 mẫu. Các chấm màu đen là tín hiệu huỳnh quang bị nhiễu; Các mẫu đối chứng không có tín hiệu huỳnh quang (không xuất hiện trên hình). Chương 4. BÀN LUẬN KẾT QUẢ 4.1. Đa hình AFLP ở các quần đàn tôm sú Kết quả phân tích đa hình AFLP sử dụng cặp mồi chọn lọc MseI-CTT/EcoRI-ACC JOE đối với các mẫu tôm sú thuộc ba quần đàn BTB, NTB và NB với số lượng alen ở các quần đàn là khác nhau, không có sự trùng nhau hoàn toàn về vị trí xuất hiện của các alen đã cho thấy genome của các mẫu tôm sú có cấu trúc khác nhau, tức là có sự đa hình về mặt di truyền giữa các cá thể. Khi so sánh chi tiết vị trí các alen của các mẫu tôm sú giữa các quần đàn với nhau cho thấy: không những các alen ở các mẫu là không trùng nhau hoàn toàn khi so sánh hai mẫu bất kỳ thuộc cùng một quần đàn hay thuộc hai quần đàn khác nhau, mà ở mỗi quần đàn đều có những alen đặc trưng cho quần đàn đó, tức là chỉ xuất hiện ở một hoặc một vài cá thể của một quần đàn mà không thấy có ở các quần đàn khác. Trong đó: Quần đàn BTB có số lượng alen đặc trưng quần đàn nhiều hơn hẳn so với quần đàn NTB và NB. Trong phạm vi từng quần đàn, khi so sánh sự đa hình AFLP giữa các cá thể thuộc cùng một quần đàn cho thấy: trong khi ở quần đàn NTB có 4 alen trùng nhau, ở quần đàn NB có 8 alen trùng nhau thì điểm đặc biệt của quần đàn Bắc Trung Bộ là không có bất kì alen nào trùng nhau. Điều này cho thấy tính đa dạng di truyền rất cao của các cá thể trong quần đàn này. Phân tích sâu hơn chúng tôi nhận thấy, giữa 3 quần đàn này không có alen nào trùng nhau. Từ những nhận định trên đây có thể kết luận: các mẫu tôm sú nghiên cứu thuộc 3 quần đàn khác nhau thể hiện tính đa hình di truyền rõ rệt. Mỗi cá thể đều là khác biệt hay nói cách khác chúng có kiểu gene khác nhau. Sự đa hình này không chỉ thể hiện giữa các cá thể bên trong mỗi quần đàn mà còn là sự đa hình giữa các quần đàn tôm sú thuộc các khu vực phân bố khác nhau về mặt địa lý. Trong số 3 quần đàn tôm sú nghiên cứu, quần đàn BTB thể hiện tính đa hình di truyền (đa hình AFLP) cao nhất và thấp nhất là quần đàn NB. Các nhận định này cũng phù hợp với kết quả nghiên cứu của Nguyễn Thị Thảo et al. (2004) khi nghiên cứu tính đa hình của ba quần đàn tôm sú (gồm 2 quần đàn tôm sú Việt Nam và 1 quần đàn tôm sú nhập ngoại từ Singapore) bằng phương pháp phân tích microsatellite. Kết quả nghiên cứu của nhóm tác giả này cho thấy: ngay trong nội bộ một quần đàn và giữa các quần đàn tôm cũng thể hiện tính đa hình di truyền cao; Ba quần đàn với tổng số 83 cá thể là 83 sự khác biệt với 83 kiểu gene khác nhau, có rất ít hoặc không có alen trùng nhau; Khi phân tích cây phát sinh chủng loại thì 2 quần đàn tôm Việt Nam thuộc cùng một nhánh tách biệt hoàn toàn với nhánh tôm nhập từ Singapore còn lại; Quần đàn tôm sú ở vùng Phú Yên (thuộc vùng Trung Bộ) thể hiện tính đa hình cao hơn so với quần đàn vùng Rạch Gốc (Nam Bộ). Trong nghiên cứu của chúng tôi, dòng tôm Nội địa là tôm tự nhiên của Việt Nam được thu từ các vùng biển Đà Nẵng, Phú Yên (vùng biển Nam Trung Bộ). Kết quả đánh giá đa hình di truyền AFLP trong nghiên cứu này đã cho thấy quần đàn ở vùng này có sự đa hình di truyền khá rõ nét. Nghiên cứu của Nguyễn Thị Thảo et al., (2004) với chỉ thị microsatellite cũng khẳng định điều này. Đây là những dẫn liệu quan trọng bước đầu định hướng cho việc lựa chọn dòng tôm bố mẹ từ các quần đàn bản địa có tính đa hình di truyền để tạo ưu thế lai trong công tác chọn giống tôm sú. Tuy nhiên đây mới chỉ là nhận định bước đầu trong phạm vi kết quả nghiên cứu của đề tài này. Để có thể khẳng định được mức độ đa hình di truyền của các quần đàn tôm sú tự nhiên Việt Nam thì cần phải tiến hành thêm nhiều nghiên cứu trên nhiều quần đàn với số lượng mẫu lớn hơn, đặc biệt cần có các số liệu nghiên cứu về các chỉ số đa dạng di truyền của các quần đàn đó. Một số kết quả nghiên cứu của các nhóm tác giả khác trên các đối tượng tôm sú thuộc các quần đàn địa lý khác nhau trong khu vực Đông Nam Á cũng cho thấy những nhận định tương tự về tính đa dạng di truyền của các quần đàn tôm. Khamnamtong et al. (2009) đã nghiên cứu sự đa hình di truyền và sự khác biệt về địa lý trên đối tượng tôm sú thu ở 3 vùng địa lý khác nhau ở Thái Lan. Kết quả nghiên cứu cho thấy có sự đa hình di truyền cao trên các đối tượng tôm khảo sát, không có sự tương đồng di truyền mà có sự khác biệt rất lớn trong thông tin di truyền của các cá thể. Sự đa dạng di truyền trên tôm cũng được thể hiện trong các nghiên cứu sử dụng kỹ thuật microsatellite (Supungul et al., 2000). Klinbunga et al. (2001) nghiên cứu tính dị hợp về thông tin di truyền trên tôm sú Thái Lan bằng kỹ thuật RAPD và phân tích DNA ty thể bằng kỹ thuật RFLP. Kết quả nghiên cứu của nhóm này cho thấy sự khác biệt về vật chất di truyền giữa các cá thể thu ở 5 vùng địa lý khác nhau. Các cá thể thuộc cùng một khu vực địa lý cũng ít cho thấy sự tương đồng, mỗi cá thể mang một kiểu gene riêng. 4.2. Quan hệ phát sinh chủng loại giữa các quần đàn tôm sú Việt Nam Cây phát sinh chủng loại của các mẫu tôm sú nghiên cứu thuộc 3 quần đàn tự nhiên vùng biển BTB, NTB và NB của Việt Nam phản ánh rõ mối tương quan về mặt di truyền giữa chúng. Nhìn chung, các cá thể thuộc cùng một quần đàn có mức độ tương đồng về mặt di truyền (thể hiện ở các nhánh gần nhau trên cây phân loại) cao hơn so với các cá thể thuộc các quần đàn khác nhau. Hiện tượng một số cá thể thuộc quần đàn này lại xuất hiện trên nhánh phân loại của quần đàn khác có thể được giải thích bởi các nguyên nhân sau: (1) Do sự di cư của các đàn tôm sú trong tự nhiên từ vùng biển này đến vùng biển khác theo các dòng hải lưu để tìm kiếm nguồn thức ăn và môi trường mới thích hợp với giai đoạn sinh trưởng của chúng; (2) Do người nuôi tôm đánh bắt tôm sú bố mẹ từ tự nhiên đem về để sản xuất tôm giống, bán cho người nuôi ở các khu vực khác (Bắc, Trung, Nam), khi nuôi có thể tôm thoát ra ngoài tự nhiên nên có sự pha tạp. Các kết quả này phù hợp với đặc điểm nuôi trồng thủy sản ở Việt Nam cũng như ở các khu vực khác trên thế giới. Tính chất đa hình về mặt di truyền giữa các cá thể trong cùng một quần đàn và giữa các quần đàn, cũng như sự pha tạp cá thể giữa các quần đàn tiếp giáp cũng phù hợp với nhận định của các tác giả khác khi nghiên cứu về đa hình di truyền ở các quần thể tôm tự nhiên. Mặc dù vị trí địa lý của các quần đàn thu mẫu là khác nhau giữa các nghiên cứu nhưng về cơ bản đều cho thấy các quần thể tôm sú ở các vùng phân bố khác nhau có sự khác biệt rõ rệt về mặt di truyền giữa các quần thể địa lý (Pan et al., 2004). Theo đó, tôm giống tự nhiên ở những vùng khác nhau cũng sẽ khác nhau về sức sinh sản, tỷ lệ sinh trưởng, khả năng chống chịu bệnh và nhiều đặc tính khác (Kim Thị Phương Oanh et al., 2010). Mặt khác, tùy thuộc vào phương pháp đánh giá đa hình được sử dụng mà kết quả phân tích và mô hình cây phát sinh chủng loại được thể hiện giữa các nghiên cứu cũng khác nhau, thậm chí trên cùng một đối tượng nghiên cứu hoặc trên các mẫu nghiên cứu được thu thập từ các quần thể khá tương đồng về mặt địa lý. Trong nghiên cứu của Nguyễn Thị Thảo et al. (2004), phương pháp phân tích microsatellite được sử dụng để đánh giá đa hình ở ba quần đàn tôm sú tự nhiên cũng đã cho thấy có rất ít hoặc không có alen trùng nhau. Tuy nhiên mô hình cây phát sinh chủng loại biểu thị 2 quần đàn tôm sú Việt Nam (thu thập tại các vùng biển Phú Yên (thuộc vùng Trung Bộ) và vùng Rạch Gốc (Nam Bộ) thuộc cùng một nhánh tách biệt hoàn toàn với nhánh tôm nhập từ Singapore còn lại. Trong nghiên cứu này, cây phát sinh chủng loại được xây dựng bằng các công cụ phần mềm tương thích với dữ liệu đầu vào về phân tích AFLP. Về cơ bản, cây phát sinh chủng loại ở Hình 3.3 thể hiện được nội dung kết quả nghiên cứu, phản ánh mức độ gần gũi về mặt di truyền giữa các mẫu tôm sú được thu từ cùng một quần đàn cũng như sự pha tạp giữa các quần đàn. 4.3. Tạo vật liệu tôm sú thế hệ G0, G1 Kết quả sàng lọc nguồn tôm bố mẹ đầu vào đối với 4 dòng tôm sú Ấn Độ Dương (A), Thái Bình Dương (T), Nội địa (N) và Gia hóa (G) theo tiêu chí sạch bệnh cho thấy: tỷ lệ sạch bệnh cao nhất là tôm G (100%). Kết quả này là phù hợp vì thực tế dòng tôm G là tôm chọn giống được thương mại hóa dùng làm tôm bố mẹ sản xuất tôm giống phục vụ cho nuôi thương phẩm. Dòng tôm này được nuôi trong điều kiện đảm bảo an toàn sinh học một cách nghiêm ngặt. Các dòng tôm tự nhiên nhập ngoại (A, T) cũng có tỷ lệ sạch bệnh khá cao. Riêng dòng tôm tự nhiên trong nước (N) có tỷ lệ giữ lại sau sàng lọc bệnh thấp nhất. Sau khi hoàn thiện việc ghép cặp cho lai hỗn hợp bốn dòng tôm sú có nguồn gốc địa lý khác nhau đã tạo ra được các gia đình, bước đầu tạo được nguồn vật liệu đa dạng về mặt di truyền cho các nghiên cứu tiếp theo về sàng lọc chỉ thị phân tử SNP. Kết quả ghép phối hỗn hợp 4 dòng tôm sú có nguồn gốc địa lý khác nhau với 16 phép lai để tạo ra các gia đình cho thấy: tôm mẹ thuộc các dòng khác nhau sau khi được cấy tinh và thả nuôi để chuẩn bị cho sinh sản tạo thế hệ Go đã có sự khác nhau rõ rệt về khả năng sống. Nói cách khác, các phép lai có sự khác nhau về nguồn gốc tôm mẹ và tôm bố sẽ dẫn đến sự khác nhau về số lượng gia đình được thả nuôi thành công. Điều này có thể được lý giải do sự khác nhau về sức sống của tôm mẹ thuộc các dòng khác nhau. Chẳng hạn: tôm mẹ N là dòng tôm sú có nguồn gốc bản địa trong nước nên có thể chúng thích nghi tốt hơn với điề

Các file đính kèm theo tài liệu này:

  • doctom_tat_luan_an_nghien_cuu_da_hinh_he_gen_cac_dong_tom_su_pe.doc
Tài liệu liên quan