Tóm tắt Luận án Nghiên cứu một số dạng bất thường nhiễm sắc thể y ở nam giới khám vô sinh tại bệnh viện phụ sản thành phố Cần Thơ

Đại cương về vô sinh và quá trình sinh tinh

2.1.1. Một số khái niệm về vô sinh và vô sinh nam

Khoảng 80-85% các cặp vợ chồng có thai tự nhiên sau một năm

chung sống, nhưng cũng có 15-20% cặp vợ chồng gặp vấn đề về khả năng

sinh sản hay còn gọi là vô sinh (Ayensu-Coker et al., 2007; Jungwirth et

al., 2012).

Một cặp vợ chồng hay một đôi nam nữ được gọi là vô sinh khi họ

giao hợp thường xuyên và không sử dụng biện pháp tránh thai nào sau 12

tháng mà vẫn không có con (WHO, 2000).

Vô sinh nam là tình trạng các cặp vợ chồng hoặc cặp nam nữ không

có thai sau một năm sinh hoạt tình dục bình thường và không dùng biện

pháp tránh thai nào do nguyên nhân từ nam giới (Jungwirth et al., 2012).

2.1.2. Đại cương về quá trình sinh tinh

Các tế bào mầm sinh dục nguyên thủy tham gia vào quá trình sinh

tinh trải qua 3 giai đoạn là phân bào nguyên phân, giảm phân và biệt hóa

để tạo thành tinh trùng trưởng thành (Oliveira và Alves, 2015). Nam giới4

có khả năng sinh sản bình thường mỗi ngày tạo ra > 40x106 tinh trùng

(Cheng và Mruk, 2013).

Quá trình sinh tinh được điều hòa bởi 3 hormon chính là FSH

(FSH - Follicle-stimulating hormon), LH (LH - Luteinizing hormon) và

testosteron (Verhoeven et al., 2010; Rato et al., 2012). Bên cạnh đó, quá

trình này còn được điều hòa bởi một số yếu tố khác như nhiệt độ, các dạng

oxi hoạt động ROS (ROS - Reactive oxygen species) và hàng rào chống

oxi hóa tại tinh hoàn (Oliveira và Alves, 2015).

Xét nghiệm nồng độ hormon FSH, LH và testosteron là những xét

nghiệm cần thiết và quan trọng giúp tìm ra được nguyên nhân và cách điều

trị cho nam giới vô sinh do nội tiết (Hotaling và Walsh, 2009).

pdf28 trang | Chia sẻ: trungkhoi17 | Lượt xem: 355 | Lượt tải: 0download
Bạn đang xem trước 20 trang tài liệu Tóm tắt Luận án Nghiên cứu một số dạng bất thường nhiễm sắc thể y ở nam giới khám vô sinh tại bệnh viện phụ sản thành phố Cần Thơ, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
ai tại chỗ huỳnh quang (FISH), PCR đa mồi, Realtime PCR, khuếch đại các đầu dò phụ thuộc ghép nối (MLPA) và QF-PCR. 2.5. Tình hình nghiên cứu một số nguyên nhân vô sinh ở nam giới 2.5.1. Trên thế giới Nhiều nghiên cứu cho thấy hội chứng Klinefelter và mất đoạn AZF là 2 nguyên nhân di truyền thường gặp ở nam giới khám vô sinh có số lượng < 5x106 tinh trùng/mL tinh dịch (Cavkaytar et al., 2012; Choi et al., 2013; Zhang et al., 2013b). Tỷ lệ mất đoạn AZF từ 4-38% (Mafra et al., 2011; Cavkaytar et al., 2012; Fu et al., 2012; Choi et al., 2013; Ambulkar et al., 2013; Nasasse et al., 2015). 2.5.2. Ở Việt Nam Tỷ lệ mất đoạn AZF từ 5-12,8%; trong đó mất đoạn AZFc lưu hành phổ biến nhất (Nguyễn Minh Hà, 2011; Nguyễn Thị Việt Hà, 2012; Nguyễn Đức Nhự, 2015). 7 Chương 3 PHƯƠNG PHÁP NGHIÊN CỨU 3.1. Sơ đồ nghiên cứu tổng quát Sơ đồ 3.1. Sơ đồ nghiên cứu tổng quát 3.2. Đối tượng nghiên cứu Nam giới khám vô sinh tại Khoa Hiếm muộn Bệnh viện Phụ sản thành phố Cần Thơ có ≤ 5x106 tinh trùng/mL tinh dịch theo tiêu chuẩn WHO (2010). Tiêu chuẩn loại trừ: bệnh nhân không thể lấy tinh dịch bằng cách thủ dâm và không đồng ý tham gia nghiên cứu. Bên cạnh đó, cũng loại trừ 8 những nam giới thắt, cắt ống dẫn tinh, lấy mẫu tại nhà, làm rơi vãi tinh dịch trong khi lấy mẫu. 3.3. Cỡ mẫu - Áp dụng công thức tính cỡ mẫu ước lượng cho một tỷ lệ 2 2 2/1 )1.( . d pp Zn    Trong đó: n: cỡ mẫu tối thiểu cần thiết. Z1-/2 = 1,96 với hệ số tin cậy mong muốn là 95%. p: tỷ lệ nam giới có ≤ 5x106 tinh trùng/mL tinh dịch bị mất đoạn AZF trên nhiễm sắc thể Y. Dựa trên nghiên cứu của Nguyễn Minh Hà (2011) với p = 12,8%, luận án chọn p = 0,128. d: sai số cho phép, chọn d = 0,037. Thay vào công thức tính được n = 313. Như vậy, cỡ mẫu nghiên cứu tối thiểu là 313 nam giới khám vô sinh có ≤ 5x106 tinh trùng/mL tinh dịch. Trong thực tế, luận án đã nghiên cứu trên 322 trường hợp. 3.4. Phương pháp chọn mẫu Chọn mẫu thuận tiện không xác xuất. 3.5. Thời gian và địa điểm 3.5.1. Thời gian nghiên cứu Từ tháng 11/2014 đến tháng 3/2017. 3.5.2. Địa điểm nghiên cứu - Thu nhận mẫu tinh dịch đồ và thực hiện xét nghiệm tinh dịch đồ tại Khoa Hiếm muộn, Bệnh viện Phụ sản thành phố Cần Thơ. - Xét nghiệm nồng độ hormon FSH, LH, testosteron, ly trích ADN, kỹ thuật QF-PCR và giải trình tự được thực hiện tại Khoa xét nghiệm - Di truyền học, Bệnh viện Phụ sản thành phố Cần Thơ. - Gửi 1 mẫu máu, 3 mẫu ADN đến phòng xét nghiệm kỹ thuật cao ISOLABO tại địa chỉ 101/26 Nguyễn Chí Thanh, Phường 9, Quận 5, thành phố Hồ Chí Minh để kiểm định kết quả QF-PCR. 3.6. Thiết bị, dụng cụ và hóa chất - Nghiên cứu sử dụng các hóa chất và trang thiết bị để xét nghiệm tinh dịch đồ, nội tiết tố, di truyền (kỹ thuật QF-PCR) và giải trình tự. -14 đoạn mồi (mồi ngược) và mồi đánh dấu huỳnh quang (mồi xuôi) của các chỉ dấu di truyền được trình bày ở Bảng 3.1A. 9 Bảng 3.1A. Các chỉ dấu di truyền dùng phát hiện một số dạng bất thường nhiễm sắc thể Y Chỉ dấu di truyền Vị trí nhiễm sắc thể Trình tự mồi (5’-3’) Màu huỳnh quang Kích thước sản phẩm PCR tham khảo (bp) Nguồn tham khảo sY84-F AZFa F: AGAAGGGTCCTGAAAGCAGGT NED 326 Krausz et al. sY84-R R: GCCTACTACCTGGAGGCTTC (2014) sY86-F AZFa F: GTGACACACAGACTATGCTTC VIC 318 Krausz et al. sY86-R R: ACACACAGAGGGACAACCCT (2014) sY127-F AZFb F: GCACCCACTGGAATCTACC FAM 195 Fu et al. sY127-R R: CATGGCTACACAGACAGGGA (2012) sY134-F AZFb F: GTCTGCCTCACCATAAAACG NED 301 Krausz et al. sY134-R R: ACCACTGCCAAAACTTTCAA (2014) sY254-F AZFc F: GGGTGTTACCAGAAGGCAAA FAM 380 Krausz et al. sY254-R R: GAACCGTATCTACCAAAGCAGC (2014) sY255-F AZFc F: GTTACAGGATTCGGCGTGAT FAM 123 Krausz et al. sY255-R R: CTCGTCATGTGCAGCCAC (2014) sY1191-F AZFc F: CCAGACGTTCTACCCTTTCG VIC 385 Krausz et al. sY1191-R R: GAGCCGAGATCCAGTTACCA (2014) sY1192-F AZFc F: ACTACCATTTCTGGAAGCCGG NED 255 Krausz et al. sY1192-R R: CTCCCTTGGTTCATGCCATT (2014) sY1291-F AZFc F: TAAAAGGCAGAACTGCCAGG VIC 527 sY1291-R R: GGGAGAAAAGTTCTGCAACGT SRY-F Yp11.2- p22.1 F: GAATATTCCCGCTCTCCGGA FAM 472 Fu et al. SRY-R R: GCTGGTGCTCCATTCTTGAG (2012) CDY-F AZFc F: GTTTCTTCCACTGTAGAAATTCACCTCC VIC 200 194 Plaseska et al. CDY-R AZFb R: GAAGTTTGCATAGTGGACAGC (2011) AMEL-F AMEL-R Xp22.1-p22.31 Yp11.2 - p22.1 F: CCCTGGGCTCTGTAAAGAATAGTG R: ATCAGAGCTTAAACTGGGAAGCTG FAM 106 112 Xie và Liang et al. (2014) TAF9B-F TAF9B-R X NST 3 F: TTTGACAGGTAGTTTTGGGTCA R: TGGTTTTGCCTAGGTCCAGT FAM 144 140 Plaseska et al. (2011) DAZ-F DAZ-R AZFc NST 3 F: TTAAGTACTACTGTAGACACC R: GTTTCTTGTATAATGTAGAAGAGTAGAGC FAM 214 217 Alimardanian et al. (2016) 10 - Chứng âm (nước cất, nữ bình thường) và chứng dương (nam giới bị mất đoạn AZFc, hội chứng Klinefelter do Bộ môn Y Sinh học – Di truyền, Học viện Quân Y và Đại học Y Hà Nội cung cấp, được xác định bằng kỹ thuật multiplex-PCR (AZF) và nuôi cấy bạch cầu lympho máu ngoại vi (hội chứng Klinefelter)). + Cặp mồi thường sY1291 đặt công ty Macrogen, Hàn Quốc sản xuất và cặp mồi thường LAPT đặt công ty Macrogen, Hàn Quốc và công ty TNHH Phù Sa, Cần Thơ, Việt Nam sản xuất (Bảng 3.1B). Bảng 3.1B. Một số đặc điểm của 2 chỉ dấu di truyền sY1291 và LAPT Chỉ dấu di truyền Trình tự mồi (5’-3’) Kích thước sản phẩm PCR tham khảo (NCBI, GRCh38.p7) (bp) sY1291 F: TAAAAGGCAGAACTGCCAGG R: GGGAGAAAAGTTCTGCAACGT 527 LAPT F: CAGAACTGCCAGGTCTGTGTCTTAT R: ACCATCCCGGCTAAAAACGGTG 288 3.3. Phương pháp nghiên cứu 3.3.1. Xây dựng và kiểm định quy trình kỹ thuật QF-PCR để phát hiện một số dạng bất thường nhiễm sắc thể Y ở nam giới khám vô sinh có ≤ 5x106 tinh trùng /mL tinh dịch 3.3.1.1. Ly trích ADN 3.3.1.2. Xây dựng quy trình kỹ thuật QF-PCR Luận án khảo sát các điều kiện thực hiện phản ứng QF-PCR và điện di mao quản để xây dựng và tối ưu hóa quy trình kỹ thuật QF-PCR. a. Khảo sát các điều kiện thực hiện phản ứng QF-PCR Xác định nhiệt độ gắn mồi của từng chỉ dấu di truyền dựa vào trang web của NEB calculator Tm tại https://tmcalculator.neb.com/#!/. Sắp xếp nhóm các chỉ dấu di truyền dựa vào nhiệt độ gắn mồi và tối ưu dựa vào điều kiện thực nghiệm. Thử nghiệm phản ứng QF-PCR ở nồng độ cuối cùng của mồi là 5 pmol và 10 pmol; multiplex PCR mastermix là 1X và 2X ở thể tích phản ứng là 25 µl và 50 µl. Xác định điều kiện tối ưu của các nhóm chỉ dấu di truyền trong phản ứng QF-PCR. b. Khảo sát các điều kiện điện di mao quản sản phẩm PCR huỳnh quang Thực hiện pha HiDi-Formamide (HiDi) và thang chuẩn ở 2 thể tích là 200 µl HiDi + 4 µl thang chuẩn và 120 µl HiDi + 4 µl thang chuẩn. 11 Pha loãng 40 lần, 60 lần và 100 lần sản phẩm PCR huỳnh quang với nước cất khử ion 2 lần (Bảng 3.2). Bảng 3.2. Thể tích pha loãng sản phẩm PCR huỳnh quang Thể tích dung dịch cuối cùng điện di mao quản Thể tích pha loãng Sản phẩm PCR huỳnh quang Nước cất khử ion 2 lần 0,5 µl 0,5 µl 20 µl 0,5 µl 0,5 µl 30 µl 0,5 µl 0,5 µl 50 µl Thử điều kiện điện di mao quản theo chương trình của Devyser và Elucigen đã được cài đặt trên máy phân tích di truyền ABI 3500. Chọn điều kiện điện di mao quản dựa vào kết quả QF-PCR. c. Kết quả QF-PCR Phân tích bằng phần mềm Genemarker V2.6.3 và ghi nhận kết quả xuất hiện peak sản phẩm PCR huỳnh quang được đánh dấu bằng màu FAM (xanh da trời), VIC (xanh lá cây) và NED (đen). 3.3.1.2. Kiểm định quy trình kỹ thuật QF-PCR Để đánh giá độ chính xác và tin cậy của quy trình kỹ thuật đã xây dựng và tối ưu, kết quả QF-PCR được kiểm định bằng những cách sau đây: - So sánh với NCBI (Phiên bản GRCh38.p7) và một số nghiên cứu trên thế giới. - So sánh với mẫu chứng dương do Bộ môn Y Sinh học Di truyền của Đại học Y Hà Nội và Học viện Quân Y cung cấp. - Gửi mẫu máu và ADN của đối tượng nghiên cứu đi kiểm chứng. - Giải trình tự để khẳng định sự tương đồng trình tự nucleotid ở mẫu thể hiện sự đa hình về chiều dài sản phẩm PCR huỳnh quang. 3.3.2. Xác định tỷ lệ một số dạng bất thường nhiễm sắc thể Y ở nam giới khám vô sinh có ≤ 5x106 tinh trùng /mL tinh dịch bằng quy trình kỹ thuật QF-PCR đã được xây dựng và kiểm định Áp dụng quy trình kỹ thuật QF-PCR đã kiểm định vào xác định một số dạng bất thường nhiễm sắc thể Y. Nam giới khám vô sinh không có bất thường nhiễm sắc thể Y (bình thường) xuất hiện các peak như sau: AMELX/AMELY là 1:1 (103-106 bp), DAZ/DAZL là 4:2 (210-214 bp), TAF9B3/TAF9BX là 2:1 (144-148 bp), CDY2/CDY1 là 2:2 (198-204 bp), SRY ( 465 bp), sY84 (328 bp), sY86 (316 bp), sY127 (192 bp), sY134 (302 bp), sY254 (380 bp), sY255 (122 bp), sY1191 (385 bp) và sY1192 (255 bp). Peak của sY1291 có thể xuất 12 hiện tại một trong các vị trí sau: 507 bp hoặc 512 bp hoặc 523 bp hoặc 527 bp. + Mất một phần đoạn AZFb kiểu mất 2 gen CDY2 xuất peak CDY2/CDY1 là 0:2; các peak còn lại đều xuất hiện như ở nam giới bình thường. + Mất một phần đoạn AZFc kiểu gr/gr: xuất hiện peak DAZ/DAZL là 2:2 (DAZ bị giảm ½); CDY2/CDY1 là 2:1 (mất 1 CDY1), không có peak của sản phẩm PCR huỳnh quang sY1291 và các peak còn lại giống như nam giới bình thường. + Mất một phần đoạn AZFc kiểu b2/b3: xuất hiện peak DAZ/DAZL là 2:2 (DAZ bị giảm ½); CDY2/CDY1 là 2:1 (mất 1 CDY1), không có peak của sản phẩm PCR huỳnh quang sY1191 và sY1192; và các peak khác giống ở nam giới bình thường. + Mất một phần đoạn AZFc kiểu mất 2 gen DAZ: xuất hiện peak DAZ/DAZL là 2:2; các peak khác giống như ở nam giới bình thường. + Mất một phần đoạn AZFc kiểu mất 1 gen CDY1: xuất hiện peak CDY2/CDY1 là 2:1; các peak còn lại giống ở nam giới bình thường. + Mất một phần đoạn AZFc kiểu mất 2 gen DAZ và 1 gen CDY1: peak DAZ/DAZL là 2:2 và CDY2/CDY1 là 2:1; các peak còn lại đều xuất hiện như ở nam giới bình thường. + Mất một phần đoạn AZFc kiểu mất sY1191-sY1192: không có peak của 2 chỉ dấu di truyền sY1191 và sY1192; các peak khác đều xuất hiện như ở nam giới không có bất thường nhiễm sắc thể Y. + Mất một phần đoạn AZFc kiểu mất sY1291: xuất hiện các peak giống nam giới bình thường, ngoại trừ sY1291 không xuất hiện peak tại bất kỳ vị trí nào 507 bp, 512 bp, 523 bp, 527 bp. + Mất hoàn toàn đoạn AZFc (b2/b4): không có peak của sY254, sY255, sY1191, sY1192 và sY1291; peak CDY2/CDY 1là 2:0 và DAZ/DAZL là 0:2; các peak khác đều xuất hiện như ở nam giới bình thường. + Mất hoàn toàn đoạn AZFbc: kết quả QF-PCR không có peak của sY127, sY134, sY254, sY255, sY1191, sY1192, sY1291, CDY2/CDY1, DAZ; các peak còn lại và DAZL đều xuất hiện như ở nam giới không có bất thường nhiễm sắc thể Y. + Nhân đoạn gen DAZ: xuất hiện peak DAZ/DAZL là 6:2 hoặc 8:2, các peak còn lại đều giống nam giới bình thường.. + Hội chứng Klinefelter với nhiễm sắc thể Y bị mất một phần đoạn AZFc kiểu gr/gr: là nam giới tăng 1 nhiễm sắc thể X (tỷ lệ peak 13 AMELX/AMELY là 2:1 và TAF9B3/TAF9BX là 2:2) và các peak khác giống ở nam giới mất một phần đoạn AZFc kiểu gr/gr. + Hội chứng Klinefelter với nhân đoạn gen DAZ: là nam giới tăng 1 nhiễm sắc thể X và có peak DAZ/DAZL là 6:2 hoặc 8:2 và các peak khác giống nam giới bình thường. + Hội chứng Klinefelter với mất 2 gen DAZ: là nam giới tăng 1 nhiễm sắc thể X và peak DAZ/DAZL là 2:2 và các peak khác giống nam giới bình thường. 3.3.3. Mô tả đặc điểm tinh dịch đồ, nội tiết tố và một số yếu tố liên quan đến bất thường nhiễm sắc thể Y ở nam giới khám vô sinh có ≤ 5x106 tinh trùng /mL tinh dịch - Tư vấn và hướng dẫn bệnh nhân lấy mẫu tinh dịch. - Đánh giá các thông số tinh dịch đồ theo WHO (2010). - Phỏng vấn bệnh nhân theo phiếu điều tra. - Thăm khám lâm sàng: đo chiều cao, cân nặng, khám và ghi nhận các bất thường ở bìu. - Xét nghiệm nội tiết trục tuyến yên-tinh hoàn. - Phân tích kết quả. Chương 4 KẾT QUẢ VÀ BÀN LUẬN 4.1. Xây dựng và kiểm định quy trình kỹ thuật QF-PCR để phát hiện một số dạng bất thường phân tử nhiễm sắc thể Y ở nam giới khám vô sinh có ≤ 5x106 tinh trùng/mL tinh dịch 4.1.1. Xây dựng quy trình kỹ thuật QF-PCR 4.1.1.1. Khảo sát các điều kiện thực hiện phản ứng QF-PCR Qua thực nghiệm, luận án đã tối ưu nhiệt độ gắn mồi trong phản ứng QF-PCR và chia làm 3 set. Set 1 gồm có 4 chỉ dấu di truyền (sY254, sY255, sY1191, sY1192), set 2 gồm có 5 chỉ dấu di truyền (AMEL, CDY, DAZ, TAF9B, SRY) với nhiệt độ gắn mồi là 560C. Set 3 gồm có 5 chỉ dấu di truyền (sY84, sY86, sY127, sY1291, sY134) với nhiệt độ gắn mồi là 580C. Bên cạnh nhiệt độ gắn mồi, nồng độ cuối cùng và thể tích phản ứng QF-PCR cũng đã được tối ưu tương ứng là 5 pmol và 25 µl. Ngoài ra, multiplex PCR 5X mastermix cũng đã được tối ưu trong phản ứng QF- PCR với nồng độ cuối cùng là 1X. Chu trình nhiệt phản ứng QF-PCR set 1 và set 2 như sau: 940C - 2 phút, {[940C - 30 giây, 560C - 1 phút, 680C - 1 phút 30 giây], 30 chu kỳ}, 680C - 10 phút, 40C - ∞ 14 Chu trình nhiệt phản ứng QF-PCR set 3 thực hiện tương tự set 1 và set 2, chỉ khác nhiệt độ gắn mồi là 580C. Quy trình thực hiện phản ứng QF-PCR phụ thuộc vào nhiều yếu tố. Qua so sánh với các nghiên cứu cho thấy, sự khác biệt về điều kiện, nhiệt độ gắn mồi và chu trình nhiệt của phản ứng QF-PCR có lẽ là do loại hóa chất sử dụng và điều kiện thực nghiệm khác nhau. 4.1.1.2. Khảo sát các điều kiện điện di mao quản sản phẩm PCR huỳnh quang Luận án sử dụng quy trình điện di mao quản: trộn 3 set phản ứng QF-PCR lại vào chung 1 tube. Mỗi tube chứa 8 µL Hidi-thang chuẩn/1 tube + 0,5 µL sản phẩm PCR huỳnh quang pha loãng 100 lần và đặt vào máy phân tích di truyền ABI 3500 ở điều kiện điện di theo chương trình của Devyser hoặc Elucigen. Phân tích kết quả bằng phần mềm Genemarker V2.6.3. 4.1.1.3. Kết quả QF-PCR Với quy trình QF-PCR đã tối ưu, kết quả nghiên cứu ghi nhận sản phẩm PCR huỳnh quang khuếch đại bằng các chỉ dấu di truyền được thể hiện bằng các peak trên 3 nhóm màu đánh dấu huỳnh quang là màu FAM, VIC và NED. Nhóm chỉ dấu di truyền sử dụng màu FAM gồm có AMEL, sY255, TAF9B (ký hiệu là T3), sY127, DAZ, sY254 và SRY xuất hiện peak có màu xanh da trời (Hình 4.1). Hình 4.1. Kết quả QF-PCR nhóm chỉ dấu di truyền màu FAM. Với quy trình đã tối ưu, nam giới không có bất thường nhiễm sắc thể Y xuất hiện peak ở kết quả QF-PCR tại các vị trí sau: AMELX/AMELY tại 103 bp (nhiễm sắc thể X) và 109 bp (nhiễm sắc thể Y) theo tỷ lệ 1:1; sY255 tại 122 bp; TAF9B3/TAF9BX tại 144 bp (nhiễm sắc thể 3) và 148 bp (nhiễm sắc thể X) theo tỷ lệ 2:1; sY127 tại 192 bp; DAZ/DAZL tại 210 bp (nhiễm sắc thể Y) và 214 bp (nhiễm sắc thể 3) theo tỷ lệ 4:2; sY254 tại 380 bp và SRY tại 465 bp (Hình 4.1) . Nhóm chỉ dấu di truyền sử dụng màu VIC gồm có CDY, sY86, sY1191 và sY1291 xuất hiện peak màu xanh lá cây (Hình 4.2). 15 Hình 4.2. Kết quả QF-PCR nhóm chỉ dấu di truyền màu VIC với peak của sY1291 có kích thước 507 bp. Nam giới không có bất thường nhiễm sắc thể Y kết quả QF-PCR xuất hiện peak của CDY tại vị trí 198 bp (AZFb) và 204 bp (AZFc) theo tỷ lệ 2:2; sY86 tại vị trí 316 bp; sY1191 tại vị trí 385 bp (Hình 4.2). Riêng peak của sY1291 có thể xuất hiện 1 trong 4 vị trí sau: 507 bp, 512 bp, 523 bp và 527 bp (Hình 4.3). Điều này cho thấy có sự đa hình về chiều dài sản phẩm PCR huỳnh quang của đoạn gen này. Sự đa hình về chiều dài của đoạn gen này phù hợp với nghiên cứu của Lin et al. (2006) và Evguenia et al. (2016). Để khẳng định sự đa hình về chiều dài, luận án sử dụng kỹ thuật giải trình tự và được trình bày chi tiết ở mục 4.1.2. Hình 4.3. Sự đa hình về chiều dài sản phẩm PCR huỳnh quang khuếch đại bằng cặp mồi của chỉ dấu di truyền sY1291. Kết quả QF-PCR của nhóm chỉ dấu di truyền sử dụng màu NED (sY1192, sY134 và sY84), sản phẩm PCR huỳnh quang được thể hiện bằng các peak màu đen (Hình 4.4). 16 Hình 4.4. Kết quả QF-PCR nhóm chỉ dấu di truyền sử dụng màu NED. Nam giới không có bất thường nhiễm sắc thể Y kết quả QF-PCR của nhóm màu này xuất hiện peak của sY1192 tại vị trí 255 bp; sY134 tại vị trí 302 bp; sY84 tại vị trí 328 bp. Bên cạnh những peak chính, ở trên Hình 4.1, 4.2 và 4.4 còn có những peak phụ khác. Những peak phụ này có thể là sản phẩm PCR huỳnh quang không đặc hiệu của các đoạn gen khác. Nguyên nhân là do một số cặp mồi của các chỉ dấu di truyền có thể khuếch đại những sản phẩm với kích thước > 600 bp nhưng không đặc hiệu nên kích thước xuất hiện là những sản phẩm phụ ngắn hơn (NCBI, phiên bản GRCh38.p7). 4.1.2. Kiểm định quy trình kỹ thuật QF-PCR 4.1.2.1. So sánh kết quả nghiên cứu với dữ liệu trên NCBI (Phiên bản GRCh38.p7) và một số nghiên cứu trên thế giới Kết quả QF-PCR ghi nhận kích thước sản phẩm PCR huỳnh quang có thể chia làm 3 nhóm là bằng, ngắn hơn hoặc dài hơn kích thước sản phẩm PCR tham khảo (kích thước đoạn gen được công bố trên NCBI (Phiên bản GRCh38.p7). Nhóm 1 có kích thước sản phẩm PCR huỳnh quang bằng kích thước sản phẩm PCR tham khảo gồm có sY84, sY254, sY1191 và sY1192. Nhóm 2 có kích thước sản phẩm PCR huỳnh quang ngắn hơn khoảng 2-5 bp so với kích thước PCR tham khảo (SRY, sY86, sY127, sY255, CDY2/CDY1, AMELX/AMELY, TAF9B3/TAF9BX và DAZ/DAZL). Nhóm 3 có kích thước sản phẩm PCR huỳnh quang dài hơn kích thước sản phẩm PCR tham khảo (sY134). Ngoài 3 nhóm trên, kết quả nghiên cứu ghi nhận sY1291 có kích thước sản phẩm PCR huỳnh quang có thể ngắn hơn từ 4-20 nucleotid (507 bp, 512 bp, 523 bp) hoặc bằng với kích thước sản phẩm PCR tham khảo (527 bp). So sánh với nghiên cứu của Plaseska et al. (2011), kết quả có sự phù hợp về kích thước sản phẩm PCR huỳnh quang ở nhóm 2 và nhóm 3. Ở nhóm 2, tác giả ghi nhận kích thước sản phẩm PCR huỳnh quang của SRY là 243 bp, ngắn hơn 5 nucleotid so với kích thước gen mong đợi là 248 bp. Sở dĩ có sự khác nhau là do nghiên cứu sử dụng trình tự đoạn mồi khác. Kết quả phù hợp với nghiên cứu của Plaseska et al. (2011) và 17 Papoulidis et al. (2012) là 103 bp và 109 bp. Một nghiên cứu khác của Fodor et al. (2007) và Majumder et al. (2015) cũng ghi nhận kích thước sản phẩm PCR huỳnh quang của đoạn gen này là 104 bp và 110 bp. Như vậy, kích thước sản phẩm PCR huỳnh quang có thể ngắn hơn từ 2-3 bp so với kích thước sản phẩm PCR tham khảo do điều kiện phản ứng QF-PCR không giống nhau. Điều này hoàn toàn phù hợp với khuyến cáo của hãng về bộ kit Devyser dùng phát hiện mất đoạn AZF. Như vậy, vị trí peak của các sản phẩm PCR huỳnh quang có thể bằng, ngắn hoặc dài hơn kích thước nucleotid tham khảo là phù hợp với nhiều nghiên cứu trên thế giới. Kết quả luận án ghi nhận đa số sản phẩm PCR huỳnh quang ngắn hoặc dài hơn 2-5 bp so với sản phẩm PCR tham khảo; ngoại trừ đoạn gen thể hiện sự đa hình về chiều dài (ngắn hơn 4-20 bp) được khuếch đại bằng chỉ dấu di truyền sY1291. 4.1.2.2. So sánh với mẫu chứng dương Nghiên cứu thực hiện xét nghiệm một số mẫu chứng dương (ADN nam giới bị mất đoạn AZFc và hội chứng Klinefelter) bằng kỹ thuật QF- PCR. Kết quả ghi nhận hoàn toàn giống với mẫu chứng dương. 4.1.2.3. Gửi mẫu đi kiểm chứng Kết quả kiểm định 1 mẫu máu bằng phương pháp nuôi cấy bạch cầu lympho máu ngoại vi cũng cho thấy nam giới tăng 1 nhiễm sắc thể X, karyotype là 47,XXY, giống với kết quả QF-PCR. Ngoài ra, luận án chọn ngẫu nhiên 3 mẫu ADN (1 mẫu ADN không có bất thường nhiễm sắc thể Y, 1 mẫu ADN bị mất đoạn hoàn toàn AZFbc và 1 mẫu ADN bị mất đoạn hoàn toàn AZFc) gửi đi kiểm định tại Phòng xét nghiệm kỹ thuật cao ISOLABO bằng kit của Devyser cũng cho kết quả tương tự. 4.1.2.4. Giải trình tự để xác định sự đa hình về chiều dài của sản phẩm PCR huỳnh quang được khuếch đại bằng chỉ dấu di truyền sY1291 Thực hiện giải trình tự đoạn gen được khuếch đại bằng cặp mồi của sY1291 lặp đi lặp lại 10 lần trong 1 tháng, kết quả đều ghi nhận trình tự nucleotid của mẫu tương đồng khoảng 400 bp so với trình tự nucleotid tham khảo (tương đồng khoảng 77%) (Hình 4.5A, B). 18 Hình 4.5A. Độ tương đồng giữa trình tự nucleotid tham khảo (REF) và mẫu (SA100) với kích thước đoạn gen khuếch đại là 527 bp (Bioedit). Hình 4.5B. Độ tương đồng giữa trình tự nucleotid tham khảo (REF) và trình mẫu (SA207) với kích thước đoạn gen 507 bp (Bioedit). 19 Sự tương đồng trình tự nucleotid chỉ đạt được khoảng 77% là do tất cả các mẫu đều ghi nhận trên cả 2 đoạn ADN được khuếch đại bằng mồi xuôi hay mồi ngược đều bắt đầu xuất hiện trình tự nhiễu sau trình tự lặp đơn nucleotid T. Theo y văn, đoạn ADN có trình tự lặp đơn nucleotid trong phản ứng PCR sẽ làm cho enzym polymerase khi tổng hợp sợi mới sẽ tự thêm vào hoặc làm mất đi loại nucleotid lặp ở đoạn đó và làm nhiễu trình tự ở sau đoạn lặp đơn nucleotid (Jinks-Robertson, 2002). Như vậy, kết quả giải trình tự cho thấy sự đa hình về chiều dài sản phẩm PCR huỳnh quang được khuếch đại bằng cặp mồi của chỉ dấu di truyền sY1291 với kích thước 507 bp, 512 bp, 523 bp và 527 bp là do khác nhau về số lần lặp nucleotid T. Trên những cơ sở đó, quy trình kỹ thuật QF-PCR với 14 chỉ dấu di truyền để phát hiện một số dạng bất thường nhiễm sắc thể Y có độ chính xác cao và đáng tin cậy. 4.2. Xác định tỷ lệ một số dạng bất thường nhiễm sắc thể Y ở nam giới khám vô sinh có ≤ 5x106 tinh trùng/mL tinh dịch bằng quy trình kỹ thuật QF-PCR đã được xây dựng và kiểm định Kết quả nghiên cứu ghi nhận tỷ lệ bất thường nhiễm sắc thể Y ở đối tượng nghiên cứu là 35,1% (Hình 4.6), cao hơn một số nghiên cứu trong và ngoài nước (4-24%). Hình 4.6. Tỷ lệ bất thường nhiễm sắc thể Y ở đối tượng nghiên cứu. 20 Có 3 dạng bất thường nhiễm sắc thể Y, trong đó mất đoạn AZF chiếm tỷ lệ cao nhất (83,18%), thấp hơn là nhân đoạn gen DAZ (13,27%) và hội chứng Klinefelter có bất thường cấu trúc nhiễm sắc thể Y chiếm 3,55%. Không giống nghiên cứu của chúng tôi, đa số các nghiên cứu chỉ ghi nhận bất thường về karyotype và mất đoạn AZF. Sự khác biệt là do phương pháp nghiên cứu và số lượng chỉ dấu di truyền khác nhau. Có 4 dạng mất đoạn AZF; trong đó mất một phần đoạn AZFc chiếm tỷ lệ cao nhất (80,85%), thấp hơn là mất hoàn toàn đoạn AZFc chiếm 9,57%; mất hoàn toàn đoạn AZFbc chiếm 6,38%; và thấp nhất là mất một phần đoạn AZFb chiếm 3,2%. Kết quả nghiên cứu tương tự với nhiều nghiên cứu khác trên thế giới (45-98%) (Choi et al., 2013; Zhang et al., 2013b; Fadlalla et al., 2014; Gallego et al., 2014; Bichile et al., 2016; Zhu et al., 2016; Asadi et al., 2017). So sánh với các nghiên cứu trong nước cũng cho thấy tỷ lệ mất đoạn AZFc chiếm cao nhất (Nguyễn Minh Hà, 2011; Nguyễn Thị Việt Hà, 2012; Nguyễn Đức Nhự, 2015). Kết quả nghiên cứu công bố năm 2011- 2012 trên 70 nam giới khám vô sinh tại Bệnh viện Từ Dũ cho thấy mất đoạn AZFc chiếm tỷ lệ cao nhất 11,4% và mất đoạn AZFb là 1,43% (Nguyễn Minh Hà, 2011). Một nghiên cứu khác của Nguyễn Thị Việt Hà (2012) cho thấy mất đoạn AZFc chiếm tỷ lệ cao nhất 4,4%, thấp hơn là AZFa chiếm 2,4%, AZFb và AZFabc chiếm tỷ lệ thấp nhất là 0,4%. Năm 2015, nghiên cứu của Nguyễn Đức Nhự phát hiện mất đoạn AZFc và AZFcd chiếm tỷ lệ cao nhất là 26,53% (13/49 trường hợp), thấp hơn là AZFbcd chiếm 8/49 trường hợp (16,33%), AZFd chiếm 7/49 trường hợp (14,29%), AZFabcd và AZFbc chiếm 3/49 trường hợp (6,12%), AZFb chiếm 2/49 trường hợp (4,08%). Trong các kiểu mất một phần đoạn AZFc, kết quả ghi nhận có 7 kiểu mất đoạn gồm: gr/gr, b2/b3, mất 2 gen DAZ, mất 1 gen CDY1, mất 2 gen DAZ và 1 gen CDY1, mất đoạn sY1191-sY1192 và mất đoạn sY1291. Một số đột biến mất một phần đoạn AZFc mới so với các nghiên cứu trên thế giới là mất đoạn sY1291, mất đoạn sY1191-1192, mất 2 gen DAZ, mất 2 gen DAZ và 1 gen CDY1. Sỡ dĩ, kết quả nghiên cứu khác biệt với nhiều nghiên cứu trên thế giới là do hầu hết các nghiên cứu chỉ dựa vào sự vắng mặt sản phẩm PCR được khuếch đại bằng các cặp mồi của các chỉ dấu di truyền sY1291, sY1191, sY1192 để xác định mất đoạn kiểu gr/gr, b2/b3 và b1/b3. Trong khi theo y văn cho thấy, mất đoạn kiểu gr/gr, b2/b3 hay b1/b3 có liên quan đến mất 2 gen DAZ và 1 gen CDY. 21 Mất đoạn gr/gr chiếm tỷ lệ cao nhất (31,6%), thấp hơn là mất 2 gen DAZ (21,1%), mất đoạn sY1191-sY1192 (14,5%), mất đoạn sY1291 (10,5%), mất 2 gen DAZ - 1 gen CDY1 (9,2%), mất đoạn kiểu b2/b3 (7,9%), và thấp nhất là mất 1 gen CDY1 (5,2%). Kết quả phù hợp với nhiều nghiên cứu trên thế giới (Rozen et al., 2012; Sen et al., 2015; Olesen et al., 2017). Sau mất đoạn AZF, nhân đoạn gen DAZ là nguyên nhân di truyền phổ biến thứ 2. Ở nam giới không có bất thường nhiễm sắc thể Y, DAZ/DAZL xuất hiện peak theo tỷ lệ 4:2. Tuy nhiên, kết quả luận án ghi nhận 15/113 (13,27%) trường hợp nam giới có peak DAZ/DAZL xuất hiện với tỷ lệ là 6:2 (Hình 4.7) hoặc 8:2 (Hình 4.8). Hình 4.7. Kết quả QF-PCR mẫu A236 với tỷ lệ peak DAZ/DAZL là 6:2 tại vị trí 210 bp và 214 bp. Hình 4.8. Kết quả QF-PCR mẫu A174 với tỷ lệ peak DAZ/DAZL là 8:2 tại vị trí 210 bp và 214 bp. Nhân đoạn gen DAZ cũng đã được L

Các file đính kèm theo tài liệu này:

  • pdftom_tat_luan_an_nghien_cuu_mot_so_dang_bat_thuong_nhiem_sac.pdf
Tài liệu liên quan