Tóm tắt Luận án Nghiên cứu nấm Bipolaris oryzae hại hạt giống lúa thu thập tại các tỉnh phía bắc và ven biển miền trung Việt Nam

Với hạt giống lúa thuần, tổng số 1200 mẫu hạt giống thu thập tại

các tỉnh phía Bắc và ven biển miền Trung đã được giám định để điều

tra trong 3 năm. Tỷ lệ hạt nhiễm nấm của các mẫu thu thập không có

biến động nhiều qua các năm ngoại trừ một số mẫu có kết quả tăng đột

biến. Tỷ lệ mẫu nhiễm và tỷ lệ hạt nhiễm nấm ở vụ mùa cao hơn vụ

xuân. Tỷ lệ mẫu nhiễm nấm thấp nhất trên giống Q5 (18,3% trong vụ

xuân), tỷ lệ hạt nhiễm thấp nhất trên giống nếp Vải (1,6% tại vụ xuân

năm 2010). Tỷ lệ mẫu nhiễm nấm và tỷ lệ hạt nhiễm nấm trung bình

cao nhất trên giống IR 353-66 (tỷ lệ mẫu nhiễm nấm trung bình cao

nhất là 91,7% ở vụ mùa, tỷ lệ hạt nhiễm 23,7% tại vụ mùa năm 2012).

Với hạt giống lúa lai sản xuất trong nước, tỷ lệ mẫu nhiễm và tỷ

lệ hạt nhiễm nấm ở vụ mùa cao hơn vụ xuân. Các giống lúa lai có bố

mẹ sản xuất trong nước có tỷ lệ mẫu nhiễm nấm và tỷ lệ hạt nhiễm nấm

cao hơn các giống có bố mẹ nhập khẩu. Các giống có tỷ lệ hạt nhiễm

nấm không quá 5%, tỷ lệ này có biến động không đáng kể qua các năm.

Tỷ lệ hạt nhiễm thấp nhất trên giống TH3-3 được sản xuất năm 2010

(1,8%), 2011, và 2012 (1,9%); tỷ lệ hạt nhiễm nấm cao nhất xuất hiện

trên giống HYT 100 được sản xuất vào năm 2011 và LC 20 được sản

xuất vào năm 2012 với tỷ lệ 4,9%.

pdf24 trang | Chia sẻ: phuongchi2019 | Lượt xem: 509 | Lượt tải: 0download
Bạn đang xem trước 20 trang tài liệu Tóm tắt Luận án Nghiên cứu nấm Bipolaris oryzae hại hạt giống lúa thu thập tại các tỉnh phía bắc và ven biển miền trung Việt Nam, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
hống kê về mặt đa dạng sinh học. Kết quả cho thấy có sự đa dạng sinh học, tại một địa điểm có thể có cả hai loại gen cổ điển và vô tính (Burgos, 2013). 2.1.4. Độc tố và sự hình thành bào tử của nấm B.oryzae Misra et al. (1962) đã tìm ra sự khác biệt về tính độc và sự hình thành bào tử giữa hai ioslate phân lập được. Matuo (1948) cho rằng bào tử từ cây lúa mọc trên dung dịch có ít hay không có kali thì độc tính cao 6 hơn. Hình thành bào tử đòi hỏi phải có cả hai giai đoạn tối và sáng, ánh sáng xanh ức chế sự hình thành bào tử (Honda and Sakamoto, 1969). B. oryzae tiết ra hai loại độc tố là Cochliobolin gây độc cho cây mạ, hạn chế sự phát triển của rễ lúa ở nồng độ 30ppm; Ophiobolin gây độc cho rễ và diệp lục, gây héo úa cây ở nồng độ 2-5ppm. Các độc tố này có thể bị oxychlorua đồng làm bất hoạt. Nếu bệnh phát triển trên môi trường ít hay không có kali, độc tính gây bệnh sẽ gia tăng. Từ một bào tử hay nuôi cấy từ một tế bào ngọn, có thể tạo nên các dòng có độc tính khác nhau (Shoemaker, 1959). 2.1.5. Cơ chế lây nhiễm của nấm B.oryzae lên hạt giống Theo Nome et al. (2012), có 2 trường hợp xảy ra: - Nhiễm bệnh toàn hạt giống: nấm xâm nhiễm bất kỳ phần nào của hạt giống bởi hệ thống mạch dẫn hoặc trực tiếp bởi những vết thương tự nhiên hoặc nhân tạo. Nấm lây nhiễm thông qua giai đoạn nở hoa tạo hạt, bào tử của một số loại nấm nảy mầm và sợi nấm phát triển đến phôi nơi chúng có thể tồn tại như một sợi nấm tiềm sinh không hoạt động cho đến khi hạt nảy mầm. Khi hạt nảy mầm, điều kiện cho nấm phát triển cũng xuất hiện. - Mang nguồn bệnh thụ động: mầm bệnh dính vào hạt giống khi thu hoạch hoặc sau thu hoạch bao gồm các u sưng, các hạch nấm bộ phận của cây hoặc các hạt đất có mang mầm bệnh của một tác nhân gây bệnh có thể làm hạt giống nhiễm bệnh thứ cấp thông qua sự cọ sát trong bất kỳ quá trình sản xuất hạt giống nào như thu hoạch, chế biến và đóng gói. Bằng các biện pháp kỹ thuật Schroeder (1966) đã chứng minh sợi nấm Drechslera oryzae nằm trong nội nhũ, các sợi nấm phát triển dọc theo vách tế bào. Các phần bị nhiễm bệnh trên hạt: vỏ trấu, vỏ cám và phôi của hạt lúa. 2.1.6. Biện pháp phòng trừ nấm B.oryzae Theo Ou (1985), biện pháp phòng trừ tốt nhất là sử dụng giống chống chịu bệnh và sử dụng hạt giống sạch bệnh. Xử lý hạt giống bằng các phương pháp như vật lý, hóa học, sinh học để bảo vệ cây con không nhiễm bệnh từ hạt giống truyền sang, qua đó làm giảm khả năng phát 7 sinh dịch bệnh trên cây trồng. Xử lý hạt giống để tăng tỷ lệ nảy mầm, giảm khả năng truyền bệnh sang cây con, cây trồng không bị gây hại bởi bệnh truyền qua hạt giống, để bảo vệ khi hạt nảy mầm và cây con khỏi sự tấn công của nấm. 2.2. Những nghiên cứu trong nước 2.2.1. Đặc điểm của nấm B.oryzae Bệnh đốm nâu (tiêm lửa) đã được nghiên cứu từ những năm 60, 70. Theo Vũ Triệu Mân và Lê Lương Tề (2001), bệnh tiêm lửa do nấm B. oryzae gây hại chủ yếu trên lúa xấu, thiếu dinh dưỡng và các giai đoạn sinh trưởng mà cây khủng hoảng dinh dưỡng ở các bộ phận già hay thiếu dinh dưỡng, ở thời kỳ cuối mạ và lúa bị hạn, trên các lá già, giai đoạn cuối khi mạ chuẩn bị nhổ cấy, trên lá già sau đẻ nhánh, trên vỏ hạt bông lúa non lúc trỗ và đòng non khiến bông lúa bị lép. Mức độ thâm canh càng cao bệnh càng ít gây hại, giống lúa dài ngày càng dễ bị bệnh vì có nhiều giai đoạn sinh trưởng thiếu dinh dưỡng. Bệnh gây ít tác hại khi ở mức độ nhẹ, khi bệnh nặng, vết bệnh nhiều sẽ làm lá cây bị úa vàng khô héo. 2.2.2. Tình hình nấm B.oryzae gây hại trên hạt giống Theo Trung tâm khảo kiểm nghiệm giống, sản phẩm cây trồng Quốc gia, trong các nghiên cứu từ năm 1998 đến năm 2008 trên các mẫu hạt giống thu thập được ở các tỉnh miền Bắc và miền Trung, nấm B. oryzae được tìm thấy trên một số giống có chất lượng gạo ngon như Tám, Hương thơm số 1, IR353-66. Tỷ lệ hạt nhiễm bệnh này cao nhất là trên 80%, những mẫu hạt giống có tỷ lệ hạt nhiễm nấm B. oryzae đều có tỷ lệ cây mầm bất bình thường cao, tỷ lệ nảy mầm thấp. Một số dòng bố mẹ lúa lai tạo ra các giống lúa lai chất lượng cũng bị nhiễm bệnh với tỷ lệ trên 60%. 2.2.3. Khả năng truyền bệnh của nấm B.oryzae trên hạt B. oryzae là nấm bệnh truyền qua hạt giống, tất cả các phần của hạt đều tìm thấy bào tử nấm. Phôi, nội nhũ, mày hạt, vỏ trấu trên, vỏ trấu dưới, lớp vỏ cám đều có thể bị nấm bệnh tấn công và gây hại. Nấm 8 cũng có thể nằm bên trong hạt hoặc sát bề mặt hạt trong các lớp vỏ hạt (Somsiri and Vu Van Ba, 2005). 2.2.4. Khả năng gây hại của nấm B.oryzae trên cây mầm Nấm bệnh đã truyền qua cây mạ biểu hiện triệu chứng thành chín kiểu khác nhau, các cây mạ này trở thành cây mầm không bình thường không được tính vào tỷ lệ nảy mầm, có nghĩa là tỷ lệ nảy mầm chung của lô hạt giống đã bị giảm đi đúng bằng tỷ lệ cây mang triệu chứng bệnh: Cây mầm không có rễ; Không có rễ và bị thối ở thân mầm; Rễ ngắn; Thối thân mầm; Thối mầm và thối rễ; Rễ sơ cấp bị biến màu nâu, không phân nhánh và không có rễ sơ cấp; Mầm còi cọc vặn xoắn; Mầm nhỏ, yếu, úng nước; Rễ sơ cấp nhỏ và yếu (Huỳnh Văn Nghiệp và Ashok, 2004). 2.2.5. Biện pháp phòng trừ nấm B.oryzae Theo Phạm Văn Dư và cs. (2011), bệnh lem lép trong đó có nấm B. oryzae chiếm tỷ lệ 4,9%. Các giống lúa cải tiến có tỷ lệ bệnh cao hơn các giống lúa địa phương. Sử dụng phương pháp lựa chọn hạt giống sạch bệnh và dùng dung dịch muối pha loãng 15% trước khi gieo sạ trên ruộng, phương pháp này làm giảm tỷ lệ truyền bệnh qua hạt, tăng năng suất từ 12 đến 15%. Hiện nay việc xử lý hạt giống bằng thuốc hóa học đang được sử dụng rộng rãi, sử dụng các loại dịch chiết thực vật cũng đang được áp dụng. PHẦN 3. PHƯƠNG PHÁP NGHIÊN CỨU 3.1. Vật liệu - Mẫu hạt giống lúa thuần, lúa lai và các nguồn nấm thu thập tại các tỉnh phía Bắc và ven biển miền Trung. 3.2. Phương pháp nghiên cứu - Phương pháp điều tra theo QCVN 01-38:2010/BNNPTNT. - Phương pháp lấy mẫu hạt giống theo ISTA (2010). - Phương pháp kiểm nghiệm hạt giống theo ISTA (2010). - Phương pháp nghiên cứu đặc điểm phân tử: hai mồi ITS1 và ITS2 (White et al., 1990) đã được sử dụng để nhân toàn bộ vùng ITS của các mẫu nấm. Tìm kiếm cơ sở dữ liệu Genbank bằng phần mềm 9 trực tuyến BLAST tại NCBI (the National Center for Biotechnology Information). Phân tích trình tự gene được thực hiện bằng các phầm mềm ClustalX và MEGA5.1. - Phương pháp giám định nấm B. oryzae trên hạt giống lúa theo Mathur and Olga (2003). - Tính hiệu lực của thuốc theo công thức Abbott (1925). - Số liệu được xử lý bằng phần mềm Microsoft Excel, phân tích phương sai (ANOVA) bằng phần mềm IRRISTAT 5.0. PHẦN 4. KẾT QUẢ NGHIÊN CỨU VÀ THẢO LUẬN 4.1. Điều tra tình hình nấm B. oryzae gây hại trên đồng ruộng Trong cả hai vụ xuân và mùa của các năm 2010, 2011, 2012, chúng tôi đã tiến hành điều tra trên 20 giống lúa thuần, 10 giống lúa lai đang được trồng phổ biến. Các giống lúa này bao gồm có lúa nếp, lúa tẻ, giống lúa thuộc nhóm chất lượng, giống lúa thuộc nhóm năng suất cao, giống lúa cổ truyền và giống lúa mới được chọn lọc, lai tạo. Với lúa thuần, mức độ nhiễm nấm của từng giống khác nhau, vụ mùa mức độ nhiễm nấm cao hơn so với vụ xuân. Nấm B. oryzae luôn tồn tại trên đồng ruộng, khả năng thâm nhập, gây bệnh luôn được duy trì. Các vết bệnh do nấm B. oryzae gây ra đều tập trung tại các lá già và lá bánh tẻ của cây lúa, triệu chứng bệnh bắt đầu xuất hiện ở các lá gần bông và lá đòng vào thời điểm sắp thu hoạch. Đa số các giống có chỉ số bệnh trên đồng ruộng thấp dưới 1%, tỷ lệ bệnh dưới 10%. Bị gây hại nặng nhất là giống Bao thai lùn: vụ xuân tỷ lệ bệnh cao nhất là 10,5% và chỉ số bệnh là 1,8%; vụ mùa tỷ lệ bệnh là 18,6% và chỉ số bệnh là 3,5% vào năm 2012, số lá bị nấm gây hại chủ yếu ở cấp bệnh 1. Với lúa lai, kết quả cho thấy tất cả các giống đều nhiễm nấm B. oryzae với chỉ số bệnh tương đối thấp, cao nhất trên giống HYT 100 (1,7%) vào vụ mùa năm 2012. Toàn bộ số lá điều tra bị nhiễm bệnh đều ở cấp bệnh 1. Chỉ số bệnh của các giống qua 3 năm sự biến động về tỷ lệ 10 bệnh và chỉ số bệnh trên các giống không lớn. So với các giống lúa thuần thì tỷ lệ bệnh và chỉ số bệnh của các giống lúa lai thấp hơn. 4.2. Tình hình bệnh do B. oryzae gây hại trên hạt giống lúa Với hạt giống lúa thuần, tổng số 1200 mẫu hạt giống thu thập tại các tỉnh phía Bắc và ven biển miền Trung đã được giám định để điều tra trong 3 năm. Tỷ lệ hạt nhiễm nấm của các mẫu thu thập không có biến động nhiều qua các năm ngoại trừ một số mẫu có kết quả tăng đột biến. Tỷ lệ mẫu nhiễm và tỷ lệ hạt nhiễm nấm ở vụ mùa cao hơn vụ xuân. Tỷ lệ mẫu nhiễm nấm thấp nhất trên giống Q5 (18,3% trong vụ xuân), tỷ lệ hạt nhiễm thấp nhất trên giống nếp Vải (1,6% tại vụ xuân năm 2010). Tỷ lệ mẫu nhiễm nấm và tỷ lệ hạt nhiễm nấm trung bình cao nhất trên giống IR 353-66 (tỷ lệ mẫu nhiễm nấm trung bình cao nhất là 91,7% ở vụ mùa, tỷ lệ hạt nhiễm 23,7% tại vụ mùa năm 2012). Với hạt giống lúa lai sản xuất trong nước, tỷ lệ mẫu nhiễm và tỷ lệ hạt nhiễm nấm ở vụ mùa cao hơn vụ xuân. Các giống lúa lai có bố mẹ sản xuất trong nước có tỷ lệ mẫu nhiễm nấm và tỷ lệ hạt nhiễm nấm cao hơn các giống có bố mẹ nhập khẩu. Các giống có tỷ lệ hạt nhiễm nấm không quá 5%, tỷ lệ này có biến động không đáng kể qua các năm. Tỷ lệ hạt nhiễm thấp nhất trên giống TH3-3 được sản xuất năm 2010 (1,8%), 2011, và 2012 (1,9%); tỷ lệ hạt nhiễm nấm cao nhất xuất hiện trên giống HYT 100 được sản xuất vào năm 2011 và LC 20 được sản xuất vào năm 2012 với tỷ lệ 4,9%. Với hạt giống lúa lai nhập khẩu, chúng tôi đã tiến hành điều tra các mẫu lúa nhập khẩu vào nước ta tại vụ xuân và vụ mùa ba năm 2010, 2011, 2012 liên tục, kết quả cho thấy không có mẫu nào bị nhiễm nấm B. oryzae Với hạt giống lúa thu thập tại các vùng sinh thái khác nhau, tỷ lệ hạt nhiễm nấm thấp nhất thuộc vùng đồng bằng sông Hồng, tỷ lệ nhiễm cao nhất của vùng này là 8,3% vào năm 2012. Các tỉnh vùng Bắc trung bộ có tỷ lệ hạt nhiễm nấm cao nhất (15,3% vào năm 2011). Sau đó là các tỉnh vùng Tây bắc có tỷ lệ cao nhất là 10,0% vào năm 2010; vùng Đông bắc có tỷ lệ cao nhất là 9,5% vào năm 2011. Ở tất cả các vùng, tỷ 11 lệ hạt nhiễm nấm không có sự biến đổi nhiều qua các năm điều tra, tỷ lệ mẫu nhiễm nấm từ 36,6% đến 50%. Với hạt giống lúa thu thập tại các chế độ và địa hình canh tác khác nhau, chế độ canh tác một vụ lúa, một vụ cá có tỷ lệ hạt nhiễm thấp nhất (tỷ lệ cao nhất là 1,5%), chế độ chuyên canh lúa tỷ lệ hạt nhiễm cao nhất (25,5%). Đất sản xuất một vụ lúa, một vụ cá thường là khu đất trũng (đầm), giàu dinh dưỡng, cây lúa phát triển tốt, đẻ nhánh khỏe, các loại sâu bệnh khác cũng rất ít khi gặp. Sau khi gặt, tất cả các tàn dư của cây đều bị ngập nước trong thời gian dài nên tỷ lệ mẫu nhiễm nấm thấp đã hạn chế việc truyền bệnh sang vụ sau. Trên đất trồng lúa luân canh sản xuất cây vụ đông (khoai tây, rau họ thập tự), tỷ lệ mẫu nhiễm và hạt nhiễm nấm có nhiều hơn nhưng vẫn thấp hơn trên các chân đất chỉ trồng lúa, cây vụ đông không phải là ký chủ của B. oryzae nên cũng đã hạn chế được quá trình truyền bệnh trên đồng ruộng. Các mẫu thu thập tại Nghệ An có tỷ lệ hạt nhiễm nấm lên tới 62,5%, khu ruộng này chuyên canh lúa và nằm trên khu vực cao, địa hình dốc, khô hạn, khó khăn trong việc tưới tiêu. Quá trình chăm sóc như làm cỏ, bón phân và công tác bảo vệ thực vật còn hạn chế, sự phát triển của giống trên ruộng không đạt được mức tối đa, cây phát triển kém dẫn đến nấm bệnh phát triển nhiều. Tại Quảng Bình, mẫu thu tại ruộng chuyên canh lúa ven biển, đất pha cát và bạc màu cũng có tỷ lệ hạt nhiễm lên tới 52,5%. Các mẫu thu tại ruộng đất nhiễm phèn tại tỉnh này cho tỷ lệ hạt nhiễm 19,0%. Số mẫu nhiễm trên mẫu kiểm tra cao nhất cũng ở 3 loại địa hình như trên. Trên đất trũng có số mẫu nhiễm nấm thu thập được trên số mẫu kiểm tra thấp nhất (1/10), tỷ lệ hạt nhiễm nấm trên loại đất này cũng thấp nhất (1,5%). 4.3. Một số đặc điểm sinh học, phân tử của nấm B. oryzae 4.3.1. Kiểu nảy mầm của bào tử nấm B.oryzae Quá trình nảy mầm của bào tử nấm xảy ra sau 2 giờ ở nhiệt độ 250C trong điều kiện đủ nước, ánh sáng nhẹ, không đòi hỏi yêu cầu gì đặc biệt. Bào tử nấm nảy mầm theo 2 kiểu: nảy mầm ở 2 đầu của bào tử (70%) và 12 nảy mầm ở 2 đầu cùng tế bào giữa của bào tử (30%). Kết quả nghiên cứu thu được phù hợp với nghiên cứu của Dela (2006). Tuy nhiên kiểu nảy mầm ở một đầu của bào tử đã không quan sát thấy, có thể do sự đa dạng sinh học nên đã có khác biệt giữa Việt nam và Philippin. 4.3.2. Ảnh hưởngcủa nhiệt độ đến sự phát triển của nấm B.oryzae Ở các ngưỡng nhiệt độ khác nhau, sự phát triển của nấm B. oryzae sau các ngày nuôi cấy có sự khác nhau rõ rệt, nấm phát triển rất chậm ở ngưỡng 10oC và bị ức chế hoàn toàn ở ngưỡng 35oC, phạm vi nhiệt độ thuận lợi cho sự sinh trưởng của nấm B. oryzae là 25 -30oC. Kết quả nghiên cứu phù hợp với Shoemaker (1959) và các tác giả khác. Đây là phạm vi nhiệt thường có trong điều kiện tự nhiên ở cuối vụ xuân và vụ mùa miền Bắc khi cây lúa bước vào giai đoạn trỗ và chín. 4.3.3. Ảnh hưởng của môi trường đến sự phát triển của nấm B.oryzae Môi trường thuận lợi cho sự sinh trưởng và phát triển của nấm B. oryzae là PGA và MEA, đây là môi trường cung cấp nhiều cacbonhydrat cho nấm phát triển. Nấm phát triển kém nhất trên môi trường WA và RTA, hai loại môi trường này có thể không đáp ứng đủ dinh dưỡng cho nấm. Bào tử được sinh ra sớm nhất với số lượng nhiều nhất trên môi trường PGA. Môi trường WA nấm không sinh bào tử sau 7 ngày. 4.3.4. Ảnh hưởng của hàm lượng amylose và protein trong hạt giống tới sự phát triển của nấm B.oryzae Hàm lượng protein không thể hiện mối liên quan với tỷ lệ hạt nhiễm bệnh. Tỷ lệ hạt nhiễm nấm cao thường xuất hiện trên các giống có tỷ lệ amylose thấp và trung bình. Tuy nhiên mối quan hệ giữa tỷ lệ hạt nhiễm nấm và tỷ lệ amylose chưa rõ ràng nên cần có nghiên cứu sâu hơn để kết luận giống mẫn cảm với nấm B. oryzae phụ thuộc vào hai chỉ tiêu này hay không. 4.3.5. Ảnh hưởng của thời gian tới khả năng lan truyền của nấm B.oryzae Theo thời vụ, sau 3, 6, 9 tháng, hạt giống lúa có thể được sử dụng để gieo trồng. Sau các khoảng thời gian này nhìn chung khả năng bảo tồn để lan truyền của nấm không thay đổi. Trên các mẫu hạt giống có tỷ lệ hạt nhiễm nấm thấp, 3 tháng sau thu hoạch và bảo quản tỷ lệ nhiễm B.oryzae 13 trên hầu hết các mẫu hạt giống lúa kiểm tra không thay đổi, sau 6 tháng tỷ lệ nhiễm nấm tăng nhẹ (giống IRi 352 tăng 1,5%). Trên nhóm hạt giống có tỷ lệ hạt nhiễm nấm cao, tỷ lệ hạt nhiễm nấm B. oryzae ổn định trong suốt thời gian lưu giữ 9 tháng. 4.3.6. Đặc điểm phân tử tại vùng gen ITS của nấm B. oryzae Hiện nay, vùng liên gien ITS (internally transcribed spacers) của cụm gien rDNA là một trong các vùng gen phổ biến nhất để nghiên cứu đa dạng và xác định nhiều loài nấm. Các rDNA của nấm được tổ chức thành các đơn vị phiên mã. Mỗi đơn vị phiên mã có thể được lặp lại nhiều lần trên bộ genome. Về cấu trúc, ở sinh vật nhân thật, các đơn vị phiên mã thường lặp lại nhiều lần và kề nhau thành các cụm đơn vị phiên mã. Một đơn vị phiên mã gồm các gen xếp theo thứ tự là 18S- 5.8S-28S. Xung quanh vùng gen 5.8S là 2 vùng ITS ký hiệu là ITS1 (ở đầu 5’) và ITS2 (ở đầu 3’). Hình 4.1. Sơ đồ vùng ITS của B. oryzae Trình tự ITS1 và ITS 2 của nấm: >B.oryzae AAGGTCTCCGTAGGTGAACCTGCGGAGGGATCATTAC ACAACAAAATATGAAGGCCTGGCTTTCGCGGCC GGCTGAAGTATTTTTTTCACCCATGTCTTTTGCGCACTTGTTG TTTCCTGGGCGGGTTCGCCCGCCACCA GGACCAAACCATAAACCTTTTTTTCTTATGCAGTTTCCATCAG CGTCAGTAAAAACAATGTAATTATTAC AACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGA ACGCAGCGAAATGCGATACGTAGTGTGA ATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATT GCGCCCTTTGGTATTCCAAAGGGCATGC 14 CTGTTCGAGCGTCATTTGTACCTTCAAGCTTTGCTTGGTGTTG GGCGTTTTTTTGTCTCCCTCTTTCTGG GAGACTCGCCTTAAAACGATTGGCAGCCGGCCTACTGGTTTC GGAGCGCAGCACATTTTTTGCGCTTTGT ATCAGGAGAAAAGGACGGTACTCCATCAAGACTCTACATTTT TCACTTTTGACCTCGGATCAGGTAGGGA TACCCGCTGAACTTAAGCATATCA Tám mẫu nấm trên các loại hạt giống lúa khác nhau được thu thập từ các tỉnh khác nhau (bảng 4.1) đã được giải trình tự để tìm kiếm sự đa dạng trong vùng gen ITS. Đoạn nucleotide đọc được trên vùng ITS là 539bp. Kết quả tìm kiếm các trình tự gần gũi trên GenBank cho thấy loài gần gũi nhất là Cochliobolus miyabeanus có nguồn gốc Nhật Bản, mã JN943398; đoạn so sánh 100%, mức đồng nhất trình tự 100%. Bảng 4.1. Nguồn gốc các mẫu nấm B.oryzae thu thập được STT Danh sách isolate/ Mẫu nấm Địa điểm thu thập 1 BT7-V4/ Số 4 Ninh Bình 2 VL50-IV10/ Số 10 Hà Nội (Gia Lâm) 3 QN1-IV17/ Số 17 Bắc Giang 4 QR-III21/ Số 21 Hải Phòng 5 HT1-I24/ Số 24 Thái Bình 6 KD18-I248/ Số 248 Điện Biên 7 IR35366-V557/ Số 557 Hà Tĩnh 8 P6ĐB-III695/ Số 695 Thanh Hóa Tìm kiếm trên Genbank có 23 trình tự gen gần gũi với 8 trình tự đã được giải mã của Việt Nam. Các trình tự tìm thấy là Cochliobolus miyabeanus gây hại trên họ hòa thảo như lúa, lúa dại, niễng, cỏ ngọt, cỏ lồng vực, ngô, cá biệt gây hại trên chuối. Lựa chọn 20 mẫu B. oryzae và 10 mẫu loài Bipolaris khác trên Genbank để so sánh mức đồng nhất với các mẫu B. oryzae thu thập tại Việt Nam. Trình tự gen của 8 mẫu nấm thu thập trên 8 giống lúa tại 8 tỉnh khác nhau đã cho kết quả giống nhau 15 tại vùng gen ITS1 và ITS2. và đồng nhất với nhóm B. oryzae đã được công bố trên thế giới từ 82,2% trở lên, đồng nhất với nhóm loài Bipolaris khác đã được công bố trên thế giới từ 81,1% trở lên. Hình 4.2. Phân tích phả hệ dựa trên trình tự toàn bộ vùng ITS của các mẫu nấm B. oryzae Cây được xây dựng bằng phương pháp Neighbor-Joining (NJ). Giá trị ở các nốt là giá trị thống kê boostrap dưới dạng % (1000 lần lặp) (ngưỡng tin cậy nhìn chung là 75% có nghĩa trong 1000 lần lặp thì 750 lần các đơn vị phân loại phân nhóm với nhau). Các mẫu B. oryzae của Việt Nam được đánh dấu bằng dấu chấm và biểu diễn bằng mã giải trình tự. 163DZAB016 (Mẫu số 24) 163DZAB020 (Mẫu số 695) 163DZAB010 (Mẫu số 4) 163DZAB018 (Mẫu số 248) 163DZAB019 (Mẫu số 557) 163DZAB015 (Mẫu số 21) 163DZAB014 (Mẫu số 17) 163DZAB012 (Mẫu số 10) B.oryzae (JQ237248) B.oryzae (GU222693) B.oryzae (JQ517483) B.oryzae (HM572291) B.oryzae (HM131852) B.oryzae (KF688970) B.oryzae (HM147247) B.oryzae (JQ753706) B.oryzae (HM147248) B.oryzae (KJ522982) B.oryzae (KJ563117) B.oryzae (KC315929) B.oryzae (JF693910) B.oryzae (KJ371107) B.oryzae (KC315942) B.oryzae (KC315940) B.oryzae (KC315943) B.oryzae (KC315939) B.cynodontis (JX256412) B.chloridis (JN192372) B.microlaenae (JN601032) B.peregianensis (JN601034) B.sativus (JX256418) B.melinidis (JN601035) B.victoriae (JN601027) B.maydis (AF071325) B.carbonum (AF158110) B.zeae (AF081452) 57 84 74 54 9 8 74 57 80 52 74 63 76 100 0.005 Cụm loài B.oryzae 16 Phân tích phả hệ dùng các trình tự mẫu và các trình tự của các loài được xác định thông qua tìm kiếm Blast (hình 3.2). Các mẫu thu được phân nhóm chặt chẽ với cụm loài tương ứng của chúng. Mức độ đồng nhất của các mẫu thu thập tại Việt Nam với nhóm B. oryzae đã được công bố trên thế giới từ 74% trở lên. Trình tự gen của 8 mẫu nấm trên 8 giống lúa khác nhau thu được tại 8 tỉnh khác nhau đã cho kết quả giống nhau tại vùng gen ITS1 và ITS2 cho thấy tại Việt Nam nấm B. oryzae chưa tìm thấy sự đa dạng tại 2 vùng gen này. Để tìm ra đa dạng sinh học của nấm B. oryzae cần có các nghiên cứu sâu hơn bằng các phương pháp khác. 4.4. Đặc điểm gây hại của nấm B.oryzae trên hạt 4.4.1. Giai đoạn xâm nhiễm của nấm B. oryzae vào hạt Theo dõi quá trình xâm nhiễm tự nhiên của nấm B. oryzae vào hạt được tiến hành trên ruộng sản xuất hạt giống lúa Hương thơm số 1 tại Thái Bình vụ mùa năm 2012. Ruộng lúa lựa chọn để nghiên cứu ở giai đoạn phân hóa đòng có tỷ lệ cây nhiễm nấm B. oryzae là 100%, chỉ số bệnh là 7,9%. Để đảm bảo quá trình xâm nhiễm vào hạt không bị ảnh hưởng, ruộng thí nghiệm không phun thuốc trừ bệnh. Bảy giai đoạn phát triển hình thành hạt giống lúa đã được điều tra lấy mẫu bông mang về phòng thí nghiệm để kiểm tra sự xuất hiện của nấm hạt, kết quả cho thấy chỉ số bệnh của ruộng giống tăng dần từ giai đoạn phân hóa đòng đến khi thu hoạch, các giai đoạn của quá trình hình thành hạt đều có sự xuất hiện của nấm B. oryzae với hạt nhiễm nấm trên bông tăng dần cho đến khi chín hoàn toàn, tỷ lệ hạt nhiễm nấm tăng từ 0,5 đến 6%. Để đánh giá khả năng xâm nhiễm của nấm B. oryzae vào hạt ở các thời điểm tạo hạt, các cây lúa sạch bệnh trồng trong chậu đã được đặt ra ruộng lúa đang được theo dõi ở trên. Toàn bộ bông trong chậu thí nghiệm được thu hoạch vào cuối giai đoạn phát triển để kiểm tra tỷ lệ hạt nhiễm nấm. Tổng số 24 chậu lúa được gieo từ nguồn hạt giống đã xử lý nấm bệnh và trồng cách ly với nguồn bệnh đã được sử dụng làm 17 thí nghiệm. Kết quả cho thấy các giai đoạn từ đẻ nhánh đến chuẩn bị trỗ cây lúa có thời gian tiếp xúc với nấm bệnh lâu nhất nhưng B. oryzae vẫn chưa xâm nhập được vào đòng nên không có bằng chứng cho thấy nấm xâm nhập vào hạt. Tỷ lệ hạt nhiễm nấm tăng đột biến vào giai đoạn trỗ 50% trở đi, tỷ lệ hạt nhiễm cao nhất vào giai đoạn lúa trỗ 100% và giảm dần vào các giai đoạn sau (bảng 4.2). Bảng 4.2. Kết quả theo dõi mức độ nhiễm nấm B. oryzae ở các giai đoạn hình thành hạt trên đồng ruộng STT Giai đoạn phát triển Chỉ số bệnh (%) Tỷ lệ hạt nhiễm nấm (%) 1 Đẻ nhánh 3,1 - 2 Phân hóa đòng 7,9 0 3 Chuẩn bị trỗ 7,9 1,5d 4 Trỗ 50% 8,0 6,5b 5 Trỗ thoát 100% 9,9 9,0a 6 Chín sữa 13,2 8,5a 7 Chín sáp 14,0 3,0c 8 Chín hoàn toàn 15,3 2,0d Mỗi giai đoạn thực hiện với 3 chậu, mỗi chậu trồng 5 cây, các chậu được đặt vào giữa ruộng bị nhiễm bệnh. Cuối giai đoạn thu các chậu này về và đặt các chậu mới để thực hiện giai đoạn tiếp theo. Các ký tự khác nhau có sự khác biệt ở mức ý nghĩa 0,05; CV=7,3%. 4.4.2. Vị trí tồn tại của nấm B. oryzae trên hạt giống lúa Thu ngẫu nhiên các bông lúa từ ruộng lúa Hương thơm số 1 có chỉ số bệnh lớn hơn 15%, chọn ba nhóm hạt có triệu chứng không biến màu, biến màu nhẹ, biến màu và biến dạng. Tách các phần của hạt, đặt các phần này trên giấy ẩm theo phương pháp Blotter. Kết quả thu được cho thấy tất cả các phần vỏ trấu, phôi, vỏ cám và nội nhũ của cả ba nhóm hạt đều xuất hiện nấm B. oryzae (bảng 4.3). 18 Bảng 4.3. Vị trí tồn tại của nấm B. oryzae trên hạt Đặc điểm mẫu Vị trí tồn tại của nấm Vỏ trấu Phôi Vỏ cám Nội nhũ Hạt không biến màu + + + + Hạt biến màu nhẹ ++ + + + Hạt biến màu và biến dạng +++ ++ ++ + Ghi chú: + ++ +++ <10% số hạt bị nhiễm nấm tại vị trí kiểm tra 10-25% số hạt bị nhiễm nấm tại vị trí kiểm tra >25% số hạt bị nhiễm nấm tại vị trí kiểm tra 4.4.3. Vị trí phát triển và gây hại trên hạt của nấm B.oryzae Vị trí phát triển trên hạt của nấm có ý nghĩa rất lớn trong quá trình nảy mầm của hạt. Song song với quá trình hạt giống lúa nảy mầm, nấm B. oryzae cũng phát triển, nếu vị trí của nấm phát triển gần phôi hạt thì khả năng cây mầm bị gây hại nặng là rất cao. Gây nguy hiểm nhất đối với hạt giống lúa là nấm tồn tại và phát triển ngay tại phôi hoặc các vị trí sát cạnh phôi, khi mầm phát triển là nấm lập tức tấn công gây hại. Với mức độ nhiễm nặng, nấm có thể gây thối (chết) phôi ngay khi hạt chưa kịp nảy mầm hoặc làm chết mầm của hạt ngay khi vừa nhú. Vị trí ít gây hại hơn cả khi nấm phát triển ở phía cuối hạt nơi cách xa phôi nhất, tuy nhiên cũng phụ thuộc vào mức độ nhiễm nấm của hạt. Nấm B. oryzae gây hại trên hạt với các biểu hiện như sau: - Gây chết hạt (hạt bị thối trước khi nảy mầm). - Toàn bộ bề mặt hạt bị bao phủ một lớp nấm màu xám đen - Mầm bị thối hoàn toàn. - Rễ bị thối hoàn toàn. - Mầm và rễ bị thối toàn bộ. - Một phần mầm hoặc rễ bị thối. Nấm gây hại trên hạt trong quá trình nảy mầm ở các cấp độ khác nhau đã tạo ra các thương tổn khác nhau (hình 4.3). 19 Hình 4.3. Các dạng cây mầm hạt giống lúa HT1 bị nấm B. oryzae gây hại Mật độ bào tử xuất hiện trên hạt có ý nghĩa trong việc lan truyền trên đồng ruộng. Mật độ bào tử dầy tức là số lượng bào tử nhiều, khả năng lan truyền nhanh và mạnh, mật độ bào tử thưa, sợi nấm nhiều thì khả năng lan truyền sẽ kém hơn. Kết quả nghiên cứu cho thấy bào tử phát triển dày đặc xuất hiện với tần xuất nhiều hơn trên hạt bị nấm bao phủ quá nửa bề mặt. Đối với hạt mang nấm phát triển dưới một nửa hạt thì kiểu mật độ bào tử thưa xuất hiện nhiều hơn. Nghiên cứu xu thế phát triển của nấm trên bề mặt hạt kết quả cho thấy nấm có xu thế phát triển về phía phôi hạt với tỷ lệ cao ở tất cả các mẫu nghiên cứu. 4.4.4. Khả năng gây bệnh của các nguồn nấm B.oryzae thu thập tại các tỉnh Toàn bộ 24 mẫu nấm tham gia thí nghiệm đều cho kết quả tương đối giống nhau về thời kỳ tiềm dục, khả năng lây bệnh và mức độ gây h

Các file đính kèm theo tài liệu này:

  • pdfbvtv_ttla_tran_thi_hung_7176_2005164.pdf
Tài liệu liên quan