Tóm tắt Luận án Nghiên cứu phát triển hệ thống chuyển gen bằng vi khuẩn Agrobacterium Tumefaciens cho nấm sợi Aspergillus Oryzae

Gen trợ dưỡng dùng làm marker cho chuyển gen

Chủng nấm đột biến trợ dưỡng là các chủng mất khả năng sinh tổng hợp một

loại axit amin hoặc một hợp chấtcần thiết trong quá trình sinh trưởng, việc mất khả

năng tự tổng hợp khiến chúng không còn khả năng sinh trưởng trên môi trường tối

thiểu mà cần phải bổ sung thêm axit amin hoặc hợp chất tương ứng. Gen trợ dưỡng

được sử dụng nhiều nhất trong chọn lọc thể chuyển gen là gen pyrG (mã hóa protein

tham gia quá trình tổng hợp uridine/uracil)[49, 59, 94]. Ngoài ra còn có các gen trợ

dưỡng khác cũng được sử dụng nhưadeA(gen mã hóa enzyme tham gia tổng hợp

adenine), met(gen mã hóa enzyme tham gia tổng hợp methionine), trp(gen mã hóa

enzyme tham gia quá trình tổng hợp tryptophan), argB (gen mã hóa enzyme tham gia

quá trình tổng hợp arginine) [30, 116].

Các marker dùng cho chọn lọc các thể chuyển gen giữ vai trò hết sức quan

trọng, quyết định sự thành công của quá trình chuyển gen. Phần lớn các nghiên cứu

chuyển gen vào nấm sợi sử dụng các chất kháng sinh diệt nấm. Tuy nhiên, các kháng

sinh này thường có giá thành rất cao, khiến việc chuyển gen bị hạn chế. Bên cạnh đó,

nhiều loài nấm sợi (tiêu biểu là A. oryzae) có khả năng kháng tự nhiên với nhiều loại

kháng sinh hoặc chỉ bị ức chế ở nồng độ kháng sinh rất cao.Do đó việc sử dụng

kháng sinh trong chọn lọc thể chuyển gen là không khả thi[96]. Để khắc phục nhược

điểm này, một số loài nấm sợi đã được cải biến di truyền để có thể sử các gen trợ

dưỡng dụng làm các marker chuyển gen. Chuyển gen vào các chủng trợ dưỡng giúp

giảm chi phí, an toàn đối với môi trường và có tiềm năng ứng dụng vào sản xuất thực

tiễn.

pdf51 trang | Chia sẻ: trungkhoi17 | Lượt xem: 379 | Lượt tải: 0download
Bạn đang xem trước 20 trang tài liệu Tóm tắt Luận án Nghiên cứu phát triển hệ thống chuyển gen bằng vi khuẩn Agrobacterium Tumefaciens cho nấm sợi Aspergillus Oryzae, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
lọc thể chuyển gen là hygromycin B, phleomycin và nourseothricin. Hygromycin B là một loại kháng sinh thuộc nhóm aminoglycoside, được sản xuất từxạ khuẩn Streptomyces hygroscopicus. Chúng có thể tiêu diệt vi khuẩn, nấm và các tế bào nhân chuẩn bằng cách ức chế tổng hợp protein[76]. Phleomycin được sản xuất bởi xạ khuẩn Streptomyces verticillus, là một kháng sinh phổ rộng có hiệu quả chống lại hầu hết các loại vi khuẩn, nấm sợi, nấm men, thực vật và tế bào động vật. Kháng sinh phleomycin thuộc nhóm kháng sinh glycopeptide, gây chết tế bàobằng cách bám vào DNA và làm phá vỡ sợi kép của DNA dẫn đến các hoạt động của tế bào bị ngừng và chết[9]. Nourseothricin, với tên thương mại là clonNAT, thuộc nhóm kháng sinh aminoglycoside có nguồn gốc từ loài xạ khuẩn thuộc chi Streptomyces. Kháng sinh nàyhoạt động bằng cách gây lỗi mã hóa trong quá trình dịch mã dẫn tới không tổng hợp được protein. ClonNAT được dùng rất phổ biến làm marker chọn lọc thể chuyển gen gồm cả vi khuẩn, nấm men, nấm sợi và tế bào thực vật [39]. 1.2.4.2. Gen trợ dưỡng dùng làm marker cho chuyển gen Chủng nấm đột biến trợ dưỡng là các chủng mất khả năng sinh tổng hợp một loại axit amin hoặc một hợp chấtcần thiết trong quá trình sinh trưởng, việc mất khả năng tự tổng hợp khiến chúng không còn khả năng sinh trưởng trên môi trường tối thiểu mà cần phải bổ sung thêm axit amin hoặc hợp chất tương ứng. Gen trợ dưỡng được sử dụng nhiều nhất trong chọn lọc thể chuyển gen là gen pyrG (mã hóa protein tham gia quá trình tổng hợp uridine/uracil)[49, 59, 94]. Ngoài ra còn có các gen trợ dưỡng khác cũng được sử dụng nhưadeA(gen mã hóa enzyme tham gia tổng hợp adenine), met(gen mã hóa enzyme tham gia tổng hợp methionine), trp(gen mã hóa enzyme tham gia quá trình tổng hợp tryptophan), argB (gen mã hóa enzyme tham gia quá trình tổng hợp arginine)[30, 116]. Các marker dùng cho chọn lọc các thể chuyển gen giữ vai trò hết sức quan trọng, quyết định sự thành công của quá trình chuyển gen. Phần lớn các nghiên cứu chuyển gen vào nấm sợi sử dụng các chất kháng sinh diệt nấm. Tuy nhiên, các kháng sinh này thường có giá thành rất cao, khiến việc chuyển gen bị hạn chế. Bên cạnh đó, nhiều loài nấm sợi (tiêu biểu là A. oryzae) có khả năng kháng tự nhiên với nhiều loại kháng sinh hoặc chỉ bị ức chế ở nồng độ kháng sinh rất cao.Do đó việc sử dụng kháng sinh trong chọn lọc thể chuyển gen là không khả thi[96]. Để khắc phục nhược điểm này, một số loài nấm sợi đã được cải biến di truyền để có thể sử các gen trợ dưỡng dụng làm các marker chuyển gen. Chuyển gen vào các chủng trợ dưỡng giúp giảm chi phí, an toàn đối với môi trường và có tiềm năng ứng dụng vào sản xuất thực tiễn. 1.2.4.3. Marker pyrG Uridine 5’-monophosphate (UMP) và uracil là những hợp chất quan trọng trong quá trình sinh trưởng và phát triển của tế bào, bởi chúng liên quan đến sự tổng hợp các axit nucleic cần thiết cho mọi tế bào sống. Sinh tổng hợp UMP được thực hiện bởi enzyme orotidine 5’-monophosphate decarboxylase (OMP decarboxylase) được mã hóa bởi gen pyrG ở nấm sợi hoặc gen URA3 ở nấm men [13, 49]. Gen pyrG giúp tế bào nấm tự tổng hợp UMP trong quá trình sinh trưởng. Tuy nhiên với những chủng đột biến hỏng gen pyrG, chúng chỉ có thể sinh trưởng được trong điều kiện môi trường ngoại bào có bổ sung uridine hoặc uracil. Khi gen pyrG được đưa trở lại các chủng đột biến này, chúng có thể sinh trưởng bình thường. Chính vì lý do đó nhiều nghiên cứu trước đây đã sử dụng gen pyrG làm marker chọn lọc trong quá trình chuyển gen [13, 58, 73, 104, 107]. Với chủng tự nhiên (wild type), hoạt động của enzyme OMP decarboxylase mã hóa bởi gen pyrGsẽ chuyển hóa hợp chất 5-fluoroorotic acid (5-FOA) không độc thành chất gây độc tế bào là 5-fluorouracil. Ngược lại, các chủng bị đột biến sai hỏng về gen pyrG sẽ không thể chuyển hóa hợp chất 5-FOA và các chủng này có thể sinh trưởng bình thường trên môi trường chứa 5-FOA.Chính vì vậy 5-FOA thường được bổ sung vào môi trường trong quá trình chọn lọc các chủng vi nấm đột biến hỏng hoặc mất gen pyrG. Việc đưa gen pyrGquay trở lại thể đột biến tương ứng sẽ giúp thể đột biến tự tổng hợp uridine/uracil và sinh trưởng được trên môi trường tối thiểu (không bổ sung uridine/uracil)[116]. Nhiều nghiên cứu đã được tiến hànhnhằm tạo ra các chủngnấm sợi trợ dưỡng uridine/uracil, trong đó có các loài thuộc chi Aspergillus. Phương pháp phổ biến nhất để tạo chủng đột biến trợ dưỡng uridine/uracil là chiếu tia UV sau đó sàng lọc trên môi trường chọn lọc có chứa hợp chất 5-FOA, uridine và uracil[34, 49, 104]. Ngoài cách chiếu UV, thể đột biến trợ dưỡng uridine/uracil còn được tạo ra nhờ phương pháploại bỏ trực tiếp gen pyrG thông qua việc chuyển cấu trúc xóa gen pyrGvào tế bào nấm. Nhờ cơ chế trao đổi chéo tương đồng, gen pyrG trong hệ gen của nấm có thể được loại bỏ để tạo ra thể đột biến mất khả năng tổng hợp uridine/uracil[25, 49, 116]. 1.2.5. Một số gen chỉ thị dùng trong chuyển gen ở vi nấm Gen chỉ thị mã hóa các protein tương ứng được sử dụngtrong đánh giá hiệu quả chuyển gen hoặc dùng như dấu hiệu để sàng lọc các thể chuyển gen. Sự có mặt của gen chỉ thịkhiến các tế bào/khuẩn lạc của thểchuyển gen có kiểu hình khác biệt và dễ dàng phân biệt với các chủng tự nhiên.Gen chỉ thị không gây ảnh hưởng đến chức năng sinh lý cũng như sinh trưởng của các thể chuyển gen[33]. Ngược lại với marker chọn lọc bảo vệ thể chuyển gen trên môi trường chọn chọn lọc và gây chết hoặc ngăn chặn sự phát triển của chủng tự nhiên, gen chỉ thị được sử dụng để sàng lọc các chủng chuyển gen làm cho các tế bào/khuẩn lạc chứa gen chỉ thịcó đặc điểm có thể quan sát trực quan bằng mắt. Các gen chỉ thị có thể được gắn liền với gen đích và được điều khiển dưới cùng một promoter hoặc biểu hiện độc lập mà không có gen đích đi kèm.Một số các gen chỉ thị hay được sử dụng như: GFP, DsRed, GUS, lacZ[40, 69, 72]. Các gen chỉ thị được dùng phổ biến trong chuyển genở nấm sợi là gen mã hóa protein huỳnh quang xanhGFP và gen mã hóa protein huỳnh quang đỏ DsRed. 1.2.5.1. Gen mã hóa huỳnh quang xanh (GFP) Gen GFPcó chiều dài 720 bp được phân lập lần đầu tiên từ sứa Aequoreavictoria bởi Osamu Shimomura năm 1962.GFP mã hóa protein có kích thước 238 axit amin (26,9 kDa). Protein này phát ánh sáng huỳnh quang màu xanh lá cây khi tiếp xúc với ánh sáng bước sóng 509 nm (Hình 1.5)[78, 89]. Trong lĩnh vực sinh học phân tử, genGFP thường được sử dụng như một gen chỉ thịtrong chuyển gen và biểu hiện gen. GFPthường được đưa vào tế bàothông qua các kỹ thuật chuyển gen vàsự tích hợp của GFP trong hệ gen của tế bào có thể đủ bền vững qua các thế hệ sau. Đến nay, GFP đã được biểu hiện ở nhiều loài, bao gồm cả sinh vật nhân sơ và nhân chuẩn, trong đó có nấm sợi[52]. Hình 1.5.Biểu hiện genGFPởnấm sợiAspergillus fumigatus[35] Gen huỳnh quang GFPrất hữu ích trong việc nghiên cứu xác định vị trí của protein hoặc kiểm tra mức độ biểu hiện của một gen mong muốn. Trong nghiên cứu phát triển các phương pháp chuyển gen, biểu hiện gen chỉ thị GFPđã được chứng minh là thành công trên nhiều loài nấm sợi như Aspergillus fumigatus [35], Aspergillus oryzae[56], Aspergillus nidulans[5], Aspergillus niger[21], Fusarium oxysporum[48] 1.2.5.2. Gen mã hóa huỳnh quang đỏ (DsRed) Gen mã hóa protein huỳnh quang đỏ DsRedcó chiều dài 678 bp được phân lập từ một loài san hô thuộc chi Discosoma. Protein DsRed gồm 226 axit amin với kích thước 28 kD, phát huỳnh quang màu đỏ và tín hiệu huỳnh quang mạnh nhất khi được quan sát dưới ánh sáng bước sóng 583 nm[3].Do đặc tính tương tự như gen huỳnh quang GFP nên DsRed cũng được sử dụng làm gen chỉ thị trong nghiên cứu ở nhiều loài sinh vật khác nhau. Riêng với nấm sợi, gen DsRed được biểu hiện thành công trên nhiều loài như Sordaria macrospora[15], Fusarium oxysporum[70],Acremonium chrysogenum[32], Aspergillus fumigatus[44]Các tế bào nhận được gen DsRed sẽ có màu đỏ dưới kính hiển vi huỳnh quang với bước sóng phù hợp (Hình 1.6). Hình 1.6. Biểu hiện gen DsRed ở nấm sợiFusarium oxysporum[70] Chƣơng 2. VẬT LIỆU VÀ PHƢƠNG PHÁP 2.1. Nguyên liệu 2.1.1. Chủngvi sinh vật Các chủng vi sinh vật sử dụng trong nghiên cứu được liệt kê trong Bảng 2.1. Bảng 2.1. Các chủng vi sinh vật dùng trong nghiên cứu STT Tên chủng Phân loại Nguồn gốc 1 RIB40 A. oryzae National Research Institute of Brewing (Nhật Bản) 2 AUT1-PlD A. oryzae Bộ mônCông nghệ Sinh học, Đại học Tokyo, Nhật Bản 3 VTCCF 032 A. oryzae Viện Vi sinh vật học và Công nghệSinh học, ĐHQGHN 4 VTCCF 040 A. oryzae Viện Vi sinh vật học và Công nghệ Sinh học, ĐHQGHN 5 VTCCF 047 A. oryzae Viện Vi sinh vật học và Công nghệ Sinh học, ĐHQGHN 6 VTCCF 048 A. oryzae Viện Vi sinh vật học và Công nghệ Sinh học, ĐHQGHN 7 VTCCF 051 A. oryzae Viện Vi sinh vật học và Công nghệ Sinh học, ĐHQGHN 8 VTCCF 053 A. oryzae Viện Vi sinh vật học và Công nghệ Sinh học, ĐHQGHN STT Tên chủng Phân loại Nguồn gốc 9 VTCCF 912 A. oryzae Viện Vi sinh vật học và Công nghệ Sinh học, ĐHQGHN 10 VTCCF 914 A. oryzae Viện Vi sinh vật học và Công nghệ Sinh học, ĐHQGHN 11 VS1 A. oryzae Phòng Genomic- Phòng thí nghiệm Trọng điểm Công nghệ Enzyme và Protein, Trường Đại học Khoa học Tự nhiên 12 NRRL 3357 A. flavus ARS (NRRL) Culture Colection (Mỹ) 13 VTCCF 013 A. flavus Viện Vi sinh vật học và Công nghệ sinh học, ĐHQGHN 14 N402 A. niger CBS Fungal Biodiversity Centre (Hà Lan) 15 VTCCF 015 A. fumigatus Viện Vi sinh vật học và Công nghệ sinh học, ĐHQGHN 16 VTCCF 1414 A. fumigatus Viện Vi sinh vật học và Công nghệ sinh học, ĐHQGHN 17 FGSC A4 A. nidulans Fungal Genetics Stock Center (Mỹ) 18 DH5α E. coli [22] 19 AGL1 A. tumefaciens [43] ChủngA. tumefaciens AGL1 là chủng đã được cải biến di truyền và được sử dụng làm sinh vật trung gian để chuyển gen vào nấm. Chủng AGL1 mang gen kar kháng kháng sinh kanamycin sử dụng trong chọn lọc các chủng mang vector nhị thể. Chủng A. oryzae AUT1-PlD có nguồn gốc từ chủng RIB40. Chủng n{yđ~ bị xóa gen pyrG trong hệ gen v{ được sử dụng trực tiếp để chuyển gen sử dụng marker pyrG. 2.1.2. Thiết bị và hóa chất Các hóa chất được sử dụng trong nuôi cấy vi sinh vật và trong các thí nghiệm sinh học phân tử gồm: glucose, sucrose, KCl, NaCl, MgSO4, KH2PO4, K2HPO4, FeSO4, MnSO4, glycerol, NaNO3, (NH4)2SO4, NH4Cl, EDTA, KOH, HCl, Tris-HCl, SDSCác hóa chất với độ tinh khiết cao được mua từ những hãng uy tín như Thermo Scientific, Biobasic, Merck, Sigma, Biozym. Các mồi dùng cho phản ứng PCR do công ty IDT (Singapore) tổng hợp. Danh sách mồi được liệt kê ở Bảng 2.2. Bảng 2.2. Mồi PCR dùng trong nghiên cứu Tên mồi Trình tự (5’-3’) Enzyme giới hạn Kích thƣớc Tham khảo ITS1 TCCGTAGGTGAACCTGCGG 486- 599 bp [114] ITS4 TCCTCCGCTTATTGATATGC [114] Aof-ITS-F ATGGCCGCCGGGGGCTCT [10] AFB-F AAGCAAACCAAGACCAACAAG 116 bp [10] AFB-R AACAAGTCTTTTCTGGGTTCTA [10] P1 GGGGAATTCGAGCTCTGAAATCAAATC CTGCCTACC EcoRI 1,41 kb P2 AAAGGGCCCCTCGAGTGCACTAGCCAC XhoI ACGTTTCT P3 GGGCTCGAGCAGGGTCAAGGGTCATGT TT XhoI 1,33 kb P4 GGGAAGCTTCCCGCCTCTATCGACAAA TA HindIII P5 GGGAATTCATGCGAAGGTAAGTGCTTC T EcoRI 0,54- 1,82 kb P6 GGACTAGTTGGCTAGGCTCTGACTCG SpeI Tên mồi Trình tự (5’-3’) Enzyme giới hạn Kích thƣớc Tham khảo P5 P7 GGGAATTCATGCGAAGGTAAGTGCTTCT TGTAAGGTGATGTGTGCCAG 1,70- 2,98 kb pyrG-orf-F ATGTCTTCCAAGTCGCAATT 0,9 kb pyrG-orf-R TATTGCGCACCAACACG DsRed- F AACTCGAGCACGTGCTTAAGGATATC ATGGCCTCCTCCGAGG XhoI, PmlI, AflII, EcoRV 730 bp DsRed- R AAGGATCCCCGCGGGAGCTCGATATC CTACAGGAACAGGTGGTGGC EcoRV, SacI, SacII, BamHI GFP-F ATGGTGAGCAAGGGCGAG 720 bp GFP-R TCACTTGTACAGCTCGTCCATGC phyA-F GGGCACGTGATGAAAAAGCTATATAAT GGCCGG PmlI 1,51 kb phyA-R GGGGATCCTCAACTAAAGCACTCTCCC CA BamHI Các thiết bị sử dụng trong nghiên cứu được sử dụng tại Phòng Genomic, Phòng thí nghiệm Trọng điểm Công nghệ Enzyme và Protein, Trường Đại học Khoa học Tự nhiên. Tên thiết bị Hãng sản xuất/ Xuất xứ Tủ cấy vi sinh an toàn cấp 2 Nuaire/Mỹ Máy ly tâm lạnh Eppendorf /Đức Máy ly tâm ống falcon 3K30 Sigma/Mỹ Máy vortex Cyclone/Anh Kính hiển vi quang học CX21 Olympus/Nhật Bản Bể ổn nhiệt Julabo/Đức Tủ nuôi cấy ổn nhiệt Memmert/Đức Tủ sấy Memmert/Đức Máy lắc THZ-103B Trung Quốc Máy PCR MyCycler Bio-Rad/Mỹ Lò vi sóng Panasonic/Nhật Bản Nồi khử trùng ALP/Nhật Bản Bể điện di DNA Bio-Rad/Mỹ Máy soi gel Bio-Rad/Mỹ Máy cô quay chân không Thermo Scientific/Mỹ Máy chuyển genxung điện Bio-Rad/Mỹ Các thiết bị khác 2.1.3. Môi trƣờng sử dụng trong nghiên cứu  Môi trƣờng PDA (potato dextrose agar, Himedia) dùng để nuôi cấy và thu bào tử của các chủng nấm.  Môi trƣờng CD (Czapek-Dox) dùng để nuôi các chủng nấm sợi: 2% sucrose; 0,2% NaNO3; 0,1% KH2PO4; 0,05% MgSO4; 0,05% KCl; 0,05% NaCl; 0,002% FeSO4; 2% agar; pH 5,5. Môi trường CD dùng khi nuôi cấy các chủngA. oryze trợ dưỡng uridine/uracil cần bổ sung thêm 0,1% uridine và 0,1% uracil.  Môi trƣờng LB dùng để nuôi vi khuẩn: 1% peptone; 0,5% cao nấm men; 0,5% NaCl.  Môi trƣờng DPYdùng để nuôi và thu bào tử chủng A. oryzae AUT1-PlD trợ dưỡng uridine/uracil[116]: 2% glucose; 1% peptone; 0,5% cao nấm men; 0,5% KH2PO4; 0,05% MgSO4; 0,1% uridine; 0,1% uracil; pH 5,5.  Môi trƣờng M+ Met dùng để chọn lọc các thể chuyển gen [116]: 0,2% NH4Cl; 0,1% (NH4)2SO4; 0,05% KCl; 0,05% NaCl; 0,1% KH2PO4; 0,05% MgSO4; 0,002%FeSO4;2% glucose;0,15% methionine;pH 5,5.  Môi trƣờng PSMkích thích sinh enzyme phytase[29]: 1% glucose; 0,4% Na-phytate; 0,2% CaCl2; 0,5% NH4NO3; 0,05% KCl; 0,05% MgSO4; 0,001% FeSO4; 2% agar.  Môi trƣờng cảm ứng IM lỏng: 8 ml MES 1M; 80 ml MM salts 2,5x; 0,36 g glucose; 1 ml glycerol; 200 ml nước cất. MM salts 2,5x: 2,05gK2HPO4;1,45 g KH2PO4;0,15g NaCl;0,5 g MgSO4.7H2O;0,1g CaCl2.6H2O;0,5 g (NH4)2SO4;0,0025 gFeSO4.7H2O, 1000 ml H2O  Môi trƣờng cảm ứng IM rắn: 8 ml MES 1M; 80 ml MM salts 2,5x; 0,18 g glucose; 1 ml glycerol; 3g agar; 200 ml nước cất. 2.2. Phương pháp nghiên cứu Các kĩ thuật về sinh học phân tử sử dụng trong nghiên cứu như PCR, nhân dòng gen, tạo vector, xử lý enzyme giới hạn, được thực hiện tham khảotheo cẩm nangMolecular Cloning củatác giả Sambrook, xuất bản năm 1989 [87].Một số phương pháp như tách chiết DNA, tách chiết plasmid, được phát triển bởi Phòng Genomic-Phòng thí nghiệm Trọng điểm Công nghệ Enzym và Protein hoặc sử dụng các kit tách chiết thương mại. 2.2.1. Thu nhận bào tử nấm Các chủng nấm được nuôi trên đĩa môi trườngCzapek-Dox. Với chủngA. oryzaeVS1 trợ dưỡng uridine/uracil cần bổ sung thêm 0,1% uridine và 0,1% uracil vào môi trường nuôi. Chủng AUT1-PlD được nuôi trên đĩa môi trường DPY. Sau khoảng 3-5 ngày nuôi cấy ở 30ºC, nước cất vô trùng được bổ sung lên bề mặt đĩanuôi cấy, dùng que gạt bằng thủy tinh vô trùng gạt nhẹ để bào tử nấm rời khỏi hệ sợi và hòa vào nước. Dùng pipet hút dịch và lọc qua màng Miracloth (Calbiochem, Đức). Dịch lọc được ly tâm 4000 vòng/phút trong 10 phút để thu bào tử. Bào tử được rửa bằng nước cấtvô trùng 2 lần trước khi hòa trở lại vào nước cất vô trùng. Nồng độbào tử được điều chỉnh đến 107 bào tử/mlvàdịch bào tử được bảo quản ở 4ºC. Đối với các chủng nấm trợ dưỡng uridine/uracil, bào tử sau khi thu được cần kiểm tra để tránh nhiễm bằng cách nhỏ 20- 50µl dịch bào tử trên đĩa môi trường tối thiểu Czapek-Dox (CD) và ủ đĩa khoảng 1- 2 ngày ở 30ºC. Nếu hệ sợi nấm không xuất hiện, chứng tỏ bào tử là thuần khiết và đáp ứng được yêu cầu dùng cho chuyển gen. 2.2.2. Tách chiết DNA, RNA và tổng hợp cDNA Tách chiết DNA tổng số: 1 ml bào tử nấm được bổ sung vào bình tam giác 250 ml chứa 100 ml môi trường CD lỏng. Bình được nuôi lắc trong máy lắc tốc độ 200 vòng/phút, ở 30ºC trong 3 ngày. Hệ sợi nấm được thu bằng cách lọc qua màng Miracloth và được thấm khô bằng giấy lọc trước khi chia vào ống eppendorf 2 ml. Khoảng 200 mg sợi nấm được nghiền trong nitơ lỏng thành bột mịn bằng cối chày sứ hoặc được giã trực tiếp trong ống eppendorf sử dụng đũa thủy tinh. Bổ sung 600µl đệm chiết GX (2,5% SDS; 200 mM Tris-HCl pH 8,0; 250 mM NaCl; 25 mM EDTA; 0,2% β-mercaptoethanol) và 0,1 mg proteinase K. Ống được vortex đều sau đó ủ ở nhiệt độ 60- 65ºC trong 15- 30 phút. Thêm vào ống 300 µl natri acetate 3M (pH 5,2)trộn đều và ly tâm ở tốc độ 12000 vòng/phút trong 20 phút ở 4ºC. Hút khoảng 700 µl dịchtrong ở phía trên chứa DNAvà chuyển sang ống eppendorf 1,5 ml. Ống được bổ sung thêm 700 µl isopropanol lạnh, trộn đều sau đó ly tâm ở 12000 vòng/phút trong 20 phút ở 4ºC. Tủa chứa DNA được rửa bằng 500 µl ethanol 70% và được làm khô bằng máy cô quay chân không SpeedVac trước khi hòa vào 50 µl đệm TE 1x (Tris-EDTA, pH 8). Bổ sung 2 µl RNase (10 mg/ml) và ủ ở 60ºC trong 30 phút để loại bỏ RNA. Sản phẩm DNAtổng số được điện di kiểm tra trên gel agarose 1% và được bảo quản ở -20ºC. Tách chiết RNA tổng số: Sợi nấm 2 ngày tuổi được thu bằng cách lọc dịch nuôi qua màng Miracloth và được nghiền thành bột mịn trong nitơ lỏng. Bột sợi nấm nhanh chóng được chia vào ống eppendorf 2 ml (20-50 mg/ống) và đặt trên nước đá. RNA tổng số được chiết bằng kit tinh sạch RNA của hãng ANABIO R&D JSCtheo hướng dẫn của nhà sản xuất. RNA sau khi tinh sạch được xử lý 20 phút ở 37ºC bằng enzyme DNase I để loại bỏ hoàn toàn DNA.DNase I sau đó được bất hoạt ở 75ºC trong 15 phút và mẫu được chuyển ngay lên nước đá. Sản phẩm RNA thu được được kiểm tra bằng PCR để đánh giá mức độ tinh sạch, sử dụng cặp mồi ITS1/ITS4 để khuếch đại đoạn ITS của DNA ribosome. RNA được coi là sạch và không nhiễm DNA hệ gen chỉ khi phản ứng PCR kiểm tra không xuất hiện băng ITS. RNAsau khi tinh sạch được sử dụng ngay cho tổng hợp cDNA hoặc được bảo quản ở -30ºC. Tổng hợp cDNA: RNA tổng số sau khi tinh sạch được sử dụng ngay để tổng hợp cDNA. Một lượng 800-1000ng RNAđược sử dụng cho một phản ứng tổng hợp cDNA với mồi oligo dT và enzyme phiên mã ngược reverse transcriptase. Toàn bộ quy trình được thực hiện với ProtoScript® First Strand cDNA Synthesis Kit của hãng New England Biolabs theo hướng dẫn của nhà sản xuất. Sản phẩm cDNA được sử dụng ngay cho các thí nghiệm tiếp theo hoặc được bảo quản ở -30ºC. 2.2.3. Quan sát hình thái và kiểm tra một số đặc điểm sinh lý sinh hóa Quan sát hình thái các chủng A. oryzae: Các chủng nấm được cấy điểm hoặc nhỏ 10 µl bào tử trên môi trường đĩa thạch PDA hoặc CD đối với các chủng tự nhiên và M+ Met hoặc CD bổ sung thêm uridine/uracil với chủng AUT1-PlD và những chủng trợ dưỡng uridine/uracil. Đĩa nuôi cấy được ở 30ºC-37ºC trong 2-3 ngày. Hình thái bào tử và cuống mang bào tử được quan sát dưới kính hiển vi quang học Olympus hoặc kính hiển vi huỳnh quang Axioplan(Carl Zeiss, Đức). Kiểm tra khả năng mẫn cảm kháng sinh của các chủng A. oryzae: 10 µl dịch bào tử các chủng A. oryzae được nhỏ trên môi trường CD pH7 có bổ sung kháng sinh với các nồng độ 100mg/l, 200 mg/l và 300 mg/l. Đĩa nuôi cấy được đặt ở 30ºC trong 3 ngày để quan sát sự sinh trưởng của nấm. Kiểm tra khả năng sinh enzyme phytase[29]: 10 µl bào tử nấm được nhỏ lên đĩa môi trường PSM. Đĩa nuôi cấy được đặt ở 30ºC trong 3 ngày. Enzyme phytase sẽ phân giải phytate tạo thành vòng trong suốt xung quanh khuẩn lạc. Vòng phân giải càng lớn thì mức độ sinh enzyme và hoạt tính enzyme càng mạnh. Kiểm tra khả năng sinh enzyme amylase[100]:10 µl bào tử nấm được nhỏ lên đĩa môi trường CD+ 1% tinh bột tan (pH 6,5). Sau 3 ngày sinh trưởng ở 30ºC, vòng phân giải tinh bột xung quanh khuẩn lạc nấm được nhận biết bằng cách nhỏ dung dịch thuốc thử lugol. Xác định khả năng sinh độc tố aflatoxin trên môi trường CAM[82]:Các chủngA. oryzae RIB40, A. oryzae VS1, A. flavus NRRL 3357 được nuôi cấy trên môi trường thạch dừa(môi trường CAM)ở 28ºC, trong tối 5 ngày. Quan sát đĩa nuôi cấy dưới ánh sáng cực tím UVA bước sóng 365 nm của máy soi UV để kiểm tra sự phát quang màu xanh lá cây của aflatoxin B1. Môi trường CAM được chuẩn bị như sau: 100 g dừa tươi thái nhỏ đun sôi 15 phút trong 300 ml nước, lọc thu dịch, bổ sung 2% agar, pH 7. 2.2.4. Phân biệt A. oryzae và A. Flavusbằng các kỹ thuật sinh học phân tử Phản ứng PCR sử dụng cặp mồi ITS1/ITS4:Cặp mồi ITS1/ITS4 được sử dụng để khuếch đại vùng ITS (gồm một phần gen 18S rRNA + ITS1 + gen 5,8S rRNA + ITS2 + một phần gen 28S rRNA) của DNA ribosome. Phản ứng PCR cặp mồi này được dùng để kiểm tra chất lượng DNA của A. oryzae và A. flavus trước khi sử dụng cho phản ứng phân biệt với mồi đặc hiệu. Chu trình nhiệt như sau: 94ºC (3 phút); 30 chu kì của 94ºC (30 giây), 58ºC (30 giây), 72ºC (40 giây); 72ºC (5 phút). Sản phẩm PCR được điện di trên gel agarose 0,8% để kiểm tra. Phản ứng PCR sử dụng cặp mồi Aof-ITS-F/ITS4:Mồi Aof-ITS-F được thiết kế dựa trên trình tự ITS1 đặc hiệu chỉ với A. oryzae và A. flavus. Mồi Aof-ITS-F kết hợp với mồi ITS4 được dùng để nhận biết nhóm bao gồm A. oryzae và A. flavus. Chu trình PCR tương tự như PCR sử dụng cặp ITS1/ITS4. Phản ứng PCR sử dụng cặp mồi AFB-F/AFB-R:Sản phẩm PCR có băng đặc trưng và chỉ xuất hiện ở nấm sợi A. flavus mà không xuất hiện ở A. oryzae. Do đó, cặp mồi này được sử dụng để phân biệt hai loài này. Chu trình nhiệt như sau: 94ºC (3 phút); 30 chu kì của 94ºC (30 giây), 58ºC (30 giây), 72ºC (20 giây); 72ºC (5 phút). Sản phẩm PCR được điện di kiểm tra trên gel agarose 1%. Phản ứng PCR đa mồi (multiplex PCR): cũng tương tự như phản ứng PCR thường nhưng được thực hiện với 5 mồi đặc hiệu (ITS1, ITS4, Aof-ITS-F, AFB-F, AFB-R). Các thành phần trong tổng thể tích 10 µl phản ứng bao gồm: 5 µl GoTaq® Mastermix 2X; 0,5 µl mỗi mồi; 100-200 ng DNA tổng số; 2 µl nước cất khử ion. Chu trình nhiệt như sau: 94ºC (3 phút), 30 chu kì của 94ºC (30 giây), 60ºC (30 giây), 72ºC (1 phút 30 giây); 72ºC (10 phút). Sản phẩm PCR được điện di trên gel agarose 1% để kiểm tra. 2.2.5. Tạocác vector nhị thể dùng cho chuyển gen PCR các đoạn DNA: Trình tự các đoạn DNA được lấy từ cơ sở dữ liệu của ngân hàng GenBank, các cặp mồi khuếch đại gen hoặc DNA được thiết kế trên phần mềm Primer3 và được tổng hợp hóa học bởi công ty IDT. Các đoạn DNA được PCR từDNA tổng số hoặc cDNA sử dụng enzyme Phusion® High-Fidelity DNA polymerase của hãng Thermo Scientific. Thành phần trong 25µl hỗn hợp phản ứng như sau: buffer 5x HF 5µl, enzyme Phusion DNA polymerase 1µl, dNTP 1µl, mồi xuôi 1µl, mồi ngược 1µl, DNA khuôn 1µl, nước cất khử ion 15µl. Chu trình nhiệt như sau: 94ºC (3 phút); 35 chu kỳ của 94ºC (30 giây), 50-60ºC (30 giây), 72ºC (30 giây đến 1 phút); 72ºC (7 phút). Sản phẩm PCR được điện di kiểm tra trên gel agarose 1% sau đó được tinh sạch bằng kit tinh sạch DNA của hãng Promega hoặcAnabio R&D JSC theo hướng dẫn của nhà sản xuất. Xử lý vector và đoạn DNA với enzyme giới hạn: Các vector và đoạn DNA được cắt với enzyme giới hạn dạng FastDigest của hãng Thermo Scientific. Quy trình xử lý enzyme theo hướng dẫn của nhà sản xuất. Sản phẩm xử lý enzyme giới hạn được điện di trên gel agarose 0,8%. Đoạn DNA trên gel được cắt và chuyển sang ống eppendorf 1,5ml. Quy trình tinh sạch được thực hiện với kit tinh sạch DNAthương mạitheo sự hướng dẫn của nhà sản xuất. Sản phẩm sau tinh sạch được điện di kiểm tra trên gel agarose 0,8%. Nối đoạn DNA vào plasmid (ligation): Plasmid và đoạn DNAsau khi xử lý enzyme giới hạn và tinh sạch được trộn với tỉ lệ 1:1 theo thể tích, sử dụng enzyme nối T4 DNA ligase của hãng Thermo Scientific. Các thành phần trong 20µl hỗn hợp phản ứng như sau: T4 ligase buffer 10x 2µl, enzyme T4 DNA ligase 1µl, plasmid 4µl, đoạn DNA4µl, nước cất khử ion 9µl. Hỗn hợp phản ứng được ủ ở 4ºC-10ºC qua đêm, sau đó được biến nạp vào vi khuẩn E.coli DH5α bằng phương pháp sốc nhiệt. Quá trình biến nạp như sau: ống chứa tế bào vi khuẩn E. coli DH5α được giữ trên nước đá 5-10 phút cho tới khi rã đông. Hút hỗn hợp laivào ống tế bào khả biến, trộn nhẹ bằng pipet và đặt trên đá 20 phút. Sau đó sốc nhiệt 40 giây ở 42ºC vàđặt trên nước đá 2 phút. Bổ sung 800 µl LB lỏng và ống được lắc 1 giờ ở 37ºC. Tế bào được thu bằng ly tâm ở 8000 vòng/phút trong 20 giây và được trải trên đĩa môi trường chọn lọc LB chứa kháng sinh kanamycin (100 mg/l). Đĩa được ủ ở 37ºC trong 24 giờ. Các khuẩn lạc nhận được từ đĩa chọn lọc được kiểm tra bằng colony-PCR(PCR từ khuẩn lạc) với cặp mồi đặc hiệu cho đoạn DNA. Phản ứng colony-PCR sử dụng GoTaq® Green Master Mix của hãng Promega.Những khuẩn lạc cho kết quả PCR đúng với kích thước của đoạn chèn sẽ được sử dụng để tách chiết plasmid và cắt kiểm tra bằng enzyme giới hạn. Tách plasmid: Khuẩn lạc chọn được cấy vào bình tam giác 100ml chứa 10-20 ml môi trường LB lỏng (1% peptone; 0,5% cao nấm men; 0,5% NaCl) bổ sung thêm kháng sinh kanamycin (100 mg/l). Bình nuôi cấy được lắc qua đêm ở 30- 37ºC.Ly tâm 4ml dịch nuôi ở 12000 vòng/p

Các file đính kèm theo tài liệu này:

  • pdftom_tat_luan_an_nghien_cuu_phat_trien_he_thong_chuyen_gen_ba.pdf
Tài liệu liên quan