Tóm tắt Luận án Tạo dòng hoa huệ (Polianthes Tuberosa L.) đột biến bằng tia gamma (60CO) trong điều kiện In Vitro - Đào Thị Tuyết Thanh

Đánh giá đa dạng di truyền của các giống/dòng

hoa huệ nghiên cứu bằng sự khác biệt vị trí các băng ADN

Phân tích ISSR với mồi UBC 873 cho sản phẩm khuếch đại

23 băng ADN có kích thước phân tử trong khoảng 200 đến 3.000

bp. Cây hoa huệ đột biến với 22 cánh xuất hiện thêm băng ADN ở

hai vị trí 250 bp và 1.000 bp trong khi đó băng ADN mất đi ở vị trí

300; 350; 850; 1.250 và 3.000 bp so với giống hoa huệ gốc có 12

cánh. Đối với dòng hoa huệ đột biến có 36 cánh, băng ADN bị mất

đi ở vị trí 300; 350; 850 và 1.250 bp còn ở các vị trí 1.000 và 2.750

bp lại xuất hiện băng ADN mới so với giống gốc. Với mồi

P23SR1, sự xuất hiện các băng ADN mới ở cả hai dòng hoa huệ

đột biến ở các vị trí 500; 600; 800; 1.750 và 2.000 bp so với giống

gốc. Đồng thời 2 dòng đột biến này cũng có vị trí các băng ADN

khác biệt nhau nên có thể phân biệt với nhau. Hai mồi 3A39 và 808

cũng có sự xuất hiện mới và mất đi băng ADN, nhưng với số lượng

ít hơn chỉ với 1 băng khác biệt so với ĐC (Hình 4.7).

c. Kết quả về mối quan hệ di truyền giữa các giống/dòng

hoa huệ nghiên cứu

Kết quả hệ số tương đồng di truyền về kiểu gen của các

giống/dòng hoa huệ nghiên cứu, dựa trên cơ sở phân tích 4 mồi

ISSR đa hình (Bảng 4.8). Hệ số này biến thiên trong khoảng 0,375

đến 0,786. Trong những kiểu gen nghiên cứu, chỉ số tương đồng

thấp nhất là 0,375 giữa giống hoa huệ gốc 12 cánh và dòng hoa huệ

đột biến có 22 cánh. Vì vậy hai giống/dòng này thể hiện sự khác

biệt lớn về mặt di truyền. Kiểu gen hoa có 6 cánh và dòng đột biến

có 36 cánh cho thấy có mối quan hệ di truyền gần nhau vì có chỉ số

tương đồng cao nhất (0,786).

pdf30 trang | Chia sẻ: trungkhoi17 | Lượt xem: 381 | Lượt tải: 2download
Bạn đang xem trước 20 trang tài liệu Tóm tắt Luận án Tạo dòng hoa huệ (Polianthes Tuberosa L.) đột biến bằng tia gamma (60CO) trong điều kiện In Vitro - Đào Thị Tuyết Thanh, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
trước khi xử lý tia gamma (60Co) Ghi chú: a: mẫu mô sẹo và b: cụm chồi - Môi trường tạo mô sẹo và chồi hoa huệ là môi trường BM bổ sung 1,0 mg/l NAA và 4,0 mg/l BA (Huỳnh Thị Huế Trang và ctv., 2007). 3.2.2. Nội dung 2: Xác định hiệu quả của liều lƣợng tia gamma ( 60 Co) trên hai giống/dòng hoa huệ bằng liều gây chết 50% (LD50) in vitro * Chuẩn bị mô sẹo ở giống hoa huệ đơn và cụm chồi ở giống hoa huệ kép - Cụm mô sẹo hoa huệ có kích thước 1,0 cm2 được cấy vào đĩa petri. Mỗi đĩa petri được đổ 20 ml môi trường cơ bản (không có chất điều hòa sinh trưởng), cấy 10 cụm mô sẹo/đĩa và chuẩn bị ít nhất 60 đĩa có cấy mẫu (Hình 3.3a). - Cụm chồi hoa huệ được cắt lá và rễ (nếu có) có chiều cao trung bình từ 1,0 - 1,2 cm, mỗi cụm có đường kính khoảng 1,0 cm, được cấy vào đĩa petri (Hình 3.3b). 3.2.2.1. Thí nghiệm 1: Ảnh hƣởng của liều lƣợng tia ( 60 Co) gamma đến sự sinh trƣởng và phát triển của cụm mô sẹo ở giống/dòng hoa huệ đơn Thí nghiệm được bố trí theo thể thức hoàn toàn ngẫu nhiên, 1 nhân tố, 10 nghiệm thức, 5 lần lặp lại, mỗi lần lặp lại là một đĩa petri, mỗi đĩa petri cấy 10 cụm mô sẹo trên môi trường BM. a b 6 Nghiệm thức không xử lý chiếu xạ là đối chứng (ĐC). Cụm mô sẹo được chiếu xạ bằng tia gamma (60Co) với suất liều chiếu xạ 1,58 kGy/giờ. Thí nghiệm được bố trí theo Bảng 3.1. Bảng 3.1: Bố trí các liều chiếu xạ và nghiệm thức ở giống hoa huệ đơn Giống Liều chiếu xạ (Gy) ĐC 5 10 15 20 25 30 40 50 60 HĐ NT1 NT2 NT3 NT4 NT5 NT6 NT7 NT8 NT9 NT10 Sau khi xử lý chiếu xạ, các cụm mô sẹo được cấy vào môi trường BM bổ sung 1,0 mg/l NAA và 6,0 mg/l BA (Lê Lý Vũ Vi và ctv., 2014) để tái sinh chồi và nhân chồi, cấy truyền sau mỗi 30 ngày (1 cụm mô sẹo/chồi/túi). * Chỉ tiêu theo dõi: - Tỷ lệ cụm mô sẹo tái sinh thành chồi sau 30 ngày (%). Quan sát các cụm chồi tại thời điểm 150 ngày sau khi xử lý chiếu xạ. - Tỷ lệ chết (%) = (Tổng số chồi chết/Tổng số chồi) x 100. Cụm mô sẹo được xem là chết khi không tái sinh được thành chồi và mất màu xanh hoặc không tạo được chồi mới. - Tính liều gây chết LD50 theo mô tả của Randhawa (2009). - Chiều cao chồi (cm), số chồi/cụm chồi, số lá/cụm chồi. - Cụm chồi bất thường ghi nhận ở lá, rễ, chồi, chùn đọt... 3.2.2.2. Thí nghiệm 2: Ảnh hƣởng của liều lƣợng tia gamma ( 60 Co) đến sự sinh trƣởng và phát triển của cụm chồi ở giống/dòng hoa huệ kép Thí nghiệm này sử dụng cụm chồi của giống hoa huệ kép và bố trí liều chiếu xạ tương tự thí nghiệm 1 (Bảng 3.2). Bảng 3.2: Bố trí các liều chiếu xạ và nghiệm thức ở giống hoa huệ kép Giống Liều chiếu xạ (Gy) ĐC 5 10 15 20 25 30 40 50 60 HK NT1 NT2 NT3 NT4 NT5 NT6 NT7 NT8 NT9 NT10 7 Sau khi xử lý chiếu xạ, các cụm chồi được cấy vào môi trường nhân chồi tương tự như ở thí nghiệm 1, cấy truyền sau mỗi 30 ngày (1 cụm chồi/túi). * Chỉ tiêu theo dõi: - Tỷ lệ chết (%), tính liều gây chết LD50, chiều cao chồi (cm), số chồi, số lá và các dạng cấu trúc bất thường sau 150 ngày: (thực hiện tương tự thí nghiệm 1). Cụm chồi chết khi mất màu xanh hoặc không tạo được chồi mới. 3.2.2.3. Nhân chồi và tạo rễ thành cây hoa huệ hoàn chỉnh - Môi trường nhân chồi vẫn sử dụng môi trường BM bổ sung 1,0 mg/l NAA và 6,0 BA mg/l (Lê Lý Vũ Vi và ctv., 2014), cấy truyền 3 lần, 30 ngày cấy truyền 1 lần, cấy 10 cụm chồi/túi môi trường. - Sau khi nhân khoảng 500 chồi, chuyển sang môi trường tạo rễ là môi trường BM bổ sung 4 ml/l atonik (Lê Lý Vũ Vi và ctv., 2014) trong 60 ngày, 30 ngày cấy truyền 1 lần, cấy 10 chồi/túi môi trường đến khi cây ra rễ. 3.2.3. Nội dung 3: Xác định sự đa dạng về mặt hình thái của cây con giai đoạn thuần dƣỡng trong nhà lƣới - Quy trình thuần dưỡng theo Nguyễn Minh Kiên (2011). * Chỉ tiêu theo dõi sau 30 ngày: Tần số cây bất thường về hình thái (%): dạng sọc lá, lá uốn éo (nếu có) 3.2.4. Nội dung 4: Chọn các dòng hoa huệ tăng về số cánh hoa, kích thƣớc hoa và hoa có mùi thơm theo phƣơng pháp truyền thống 3.2.4.1. Thí nghiệm 3: Khảo sát sự sinh trƣởng và phát triển của giống/dòng hoa huệ đơn sau khi xử lý tia gamma ( 60Co) ở ngoài đồng a. Trồng lần 1 (VĐM1) - Thí nghiệm được bố trí theo thể thức khối hoàn toàn ngẫu nhiên 1 nhân tố, 8 nghiệm thức với 3 lần lặp lại (3 lô) gồm ĐC củ 8 (cây trồng từ củ), ĐC cấy mô (cây trồng từ mẫu cấy mô không chiếu xạ tia gamma) và cây trồng từ mẫu cấy mô được xử lý với các liều tia gamma (60Co) lần lượt là 5; 10; 15; 20; 25 và 30 Gy. Mỗi lô trồng 50 cây, cây trồng từ củ có đường kính củ từ 1,0 - 1,2 cm và cây huệ cấy mô hoặc đã xử lý chiếu xạ tia gamma (60Co) có 3,0 - 6,0 lá, cao 6,0 - 10,0 cm và có 1,0 - 2,0 chồi. Mỗi nghiệm thức đánh dấu 5 điểm, mỗi điểm 3 bụi huệ. - Sơ đồ bố trí lô thí nghiệm thể hiện ở hình 3.4a. Quy trình canh tác giai đoạn ngoài đồng được thực hiện theo Lê Lý Vũ Vi và ctv. (2014). Hình 3.4: Sơ đồ bố trí thí nghiệm ngoài đồng * Chỉ tiêu theo dõi - Tỷ lệ chết của cây sau khi trồng 60 ngày. - Các chỉ tiêu về sinh trưởng ở 180 ngày trồng: Số chồi: đếm các chồi đã có lá bung ra; số lá: đếm số lá/bụi vào thời điểm cây ra hoa; số củ/bụi: đếm số củ/bụi và đường kính củ (cm). - Các chỉ tiêu về hoa: Thời gian ra hoa khi có 25% cây tạo phát hoa (ngày); chiều cao phát hoa (cm); số hoa/phát hoa; đường 9 kính hoa (cm). Ghi nhận dạng bất thường ở lá, thân, hoa và mùi thơm ở hoa (khi có 75% cây có phát hoa). - Cách chọn dòng đột biến mong muốn bằng cách chọn lọc cá thể. Đặt tên: Dòng hoa huệ + Số cánh hoa + Liều chiếu xạ. - Thực hiện đánh giá mùi thơm bằng cảm quan (phương pháp ngửi). Mức độ thơm được đánh giá bởi 10 người rồi lấy điểm trung bình theo quy ước: 0 điểm: không thơm; 1 điểm: thơm bình thường và 2 điểm: thơm nhiều. Nghiệm thức cây trồng từ củ là đối chứng. Mỗi nhóm cây đánh giá 3 phát hoa khi hoa dưới cùng của phát hoa nở hoàn toàn. b. Trồng lần 2 (VĐM2) Nếu chọn lọc được 1 số dòng hoa huệ có tính trạng hoa với số lượng cánh hoa nhiều hơn 12 cánh, hoa to và có mùi thơm tiếp tục trồng lần 2. Nếu không sẽ trồng riêng để nhân củ giống và lưu trữ nguồn củ giống. * Chỉ tiêu theo dõi đến khi có 100% cây ra hoa: - Ghi nhận chỉ tiêu về sinh trưởng, ra hoa, các dạng bất thường ở số lượng cánh hoa (nhiều hơn 12 cánh) và đánh giá mùi thơm tương tự khi trồng lần 1. 3.2.4.2. Thí nghiệm 4: Khảo sát sự sinh trƣởng và phát triển của giống/dòng hoa huệ kép sau khi xử lý tia gamma ( 60 Co) ở ngoài đồng a. Trồng lần 1 (VKM1) Thí nghiệm được bố trí tương tự với giống hoa huệ đơn. Mỗi lô trồng 30 cây. Cây đem trồng có từ 3,0 - 5,0 lá, cao từ 5,0 - 10,0 cm và có 1,0 - 2,0 chồi. Mỗi nghiệm thức đánh dấu 3 điểm, mỗi điểm 3 bụi huệ. - Sơ đồ bố trí thí nghiệm theo hình 3.4b. Quy trình canh tác thực hiện tương tự như thí nghiệm 3 mục 3.2.4.1. * Chỉ tiêu theo dõi: Thực hiện tương tự với Thí nghiệm 3, mục 3.2.4.1a. 10 b. Trồng lần 2 (VKM2): Thực hiện tương tự như ở mục 3.2.4.1b. * Chỉ tiêu theo dõi đến khi có 100% cây ra hoa: Thực hiện tương tự như ở mục 3.2.4.1b. 3.2.4.3. Đánh giá đa dạng ADN ở giống/dòng hoa huệ đột biến a. Đánh giá sự đa dạng di truyền bằng phƣơng pháp đánh dấu phân tử ISSR - PCR Sử dụng 14 mồi ISSR (Mengli et al., 2012; Khandagale et al., 2014) (Bảng 3.3). Bảng 3.3: Danh sách mồi ISSR sử dụng cho nghiên cứu Tên mồi Trình tự (5’- 3’) Tên mồi Trình tự (5’- 3’) 3A01 (GA)8TC 808 (AG)8C 3A07 (AG)7CTT 836 (AG)8YA 3A21 (TG)7ACC 840 (AG)8YT 3A39 (CA)7GTA 842 (AG)8YG 3A42 (GACA)4C 855 (AC)8YT 3A62 (TG)7ACT 857 (AC)8YG UBC873 GACAGACAGACAGACA P23SR1 GGCTGCTTCTAAGCCAAC - Các đoạn ADN khuếch đại là đa hình sẽ được ghi nhận và xác định vị trí các băng ADN xuất hiện mới hoặc mất đi trên 2 dòng huệ đột biến so với băng ĐC (giống hoa huệ 12 cánh) (tính bằng bp). Vẽ sơ đồ hình nhánh bằng phần mềm NTSYSpc v2.1 (Rohlf, 2000). b. Giải trình tự vùng ITS : Sử dụng cặp mồi vi khuẩn với trình tự sau ( White et al., 1990): ITS1: 5’ - TCCGTAGGTGAACCTGCGG - 3’ ITS4: 5’ - TCCTCCGCTTATTGATATGC - 3’ - Kiểm tra đoạn ITS bằng công cụ BLAST (Basic Local Alignmet Search Tool) trên NCBI (National Center for Biotechnology Information) để chắc chắn các trình tự này là từ các 11 loài thuộc chi Polianthes spp. Xếp hàng (alignment) các trình tự để xác định vị trí và các dạng đột biến ADN. Chƣơng 4: KẾT QUẢ VÀ THẢO LUẬN 4.1. Nội dung 1 4.1.1. Tỷ lệ sống khi nuôi cấy đỉnh sinh trƣởng hai giống hoa huệ Sau 30 ngày nuôi cấy, giống hoa huệ đơn có tỷ lệ đỉnh sinh trưởng sống chiếm tỷ lệ 40% trong khi ở giống hoa huệ kép tỷ lệ sống là 60%. 4.1.2. Nhân cụm mô sẹo (callus) và cụm chồi Mẫu đỉnh sinh trưởng còn sống được cấy truyền sang môi trường nhân chồi sau 180 ngày để đủ số lượng mẫu mô sẹo và cụm chồi cho xử lý chiếu xạ tia gamma (60Co). Có sự xuất hiện cùng một lúc mô sẹo và chồi ở hai giống hoa huệ đơn và kép. 4.2. Nội dung 2 4.2.1. Hiệu quả của liều lƣợng tia gamma (60Co) đến sự sinh trƣởng và phát triển của mô sẹo giống/dòng hoa huệ đơn 4.2.1.1. Tỷ lệ tái sinh chồi Ở liều chiếu xạ cao nhất 60 Gy, không có cụm mô sẹo nào tạo được chồi. Dòng hoa huệ ở liều chiếu xạ 50 Gy có tỷ lệ tái sinh chồi thấp nhất 6%. Ngược lại, nghiệm thức ĐC cấy mô không xử lý đột biến cho tỷ lệ tái sinh chồi cao nhất đến 90%. 4.2.1.2. Tỷ lệ chết của cụm mô sẹo/chồi Ở liều chiếu thấp nhất (5 Gy) có 22% cụm mô sẹo/chồi chết. Khi liều chiếu xạ 15 Gy tăng dần đến 50 Gy cho tỷ lệ chết ở mức cao (trên 50%) và ở 60 Gy, tất cả cụm mô sẹo/chồi chết. 12 4.2.1.3. Liều gây chết LD50: Giá trị LD50HĐ của giống hoa huệ đơn là khi xử lý tia gamma 60Co là 10,96 ± 2,96 Gy (Hình 3.1). 4.2.1.4. Số chồi, chiều cao chồi và số lá Ở các liều chiếu xạ 5 và 10 Gy, có số chồi, chiều cao chồi và số lá cao nhất. Ngược lại, nghiệm thức 30 và 40 Gy, sự hình thành chồi và lá mới cũng như chiều cao chồi rất thấp. Liều 50 và 60 Gy, cây không tạo được bất kỳ chồi mới nào (Bảng 4.1). Liều chiếu xạ (Gy) Số chồi Chiều cao chồi (cm) Số lá 0 3,2 b 6,4 a 14,7 b 5 4,2 a 6,2 ab 18,3 a 10 3,5 b 5,9 ab 17,5 a 15 2,5 c 5,4 b 11,0 c 20 1,9 d 3,9 c 7,9 d 25 2,0 cd 3,8 c 3,7 e 30 0,9 e 3,7 c 2,3 ef 40 0,5 e 0,7 d 1,2 fi 50 0,0 f 0,1 d 0,07 i 60 0,0 f 0,0 d 0,0 i F * * * CV (%) 22,9 21,4 26,0 Đường biểu diễn Log(LD50HĐ) Đường biểu diễn Log(LD84HĐ) và Log(LD16HĐ) Bảng 4.1: Số chồi, chiều cao chồi và số lá của giống/dòng hoa huệ đơn đã xử lý tia gamma (60Co) sau 150 ngày nuôi cấy Ghi chú: Các số có chữ số theo sau giống nhau là khác biệt không có ý nghĩa thống kê qua phép thử Duncan; *: khác biệt ở mức ý nghĩa 5%. Hình 4.1: Đồ thị tương quan hồi quy để xác định LD50 của các liều chiếu xạ khác nhau ở giống/dòng hoa huệ đơn sau 150 ngày nuôi cấy Ghi chú: 13 4.2.1.5. Tác động của các liều chiếu xạ tia gamma (60Co) trên các cấu trúc bất thƣờng ở giống/dòng hoa huệ đơn Có 4 kiểu cấu trúc bất thường ở các giống/dòng hoa huệ đơn do ảnh hưởng của các liều gamma khác nhau. ĐC cấy mô có dạng chồi bình thường; ở 5; 10; 15 và 20 Gy, dạng chồi có lá dính nhau, cuộn tròn; chồi 25; 30 và 40 Gy lá co dúm và cuộn tròn; chồi 50 và 60 Gy bị mất sắc tố diệp lục 4.2.2. Hiệu quả của liều lƣợng tia gamma (60Co) đến sự sinh trƣởng và phát triển của cụm chồi giống/dòng hoa huệ kép 4.2.2.1. Tỷ lệ chết của cụm chồi Với các liều chiếu xạ dưới 40 Gy, tỷ lệ chết của các cụm chồi đều dưới 50%. Tỷ lệ này tăng đột biến khi cây được xử lý với liều 50 Gy và đạt tỷ lệ chết 100% ở liều xử lý 60 Gy. 4.2.2.2. Liều gây chết LD50: Giá trị LD50 HK của giống hoa huệ kép là 22,91 Gy ± 4,01 Gy (Hình 4.2). 4.2.2.3. Số chồi, chiều cao chồi và số lá Ở các liều chiếu xạ từ 5; 15 và 25 Gy, số chồi gia tăng theo thời gian ở tất cả các nghiệm thức. Chiều cao chồi đạt giá trị cao nhất ở nghiệm thức 5 và 15 Gy. Nghiệm thức 25 Gy, cây tạo số lá nhiều nhất (khoảng 21 lá). Mặc dù ở liều chiếu xạ gây chết hoàn toàn 60 Gy không cho sự gia tăng số chồi và chiều cao chồi nhưng Đường biểu diễn Log(LD50HK) Đường biểu diễn Log(LD84HK) và Log(LD16HK) Hình 4.2: Đồ thị tương quan hồi quy để xác định LD50 của các liều chiếu xạ khác nhau ở giống/dòng hoa huệ kép sau 150 ngày nuôi cấy Ghi chú: 14 vẫn có sự gia tăng số lá ở các thời điểm nuôi cấy 150 ngày (Bảng 4.2). Bảng 4.2: Số chồi, chiều cao chồi và số lá của giống/dòng hoa huệ kép đã xử lý tia gamma (60Co) sau 150 ngày nuôi cấy Liều chiếu xạ (Gy) Ngày 0 150 Số chồi Chiều cao chồi (cm) Số lá Số chồi Chiều cao chồi (cm) Số lá 0 3,4 1,1 2,2 7,3 a 5,4 b 18,0 b 5 3,4 1,1 2,2 6,9 ab 7,0 a 18,6 ab 10 3,4 1,0 2,2 6,3 bc 6,0 b 20,1 ab 15 3,5 1,1 2,3 6,7 abc 6,6 a 21,7 a 20 3,3 1,1 2,3 6,1 c 6,2 c 10,5 c 25 3,5 1,1 2,2 6,1 c 5,6 b 21,1 a 30 3,4 1,1 2,2 4,8 d 2,7 d 4,6 d 40 3,5 1,1 2,2 4,2 de 2,4 d 9,9 c 50 3,4 1,1 2,1 3,6 ef 1,1 e 4,7 d 60 3,4 1,1 2,1 3,4 f 1,2 e 3,2 d F ns Ns ns * * * CV (%) 6,4 3,6 8,6 10,6 13,3 21,8 Ghi chú: Các số có chữ số theo sau giống nhau là khác biệt không có ý nghĩa thống kê qua phép thử Duncan; *: khác biệt ở mức ý nghĩa 5%. 4.2.2.4. Tác động của các liều chiếu xạ tia gamma (60Co) trên các cấu trúc bất thƣờng ở giống/dòng hoa huệ kép Có 6 kiểu cấu trúc bất thường dưới tác động của các liều bức xạ gamma khác nhau ở giống/dòng hoa huệ kép. ĐC cấy mô và 5 Gy có chồi bình thường; chồi 10 Gy có lá co dúm; chồi 15 Gy có lá mất sắc tố và tạo rễ; chồi 20 Gy với lá có răng cưa và chùn đọt; ở 25 và 40 Gy chồi chùn đọt và mất sắc tố; chồi 30 và 50 Gy có lá cuộn tròn, dính và mất sắc tố và ở 60 Gy cụm chồi hóa nâu. 4.2.3. Nhân chồi và tạo rễ thành cây hoàn chỉnh Ở giống/dòng hoa huệ đơn, giai đoạn nhân chồi trong 90 ngày cho hệ số nhân chồi tốt, chồi xanh, khỏe. Trung bình 1 chồi ban đầu cho trung bình khoảng 4,5 chồi sau 30 ngày nuôi cấy trừ liều chiếu xạ 25 và 30 Gy. 15 Đối với giống/dòng hoa huệ kép, hệ số nhân chồi cao ở các nghiệm thức ĐC cấy mô; 5 và 10 Gy, trung bình 1 chồi ban đầu cho 6,5 chồi. Các nghiệm thức còn lại cho hệ số nhân chồi thấp hơn trung bình 2,5 - 3,5 chồi. Các nghiệm thức 40 và 50 Gy chồi ở cả hai giống sinh trưởng rất yếu và chết dần nên không tạo được cây hoàn chỉnh. Khi chuyển sang môi trường tạo rễ chồi huệ đơn và kép với tỷ lệ ra rễ khoảng 95,0% và 97,0% ở tất cả các nghiệm thức sau 60 ngày nuôi cấy. 4.3. Nội dung 3 4.3.1. Tỷ lệ chết của các giống/dòng hoa huệ đơn Nghiệm thức ĐC củ có số cây con chết ít nhất (3 cây) và ĐC cấy mô có số cây con chết nhiều nhất (30 cây), chiếm tỷ lệ khoảng 10,0%. 4.3.2. Tỷ lệ chết của các giống/dòng huệ kép Ở các giống/dòng hoa huệ kép, số cây chết thấp nhất ở nghiệm thức ĐC củ với tỷ lệ 3,0%. Trái lại, các nghiệm thức ĐC cấy mô và 5 Gy cho số cây chết nhiều nhất (trên 20 cây) chiếm tỷ lệ 8,5 và 7,2%. 4.3.3. Các dạng bất thƣờng về kiểu hình của các giống/dòng hoa huệ đơn và kép Chồi bất thường giai đoạn in vitro đều không tạo được cây hoàn chỉnh do không tạo được rễ và có sức sống rất yếu hoặc cây chết trong quá trình thuần dưỡng. Ở giai đoạn này, cây còn nhỏ nên sự khác biệt về hình thái lá và chồi không nhận thấy rõ ràng. 4.4. Nội dung 4 4.4.1. Các đặc điểm sinh trƣởng và ra hoa ở giống/dòng hoa huệ đơn khi trồng lần 1 (M1) - Tỷ lệ cây chết Sau 60 ngày trồng ngoài đồng, tỷ lệ cây chết của cây hoa huệ đơn gia tăng khi liều chiếu gia tăng. Tuy nhiên, nghiệm thức trồng 16 từ cây cấy mô, nghiệm thức ở liều 5 và 10 Gy có tỷ lệ chết bằng nhau là 4,0%. Liều chiếu xạ 25 và 30 Gy có số lượng cây chết cao nhất chiếm 8,0%. - Số chồi, số lá, số củ và đƣờng kính củ Ở các liều chiếu xạ càng cao thì sự gia tăng số chồi càng ít (trừ nghiệm thức xử lý ở liều 5 Gy). Nghiệm thức ĐC củ cây hoa huệ cho số chồi cao nhất. Số lá của các nghiệm thức có sự chênh lệch khá cao từ 48,9 đến 130,3 lá. Dòng hoa huệ ở liều chiếu xạ 25 Gy tạo được nhiều củ nhất (14,5 củ) so với giống hoa huệ trồng từ củ (13,5 củ). Trong tất cả các giống/dòng hoa huệ được xử lý chiếu xạ, ở liều 25 Gy, cây cho số củ tốt nhất và nghiệm thức ĐC củ và ĐC cấy mô có số lượng chồi và lá vượt trội hơn so với các dòng hoa huệ còn lại. Dòng hoa huệ 15 và 25 Gy có đường kính củ lớn nhất khoảng 4,1 cm (Bảng 4.3). Liều chiếu xạ (Gy) Số chồi Số lá Số củ Đƣờng kính củ (cm) ĐC củ 9,4a 107,8b 13,5ab 3,0d ĐC cấy mô 7,3b 130,3a 13,0b 3,4c 5 5,1 de 89,7 c 11,5 c 3,3 cd 10 7,0 bc 121,0 ab 10,9 c 2,7 e 15 5,6 cd 89,6 c 8,3 d 4,1 a 20 4,2 de 48,9 e 6,4 e 3,1 cd 25 4,7 de 80,9 cd 14,5 a 4,1 a 30 3,8 e 67,0 d 9,5 d 3,7 b F * * * * CV (%) 14,1 9,1 7,1 4,4 - Thời gian ra hoa, chiều cao phát hoa, số hoa/phát hoa và đƣờng kính hoa Các nghiệm thức ĐC củ, nghiệm thức chiếu xạ 10 và 25 Gy có thời gian ra hoa ngắn nhất khoảng 147 ngày. Ngược lại, các dòng hoa huệ từ cây cấy mô, nghiệm thức xử lý các liều 5, 20 và 30 Gy có thời gian ra hoa kéo dài nhất khoảng 175 ngày. Bảng 4.3: Các chỉ tiêu sinh trưởng của các giống/dòng hoa huệ đơn sau 180 ngày trồng Ghi chú: Các số có chữ số theo sau giống nhau là khác biệt không có ý nghĩa thống kê qua phép thử Duncan; *: khác biệt ở mức ý nghĩa 5%. 17 Dòng hoa huệ xử lý với liều 20 và 25 Gy có chiều cao phát hoa lần lượt là 118,0 và 122,7 cm trong khi cây ĐC củ và ĐC cấy mô chỉ cao 91,0 và 103,0 cm. Dòng hoa huệ ở liều 25 Gy có số hoa/phát hoa nhiều nhất (41,3 hoa). Mặc dù, dòng hoa huệ ở liều chiếu xạ 20 Gy có chiều cao phát hoa tốt nhưng hoa đóng thưa hơn nên số hoa ít nhất (28 hoa). Dòng có đường kính hoa to nhất là dòng 25 Gy (3,6 cm). Trái lại, dòng hoa huệ có đường kính hoa thấp nhất khi được chiếu xạ với liều 5 và 30 Gy (1,8 cm và 2,9 cm). Ở dòng hoa huệ với liều 5 Gy có hoa không nở hoàn toàn nên đường kính hoa là nhỏ nhất (Bảng 3.4). Bảng 4.4: Đặc điểm ra hoa của giống/dòng hoa huệ đơn khi ra hoa lần 1 Liều chiếu xạ (Gy) Thời gian ra hoa (ngày) Chiều cao phát hoa (cm) Số hoa/phát hoa Đƣờng kính hoa (cm) ĐC củ 147,7a 91,0d 36,0abc 3,0b ĐC cấy mô 175,3bc 103,0cd 31,3cd 3,0b 5 175,0 bc 107,3 bc 34,0 bcd 1,8 c 10 152,7 a 108,7 bc 36,0 abc 3,5 a 15 162,0 ab 108,0 bc 40,7 ab 3,5 a 20 177,7 bc 118,0 ab 28,0 d 3,1 b 25 155,7 a 122,7 a 41,3 a 3,6 a 30 181,3 c 110,0 bc 30,7 cd 2,9 c F * * * * CV (%) 5,8 6,3 10,7 6,8 Ghi chú: Các số có chữ số theo sau giống nhau là khác biệt không có ý nghĩa thống kê qua phép thử Duncan; *: khác biệt ở mức ý nghĩa 5%. - Các đặc điểm bất thƣờng ở các dòng hoa huệ đơn đƣợc xử lý tia gamma (60Co) + Ở lá: Sau 60 ngày trồng ngoài đồng, có 7 dạng bất thường ở lá các dòng hoa huệ đơn. ĐC củ và ĐC cấy mô có lá bình thường; cây 5 và 20 Gy với lá có sắc tố màu tím; cây 10 Gy với lá dưới cùng có 1 lá nhỏ nằm bên phải và 1 lá lớn hơn nằm bên trái; cây 15 Gy với lá có sọc trắng dọc hai bên mép lá; cây 25 Gy với lá 18 dính 1/3 lá từ thân lá ra chóp lá và lá mọc hai hàng nhưng không đối xứng và cây 30 Gy với lá dưới cùng có 3 lá dưới cùng rất nhỏ, bản lá rộng và dày. + Ở thân và củ: Ở các dòng hoa huệ đơn, có 3 kiểu hình bất thường sau khi xử lý đột biến. Cây 15 Gy với thân có bẹ lá xếp lệch thành hình tia; cây 20 Gy với thân có bẹ lá mọc xếp chồng lên nhau thành 2 bên ngay hàng và cây 25 Gy với cây tạo củ sớm. + Ở hoa: Dòng hoa huệ ở nghiệm thức 5 Gy cho hoa không nở hoàn toàn nên không xác định số cánh hoa trong khi những dòng được xử lý với các liều 15; 25 và 30 Gy xuất hiện hoa với 7 cánh và 8 cánh trên cùng phát hoa với tần số cao (lên đến 75%) (Hình 3.3). - Mùi thơm: Ở các dòng hoa huệ tăng số cánh lên 7 hoặc 8 cánh ở liều 15; 25 và 30 Gy được đánh giá 2 điểm. Dòng hoa huệ với liều xử lý 5 Gy với đặc điểm hoa không nở hoàn toàn được nên mất đi mùi thơm. Ở giống/dòng hoa huệ đơn không có đột biến cánh hoa dạng kép (nhiều hơn 12 cánh) nên những dòng đột biến này được chọn lọc và theo dõi riêng. Ghi chú: a: ĐC củ (hoa có 6 cánh); b: 15 Gy (hoa có 7 và 8 cánh); c: 25 Gy (hoa có 7 và 8 cánh) và d: 30 Gy (hoa có 7 và 8 cánh). 4.4.2. Các đặc điểm sinh trƣởng và ra hoa ở các giống/dòng hoa huệ kép khi trồng lần 1 (M1) - Tỷ lệ cây chết Cây ĐC củ không có cây chết trong khi cây ĐC cấy mô có số cây chết nhiều nhất (8 cây) chiếm tỷ lệ 4%. Nghiệm thức 15 và 25 Gy có số cây chết ít nhất với tỷ lệ (3,3%). Ở liều chiếu xạ 10 Gy và a b c d Hình 4.3: Các dạng hoa huệ đơn với số cánh hoa tăng khi ra hoa lần 1 19 30 Gy cho số cây chết bằng nhau (5 cây), nhưng cho tỷ lệ chết khác nhau. - Số chồi, số lá, số củ và đƣờng kính củ Nghiệm thức ĐC củ và nghiệm thức 25 và 30 Gy chỉ tạo được khoảng 4,0 chồi, trong khi đó số chồi đạt được cao nhất ở các nghiệm thức 0; 5; 10; 15 và 20 Gy (trung bình khoảng 6 chồi). Cây ĐC trồng từ củ và cấy mô có số lá trung bình hơn 29,0 lá thì ở các liều chiếu xạ 5; 10 và 20 Gy có số lá lần lượt là 36,8; 40,5 và 35,9 lá. Ở liều chiếu xạ 25 Gy, cây có số lá ít nhất (chỉ bằng 50% số lá đạt được khi so với cây có số lá cao nhất ở liều 10 Gy). Tuy nhiên, cây ở liều chiếu xạ cao nhất 30 Gy lại cho số lá cao hơn ở cây 15 Gy. Cây ĐC củ và nghiệm thức 5 và 15 Gy có số củ cao nhất (khoảng 14,0 củ) đều cho đường kính nhỏ trung bình khoảng 3,8 cm. Ngược lại, nghiệm thức có số củ ít nhất gồm nghiệm thức ĐC cấy mô; 10; 20 và 30 Gy có số củ ít nhưng cho đường kính củ đạt trung bình khoảng 4,0 cm (Bảng 4.5). Liều chiếu xạ (Gy) Số chồi Số lá Số củ Đƣờng kính củ ĐC củ 3,9b 28,9abcd 13,9ab 3,8ab ĐC cấy mô 5,8a 29,3abcd 9,1d 4,2a 5 6,0 a 36,8 ab 13,0 ab 3,8 ab 10 5,7 a 40,5 a 7,7 d 3,8 ab 15 6,1 a 21,3 cd 14,4 a 3,8 ab 20 6,2 a 35,9 abc 10,7 c 4,1 ab 25 4,3 b 19,3 d 12,4 b 3,6 b 30 3,6 b 23,8 bcd 7,9 d 3,9 ab F * * * * CV (%) 10,4 26,6 8,1 6,6 - Thời gian ra hoa, chiều cao phát hoa, số hoa/phát hoa và đƣờng kính hoa Thời gian ra hoa của nghiệm thức ĐC củ và cây ở liều chiếu xạ 10 Gy là ngắn nhất (156 ngày). Ngược lại, cây xử lý chiếu xạ với liều 15 Gy có thời gian ra hoa kéo dài nhất lên đến 188,7 ngày. Trong khi chiều cao phát hoa ngắn nhất ở cây 30 Gy là 64,3 cm thì Bảng 4.5: Các chỉ tiêu sinh trưởng của các giống/dòng hoa huệ kép sau 180 ngày Ghi chú: Các số có chữ số theo sau giống nhau là khác biệt không có ý nghĩa thống kê qua phép thử Duncan; *: khác biệt ở mức ý nghĩa 5%. 20 chiều cao phát hoa trung bình trong khoảng 82,3 đến 97,7 cm ở nghiệm thức ĐC củ và các liều chiếu xạ 0; 5 và 10 Gy. Ngược lại, chiều cao phát hoa lớn nhất hơn 100 cm ở các nghiệm thức chiếu xạ với liều 15; 20 và 25 Gy. Số hoa ít nhất ở dòng hoa huệ khi xử lý liều chiếu xạ 10 Gy là 38,7 hoa trên phát hoa. Ngược lại, số hoa trên phát hoa nhiều nhất trên nghiệm thức ĐC cấy mô và dòng 5 Gy với trung bình khoảng 52 hoa/phát hoa. Đường kính hoa nhỏ nhất ở nghiệm thức ĐC củ; ĐC cấy mô; 5; 10 và 30 Gy (khoảng 4,0 cm). Các liều chiếu xạ còn lại có đường kính hoa lớn hơn (5,0 cm) (Bảng 4.6). Bảng 4.6: Đặc điểm ra hoa của giống/dòng hoa huệ đơn khi ra hoa lần 1 Liều chiếu xạ (Gy) Thời gian ra hoa (ngày) Chiều cao phát hoa (cm) Số hoa/phát hoa Đƣờng kính hoa (cm) ĐC củ 157,7d 97,7b 37,0b 4,1bc ĐC cấy mô 161,0cd 89,2b 51,7a 4,1bc 5 163,0 cd 90,2 b 52,3 a 4,2 bc 10 156,0 d 82,3 b 38,7 b 3,8 cd 15 188,7 a 102,3 a 48,0 a 5,1 a 20 177,7 ab 106,3 a 45,7 a 5,3 a 25 170,0 bcd 104,7 a 46,0 a 5,2 a 30 175,0 abc 64,3 c 45,3 a 4,4 b F * * * * CV (%) 4,5 17,8 54,6 9,1 Ghi chú: Các số có chữ số theo sau giống nhau là khác biệt không có ý nghĩa thống kê qua phép thử Duncan; *: khác biệt ở mức ý nghĩa 5%. - Các đặc điểm bất thƣờng ở các dòng hoa huệ kép đƣợc xử lý tia gamma (60Co) + Ở lá: Kết quả cho thấy rằng có các dạng bất thường ở hình dạng lá và màu sắc lá. Cây ĐC củ với lá mảnh; cây ĐC cấy mô; 5 và 10 Gy với lá có sắc tố màu tím ở gốc và có lá nhỏ dưới cùng nằm bên phải; cây 10 Gy với lá dưới cùng nhỏ nằm bên phải; cây 15 Gy có lá dính từ chóp lá vào trong; cây 20 Gy với lá có sọc vàng dọc theo chiều dài lá; cây 20 Gy có lá nhỏ dưới cùng nằm bên trái; 21 cây 25 Gy với lá dưới cùng có 2 lá nằm bên phải và cây 30 Gy với lá dưới cùng có 3 lá dưới cùng rất nhỏ, bản lá rộng và dày. + Ở thân và củ: Có tất cả 5 kiểu hình ở thân và củ ở các dòng hoa huệ kép đột biến. ĐC củ với thân có bẹ lá mọc xếp chồng lên nhau thành 2 bên ngay hàng; cây 5 và 10 Gy với thân có bẹ lá mọc xếp chồng lên, nhưng mọc lệch nhau thành hình tia với 4 lá; cây 15 Gy với thân có bẹ lá mọc xếp chồng lên hoặc cây tạo củ sớm, nhưng mọ

Các file đính kèm theo tài liệu này:

  • pdftom_tat_luan_an_tao_dong_hoa_hue_polianthes_tuberosa_l_dot_b.pdf
Tài liệu liên quan