Tóm tắt Luận án Đánh giá đa dạng di truyền và phát triển kỹ thuật chẩn đoán virus lúa lùn sọc đen Phương Nam ở Việt Nam

3.3. PHÁT TRIỂN KỸ THUẬT CHẨN ĐOÁN SRBSDV BẰNG ELISA

Mục tiêu của nội dung nghiên cứu này là tạo kháng thể đặc hiệu

virus và phát triển kỹ thuật chẩn đoán SRBSDV Việt Nam bằng kỹ

thuật E IS . Các định hƣớng tạo kháng thể đa dòng nhƣ: (1) sử

dụng hạt virus tinh chiết từ cây nhiễm bệnh hoặc (2) sử dụng protein

vỏ (dạng đầy đủ hoặc một đoạn peptide) tái tổ hợp.

3.3.1. Tạo kháng thể đa dòng kháng SRBSDV bằng hạt virus tinh chiết

Hạt virus đƣợc tinh chiết từ mẫu lúa lây nhiễm nhân tạo

SRBSDV để gây đáp ứng miễn dịch trên thỏ. Kháng thể IgG tinh

sạch đƣợc kiểm tra bằng PTA-ELISA.

pdf27 trang | Chia sẻ: phuongchi2019 | Ngày: 03/11/2020 | Lượt xem: 48 | Lượt tải: 0download
Bạn đang xem trước 20 trang tài liệu Tóm tắt Luận án Đánh giá đa dạng di truyền và phát triển kỹ thuật chẩn đoán virus lúa lùn sọc đen Phương Nam ở Việt Nam, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
ệt Nam”. 3 2. Mục tiêu nghiên cứu - Đánh giá đa dạng di truyền SRBSDV ở các vùng sinh thái trồng lúa khác nhau của Việt Nam dựa trên kết quả giải trình tự phân đoạn S7, S9 và S10. - Phát triển kỹ thuật chẩn đoán SRBSDV ở Việt Nam bằng kỹ thuật RT-PCR và ELISA. 3. Đối tƣợng và phạm vi nghiên cứu Đối tượng - Các mẫu virus lúa lùn sọc đen Phƣơng Nam ở Việt Nam. - Các mẫu lúa nhiễm bệnh, sạch bệnh và các mẫu rầy nhiễm, sạch virus lúa lùn sọc đen Phƣơng Nam Nội dung - Phân lập, giải trình tự ba phân đoạn S7, S9, S10 của 13 mẫu SRBSDV đại diện cho các vùng sinh thái ở Việt Nam và đánh giá đa dạng di truyền. - Phát triển kỹ thuật chẩn đoán đặc hiệu SRBSDV tại Việt Nam bằng kỹ thuật RT-PCR. - Phát triển kỹ thuật chẩn đoán đặc hiệu SRBSDV tại Việt Nam bằng ELISA. 4. Tính mới của luận án Luận án là công trình đầu tiên ở Việt Nam nghiên cứu chuyên sâu và có hệ thống về đa dạng di truyền virus lúa lùn sọc đen phƣơng Nam và bƣớc đầu chứng minh chủng SRBSDV Việt Nam có quan hệ di truyền gần gũi hơn với mẫu SRBSDV Quảng Đông. Luận án đã phát triển thành công kỹ thuật chẩn đoán SRBSDV bằng RT-PCR cho kết quả chính xác 100% với các mẫu lúa nhiễm bệnh đã biểu hiện rõ triệu chứng và có thể phát hiện sớm mẫu lúa nhiễm bệnh chƣa biểu hiện rõ triệu chứng. 4 Luận án cũng là công trình nghiên cứu đầu tiên tạo thành công kháng thể đa dòng kháng virus lúa lùn sọc đen Phƣơng Nam bằng protein/peptide tái tổ hợp; kháng thể đa dòng có tính đặc hiệu cao, có thể phát hiện virus ở cả mẫu lúa và rầy nhiễm virus. 5. Ý nghĩa khoa học và thực tiễn của đề tài Luận án cung cấp các cơ sở dữ liệu, thông tin khoa học mới về đa dạng di truyền SRBSDV ở Việt Nam, cung cấp tƣ liệu khoa học mới về cơ sở khoa học và khả năng áp dụng các kỹ thuật sinh học phân tử trong chẩn đoán SRBSDV ở Việt Nam Kết quả đánh giá đa dạng di truyền SRBSDV ở Việt Nam làm cơ sở cho nghiên cứu chẩn đoán, diễn biến phát dịch và đề xuất các biện pháp phòng trừ hiệu quả giúp giảm thiểu tổn thất mùa màng cho ngƣời nông dân. Kỹ thuật chẩn đoán SRBSDV bằng RT-PCR có độ chính xác cao, phát hiện đƣợc sự có mặt của virus trong những cây lúa chƣa biểu hiện rõ triệu chứng và chẩn đoán virus bằng ELISA phát hiện nhanh sự có mặt của virus trong mẫu lúa và mẫu rầy nhiễm virus rất có ý nghĩa trong công tác chẩn đoán sớm và chính xác tác nhân gây bệnh. 6. Cấu trúc của luận án Luận án dày 152 trang đánh máy vi tính khổ A4 với 6 bảng số liệu, 49 hình. Luận án gồm 5 phần: Mở đầu 4 trang; Tổng quan tài liệu 34 trang; Vật liệu, nội dung và phƣơng pháp nghiên cứu 22 trang; Kết quả nghiên cứu và thảo luận 71 trang; Kết luận và kiến nghị 02 trang. Đã tham khảo 125 tài liệu bao gồm 23 tài liệu tiếng Việt và 102 tài liệu tiếng Anh. 5 Chƣơng 1. TỔNG QUAN TÀI LIỆU 1.1. CÁC VIRUS HẠI LÚA Virus hại lúa đã có từ lâu và đƣợc xem là bệnh hại nguy hiểm hàng đầu ở cây lúa trên thế giới nói chung và Việt Nam nói riêng. Tuy nhiên phải đến năm 1895 các nhà khoa học Nhật Bản mới nghiên cứu và lần đầu tiên virus gây bệnh lúa vàng lùn (Rice dwarf virus-RDV) đƣợc phát hiện. Tiếp theo, virus lúa lùn sọc đen (RBSDV) đƣợc phát hiện và rất nhiều virus hại lúa khác đƣợc xác định nhƣ virus gây bệnh Tungro (Tungro baccili-form virus-RTBV và Tungro spherical virus-RTSV), vàng lá di động (RTYV- Rice transitory yellow-ing virus), lá khảm đốm chết (RNMV-Rice necrosis mosaic virus), lùn xoắn lá (RRSV-Rice ragged stunt virus), vàng lùn (RGSV- Rice grassy stunt virus), trắng lá lúa (RHBV-Rice hoja blanca virus) Cho tới nay, đã có 16 loại virus gây hại trên lúa đƣợc phát hiện. Các virus phát hiện (vàng lùn, lùn xoắn lá, tungro, lùn sọc đen phƣơng Nam...) ở Việt Nam đều có tầm quan trọng kinh tế và lan truyền qua rầy. Việc chẩn đoán các virus trên lúa thƣờng khó do triệu chứng có thể bị nhầm lẫn do sử dụng thuốc trừ cỏ hoặc các nguyên nhân sinh lý. Phát hiện virus trên rầy buộc phải sử dụng các kỹ thuật chẩn đoán nhƣ E IS hoặc PCR. 1.2. ĐẶC ĐIỂM CÁC FIJIVIRUS THUỘC HỌ REOVIRIDAE Các virus thuộc họ Reoviridae đƣợc đặc trƣng bởi bộ gen RN sợi kép (dsRN ), phân đoạn, bao gồm 9 đến 12 phân tử RNA sợi kép mạch thẳng. Chi Fijivirus có hệ gen phân đoạn gồm 10 phân tử RNA sợi kép, mạch thẳng (S1-S10). Các phân tử RN này có kích thƣớc dao động từ 1,4 kb đến 4,5 kb. 6 1.3. VIRUS LÚA LÙN SỌC ĐEN PHƢƠNG N M Bệnh lúa lùn sọc đen phƣơng nam lần đầu tiên xuất hiện ở tỉnh Quảng Đông, Trung Quốc (2001) và đƣợc xem là một biến chủng của RBSDV. Cây lúa bị nhiễm SRBSDV sinh trƣởng còi cọc, lá xanh đậm, xoăn trắng ở lá, rách mép lá và đặc biệt có những u sáp màu trắng hoặc đen chạy dọc các đƣờng gân ở mặt sau lá, bẹ lá hoặc các đốt thân. Rầy lƣng trắng và một tỷ lệ nhỏ rầy nâu nhỏ là vector truyền SRBSDV. Hệ gen của SRBSDV có chiều dài 29124 bp, gồm 10 phân đoạn RNA sợi đôi, có kích thƣớc từ 1,8 đến 4,5 kb. Trong đó, phân đoạn S7 dài 2176 bp, chứa hai ORF mã hóa hai protein (40,5 kDa và 36,4 kDa); phân đoạn S9 dài 1899 bp, chứa hai ORF mã hóa hai protein (39,9 kDa và 24,2 kDa); phân đoạn S10 dài 1797 bp, chứa một ORF mã hóa protein (62.6 kDa) hình thành lớp vỏ ngoài của phân tử virus. SRBSDV có sự tƣơng đồng về triệu chứng, phổ ký chủ, hình thái học phân tử virus, huyết thanh học với các thành viên khác trong chi Fijivius, đặc biệt là RBSDV. Hai kỹ thuật chẩn đoán SRBSDV phổ biến nhất là thử nghiệm miễn dịch liên kết men (E IS ) và phản ứng trùng hợp chuỗi (RT-PCR). 1.4. VIRUS LÚA LÙN SỌC ĐEN PHƢƠNG N M Ở VIỆT NAM SRBSDV lần đầu tiên xuất hiện vào tháng 8 2009, tại Nghệ An, sau đó lan ra tại 20 tỉnh miền Bắc và Bắc Trung Bộ với diện tích bị hại tới 42.000 ha. Do tính chất nghiêm trọng của SRBSDV, ngoài việc xác định tác nhân gây bệnh, nhiều nghiên cứu về bản chất hệ gen và đa dạng di truyền của SRBSDV ở Việt Nam đƣợc nghiên cứu trong thời gian qua. Năm 2010 và 2011, bệnh có xu hƣớng mở rộng ra nhiều địa bàn trồng lúa khác nhau và có tới 34 tỉnh có diện tích trồng lúa bị bệnh. 7 Chƣơng 2. VẬT LIỆU, NỘI DUNG VÀ PHƢƠNG PHÁP NGHIÊN CỨU 2.1. VẬT LIỆU 2.1.1. Vật liệu thực vật 13 mẫu lúa nhiễm bệnh lúa lùn sọc đen đặc trƣng đƣợc xác định bằng RT-PCR và ELISA và các mẫu lúa nghi nhiễm bệnh thu thập vào vụ xuân và vụ mùa các năm 2009-2012 tại các tỉnh: Thái Bình, Nam Định, Ninh Bình, Sơn a, ào Cai, Nghệ An, Quảng Trị, Huế do phòng Bệnh học phân tử - Viện di truyền Nông nghiệp cung cấp. Các mẫu rầy khỏe, rầy nhiễm SRBSDV; các cây lúa nhiễm SRBSDV, RRSV lây nhiễm nhân tạo đƣợc cung cấp bởi Trung tâm bệnh cây nhiệt đới, Học viện Nông nghiệp Việt Nam. Bảng 2.1. Mẫu lúa nhiễm SRBSDV dùng trong nghiên cứu STT Tên mẫu Giống lúa Thời vụ Địa điểm thu mẫu 1 SonLa-1 Xén cù Vụ xuân 2010 Sơn a 2 SonLa-2 Xén cù Vụ xuân 2010 Sơn a 3 LaoCai -1 Nhị ƣu 838 Vụ xuân 2009 Lào Cai 4 NinhBinh-1 BT7 Vụ mùa 2009 Ninh Bình 5 NinhBinh-2 BT7 Vụ mùa 2010 Ninh Bình 6 ThaiBinh-1 BT7 Vụ mùa 2009 Thái Bình 7 ThaiBinh-2 BT7 Vụ mùa 2010 Thái Bình 8 NamDinh-1 BT7 Vụ mùa 2009 Nam Định 9 NgheAn-1 Xi 23 Vụ mùa 2009 Nghệ An 10 QuangTri-1 Nhị ƣu 986 Vụ xuân 2010 Quảng Trị 11 QuangTri-2 Xi 23 Vụ xuân 2010 Quảng Trị 12 Hue-1 Nhị ƣu 986 Vụ xuân 2010 Huế 13 Hue-2 Nhị ƣu 986 Vụ xuân 2010 Huế 2.1.2. Chủng vi sinh vật Chủng vi khuẩn E. coli DH5α mua của hãng Invitrogen, E.coli 8 Rosetta (DE3) mua của hãng Novogen. 2.1.3. Vector và oligonucleotide Vector pET28a/P10 do phòng Bệnh học phân tử, Viện di truyền Nông nghiệp cung cấp; pET32a mua của hãng Novogen; pGEM-T mạch thẳng có đầu T mua của hãng Promega. Các oligonucleotide sử dụng trong nghiên cứu đặt mua từ hãng Invitrogen và Sigma. 2.2. NỘI DUNG NGHIÊN CỨU - Đánh giá đa dạng di truyền SRBSDV ở Việt Nam. - Phát triển kỹ thuật chẩn đoán SRBSDV ở Việt Nam bằng RT-PCR. - Phát triển kỹ thuật chẩn đoán SRBSDV ở Việt Nam bằng ELISA. 2.3. PHƢƠNG PHÁP NGHIÊN CỨU - Tách chiết, định lƣợng DNA/RNA - Định lƣợng protein bằng bằng phƣơng pháp Bradford. - Thiết kế mồi dựa trên trình tự đƣợc công bố trên GenBank (EU784841.1, EU784843.1, EU784840). - Nhân bản DNA/RNA bằng PCR và RT-PCR. - Nhân dòng và giải trình tự DNA. - Phát triển kỹ thuật chẩn đoán SRBSDV bằng RT-PCR. - Xác định vùng gen mã hóa polypeptide giàu tính kháng nguyên bằng phần mềm Immune Epitope Database Analysis Resource. - Thiết kế vector biểu hiện gen đích trong tế bào vi khuẩn. - Tạo kháng thể đa dòng kháng SRBSDV theo phƣơng pháp Amero (1994) và Regenmortel (1993). - Phƣơng pháp kháng nguyên kháng thể: Kỹ thuật Western blot của Sambrook & Rusel (2001); kỹ thuật Dot-blot của Wang (2012); kỹ thuật PTA-ELISA của Mowat & Dawson (1987). 9 Chƣơng 3. KẾT QUẢ NGHIÊN CỨU VÀ THẢO LUẬN 3.1. NGHIÊN CỨU Đ DẠNG DI TRUYỀN SRBSDV Ở VIỆT NAM Mục tiêu của phần nghiên cứu này là đánh giá đặc điểm phân tử và đa dạng di truyền SRBSDV của Việt Nam dựa trên trình tự 3 phân đoạn S7, S9 và S10 của các mẫu virus thu thập từ các vùng sinh thái trồng lúa Việt Nam. Hình 3.2. Tinh sạch phân đoạn S10, S9 và S7 Ghi chú: Giếng M: thang chuẩn DNA 1 kb; giếng 1: hệ gen SRBSDV; giếng 2: phân đoạn S10; giếng 3: phân đoạn S9; giếng 4: phân đoạn S7. Hệ gen của 13 mẫu SRBSDV đại diện cho các vùng sinh thái trồng lúa đƣợc tách chiết và điện di trên gel agarose. Các băng RN tƣơng ứng với các phân đoạn S7, S9 và S10 đƣợc tinh sạch từ gel agarose. Kết quả điện di cho thấy sản phẩm tinh sạch có kích thƣớc tƣơng ứng với kích thƣớc lý thuyết của các phân đoạn (Hình 3.2). Phân đoạn S7, S9, S10 đƣợc dòng hóa vào vector nhân dòng pGEM-T, giải trình tự và phân tích đa dạng di truyền bằng phần mềm MEGA5. Kết quả giải trình tự cho thấy thấy tất cả các phân đoạn S7, S9 và S10 của 13 mẫu SRBSDV phân lập tại Việt Nam đều có kích thƣớc giống nhau, lần lƣợt là 2176 bp, 1849 bp và 1798 bp. Mức độ tƣơng đồng nucleotide của các mẫu virus Việt Nam với nhau dao động từ 97,6-100% và với các chủng Trung Quốc dao động từ 97,3 - 99,8%. Kết quả so sánh trình tự axit amin trên các khung đọc mở cho 10 thấy chủng SRBSDV Việt Nam có quan hệ di truyền gần gũi hơn với SRBSDV Quảng Đông (Hình 3.10, Hình 3.11, Hình 3.13). Hình 3.10. So sánh trình tự amino acid của protein P9.1 Hình 3.11. So sánh trình tự amino acid của protein P9.2 Hình 3.13. So sánh trình tự amino acid của protein P10 11 Cây phả hệ dựa trên trình tự nucleotide của SRBSDV cho thấy các mẫu Việt Nam và Trung Quốc xuất hiện xen kẽ trên cây phả hệ, chứng tỏ chúng là một quần thể virus gây hại trong một vùng địa lý ở cùng một thời điểm, chƣa hình thành chủng mới. Hình 3.9. Xây dựng cây phả hệ của SRBSDV dựa trên trình tự phân đoạn S7 Ghi chú: Các số trên mỗi nốt là giá trị boostrap tính theo %). Mẫu Việt Nam được chỉ rõ bằng chấm đen. Thanh bar là số thay thế nucleotide. Hình 3.12. Xây dựng cây phả hệ của SRBSDV dựa trên trình tự phân đoạn S9 Ghi chú: Các số trên mỗi nốt là giá trị boostrap tính theo % (1000 lần lặp). Mẫu Việt Nam được chỉ rõ bằng chấm đen. NinhBinh-2 JQ692578.1-VN JN388912.1-TQ ThaiBinh-2 NamDinh Hue-1 EU784841.1-QuangDong-TQ FN563995.1-HaiNam-TQ HQ731498.1-ThuaThienHue HM998850.1-TQ Hue-2 HM585273.1-TQ JQ034354.1-TQ SonLa-1 SonLa-2 NgheAn NinhBinh-1 LaoCai ThaiBinh-1 QuangTri-1 QuangTri-2100 100 80 40 80 100 80 50 100 60 20 2 HQ731500-VN QuangTri-1 EU523359-HaiNam-TQ LaoCai ThaiBinh-2 HM585271-TQ JQ692580.1-ThuaThienHue NinhBinh-2 ThaiBinh-1 SonLa-2 HM998852-TQ JQ773428-TQ QuangTri-2 Hue-1 Hue-2 SonLa-1 NgheAn JQ034356-TQ EU784843-QuangDong-TQ NamDinh NinhBinh-1 100 100 100 100 100 77 55 66 33 33 44 77 44 22 22 33 11 22 12 Hình 3.14. Xây dựng cây phả hệ của SRBSDV dựa trên trình tự phân đoạn S10 Ghi chú: Các số trên mỗi nốt là giá trị boostrap tính theo %). Mẫu Việt Nam được chỉ rõ bằng chấm đen. Thanh bar là số thay thế nucleotide 3.2. NGHIÊN CỨU PHÁT TRIỂN KỸ THUẬT CHẨN ĐOÁN SRBSDV BẰNG RT-PCR Quy trình chẩn đoán đặc hiệu SRBSDV của Việt Nam bằng kỹ thuật RT-PCR đƣợc tối ƣu các yếu tố ảnh hƣởng nhƣ: vị trí lấy mẫu, phƣơng pháp chiết RNA, trình tự mồi, loại phản ứng RT-PCR, điều kiện phản ứng RT-PCR. Phản ứng RT-PCR tối ƣu cho quy trình xét nghiệm SRBSDV có thành phần bao gồm 8,6 µl ddH2O, 0,6 µl mỗi loại mồi (Fw: CACCCCACATCGCGTCATCT, Rv: CCCATTTGAGCAGGAAC TTCAC), 0,5 µl RN khuôn, 1,5 µl đệm 10X, 1,5 µl dNTP 2 mM, 0,2 µl Taq DNA polymerase 5 U/µl; 0,75 µl Reverse transcriptase 4 U/µl, 0,75 µl Ribolock Rnase và chu trình nhiệt là: 42oC - 10 phút, 94 o C - 5 phút, (94 o C - 30 giây, 56 o C - 20 giây, 72 o C - 1,5 phút) x 35 chu kỳ, 72oC - 7 phút, bảo quản ở 4oC. ThaiBinh-2 GQ472845-TQ SonLa-1 LaoCai NinhBinh-1 NinhBinh-2 HM585270-TQ JQ692581.1-ThuaThienHue EU784840-QuangDong-TQ JQ034357-TQ NamDinh HQ731501-VN EU523360-HaiNam-TQ NgheAn SonLa-2 HQ394212-TQ ThaiBinh-1 QuangTri-1 Hue-1 QuangTri-2 Hue-2 100 100 71 100 100 100 100 57 85 100 28 42 57 5 13 Tiến hành thử nghiệm quy trình đã tối ƣu đƣợc đối với 192 mẫu lúa gồm 102 mẫu khô và 90 mẫu tƣơi (Bảng 3.6). Bảng 3.6. Thử nghiệm quy trình chẩn đoán SRBSDV bằng RT-PCR Loại mẫu Dạng bảo quản Tình trạng nhiễm SRBSDV Kết quả chẩn đoán Tƣơi Khô Mồi Actin Mồi đặc hiệu Tỉ lệ phát hiện bệnh Lúa sạch bệnh 10 0 Không 10/10 0/10 0 % Lúa nhiễm RRSV 0 5 Không 5/5 0/5 0 % Lúa thu thập từ vùng dịch, đã giải trình tự gen 0 13 Nhiễm 13/13 13/13 100 % Lúa lây nhiễm nhân tạo biểu hiện bệnh 64 0 Nhiễm 64/64 64/64 100 % Lúa lây nhiễm nhân tạo chƣa biểu hiện bệnh 10 0 Nghi nhiễm 10/10 2/10 20 % Lúa thu thập từ các vùng dịch 6 84 Nghi nhiễm 90/90 79/90 88 % Kết quả thử nghiệm cho thấy quy trình đƣợc xây dựng phát hiện chính xác 100% sự có mặt của SRBSDV trong mẫu bệnh, bao gồm cả mẫu tƣơi và mẫu khô, có thể phát hiện sự có mặt của SRBSDV ở giai đoạn cây chƣa biểu hiện bệnh. 3.3. PHÁT TRIỂN KỸ THUẬT CHẨN ĐOÁN SRBSDV BẰNG ELISA Mục tiêu của nội dung nghiên cứu này là tạo kháng thể đặc hiệu virus và phát triển kỹ thuật chẩn đoán SRBSDV Việt Nam bằng kỹ thuật E IS . Các định hƣớng tạo kháng thể đa dòng nhƣ: (1) sử dụng hạt virus tinh chiết từ cây nhiễm bệnh hoặc (2) sử dụng protein vỏ (dạng đầy đủ hoặc một đoạn peptide) tái tổ hợp. 3.3.1. Tạo kháng thể đa dòng kháng SRBSDV bằng hạt virus tinh chiết Hạt virus đƣợc tinh chiết từ mẫu lúa lây nhiễm nhân tạo SRBSDV để gây đáp ứng miễn dịch trên thỏ. Kháng thể IgG tinh sạch đƣợc kiểm tra bằng PTA-ELISA. Kết quả thu đƣợc cho thấy 14 kháng thể IgG tinh sạch có hiệu giá là 1/200 (Hình 3.30) và phát hiện chính xác sự có mặt của SRBSDV trong mẫu cây bệnh (Hình 3.31). Hình 3.30. Xác định hiệu giá kháng thể IgG bằng PTA- ELISA Ghi chú: Mẫu kháng thể IgG tinh sạch được pha loãng theo tỉ lệ:1/100, 1/200, 1/500, 1/1000, mẫu dịch chiết cây bệnh (cột màu xanh) và cây khỏe (cột màu đỏ). Đồ thị thể hiện ODA405 trung bình 3 lần xét nghiệm. Hình 3.31. Xét nghiệm SRBSDV trong mẫu lúa bệnh Ghi chú: Mẫu dich chiết cây được pha loãng theo tỷ lệ 1/5; 1/10 và 1/20. Kháng thể IgG tinh sạch được pha loãng theo tỉ lệ:1/200, mẫu dịch chiết cây bệnh (cột màu xanh) và cây khỏe (cột màu đỏ). Đồ thị thể hiện giá trị ODA405 trung bình của 3 lần xét nghiệm. 3.3.2. Nghiên cứu tạo kháng thể kháng SRBSDV bằng protein vỏ tái tổ hợp P10 của SRBSDV Chúng tôi tiếp tục nghiên cứu tạo kháng thể đặc hiệu của SRBSDV bằng protein vỏ tái tổ hợp sử dụng vector pET28a/P10. Protein tái tổ hợp đƣợc biểu hiện trong vi khuẩn E. coli Rossetta và tinh sạch bằng cột sắc kí ái lực Ni2+ agarose (Hình 3.33). Protein 15 tái tổ hợp tinh sạch đƣợc sử dụng để gây đáp ứng miễn dịch trên chuột. Kháng thể IgG đƣợc tinh sạch từ kháng huyết thanh (đã kiểm tra đáp ứng miễn dịch) bằng cột sắc ký ái lực Protein A-sepharose (Hình 3.35). Hình 3.33. Tinh sạch protein P10 bằng cột sắc ký ái lực Ni-NTA Ghi chú: (A) Dịch chiết tế bào và các phân đoạn tinh sạch protein được điện di trên gel SDS-PAGE 12%. (B). Protein P10 được phát hiện bằng kháng thể anti-His-tag pha loãng 1: 5000. MK: thang chuẩn protein; giếng 1: Dịch chiết tế bào; giếng 2: dịch không gắn cột; giếng 3,4: phân đoạn rửa cột; giếng 5-8: các phân đoạn đẩy cột bằng imidazol 250 mM. Hình 3.35. Kiểm tra kháng thể IgG tinh sạch Ghi chú: (A) Kháng thể tinh sạch qua cột Protein A-Sepharose được điện di trên gel SDS-PAGE 12%. Giếng Mk: Thang chuẩn protein; giếng 1: phân đoạn rửa giải. (B) Khả năng phát hiện protein P10 của kháng thể IgG tinh sạch pha loãng 1: 2000; Giếng Mk: Thang chuẩn Protein; Giếng 1: Protein P10 tinh sạch; Giếng 2: Dịch chiết vi khuẩn mang pET28a (Đối chứng âm); Giếng 3: Dịch chiết vi khuẩn mang pET28a/P10. 16 Hiệu giá của kháng thể đƣợc xác định kĩ thuật Dot-blot. Kết quả thu đƣợc cho thấy kháng thể IgG sau đƣợc tinh sạch phát hiện đƣợc protein P10 tái tổ hợp ở nồng độ pha loãng 1:6000 (Hình 3.36A cột 2) và SRBSDV trong mẫu dịch chiết lúa và ngô bệnh ở nồng độ pha loãng 1:5000 (Hình 3.36B). Hình 3.36. Xác định hiệu giá kháng thể tinh sạch bằng Dot-blot Ghi chú: (A) Xác định hiệu giá của kháng thể sau tinh sạch được đánh giá bằng protein P10 bằng phương pháp Dot-blot; kháng huyết thanh (cột 1) và kháng thể sau tinh sạch (cột 2) được pha loãng tỉ lệ 1:1000, 1:2000, 1:3000, 1:4000, 1:5000 và 1:6000. (B) Độ đặc hiệu của kháng thể tinh sạch được đánh giá bằng dịch chiết cây lúa và ngô pha loãng theo tỉ lệ 1:50, 1:100 và 1:200; mẫu kháng thể tinh sạch được pha loãng tỉ lệ 1:1000 và 1:5000; (+): dịch chiết cây nhiễm SRBSDV; (-): dịch chiết cây sạch bệnh. Độ đặc hiệu của kháng thể tinh sạch đƣợc tiếp tục xác định bằng kĩ thuật ELISA sử dụng mẫu lúa nhiễm SRBSDV và RRSV. Kết quả cho thấy kháng thể ở nồng độ pha loãng 1:5000 có khả năng nhận biết đặc hiệu SRBSDV trong mẫu lúa nhiễm bệnh lùn sọc đen (Hình 3.37), ngoài ra, kháng thể sau tinh sạch cũng có khả năng phát hiện sớm sự có mặt của SRBSDV trong trong mẫu xét nghiệm có tỉ lệ rầy nhiễm SRBSDV cao hơn 50% (bằng phƣơng pháp lây nhiễm nhân tạo) (Hình 3.38). A B 1: 50 1: 100 1: 200 17 Hình 3.37. Đánh giá độ đặc hiệu của kháng thể bằng ELISA Ghi chú: Mẫu kháng thể IgG tinh sạch được pha loãng tỉ lệ 1/5000 và được kiểm tra bằng ELISA với mẫu dịch chiết cây khỏe (cột màu xanh dương), cây nhiễm SRBSDV (cột màu đỏ) và cây nhiễm RRSV (cột màu xanh lá) pha loãng tỉ lệ 1/10, 1/20, 1/30, 1/40, 1/50 và 1/60. Đồ thị thể hiện giá trị ODA492 trung bình của 3 lần xét nghiệm. Hình 3.38. Đánh giá khả năng phát hiện SRBSDV trong mẫu rầy nhiễm SRBSDV bằng ELISA Ghi chú: Mẫu kháng thể IgG tinh sạch được pha loãng tỉ lệ 1/5000 và được kiểm tra bằng ELISA với mẫu rầy được trộn theo tỉ lệ [số rầy bệnh (B)]:[số rầy khỏe (K)] là 0B:5K, 1B:4K, 2B:3K, 3B:2K, 4B: 1K và 5B:0K. Đồ thị thể hiện giá trị ODA492 trung bình của 3 lần xét nghiệm. (ĐC) đối chứng âm. 3.3.3. Nghiên cứu tạo kháng thể đa dòng SRBSDV bằng polypeptide giàu tính kháng nguyên Mục tiêu của nghiên cứu này là tạo ra kháng thể kháng P10 từ polypeptide giàu tính kháng nguyên nhằm tăng tính đặc hiệu cho xét 18 nghiệm ELISA Đoạn polypeptide giàu tính kháng nguyên trên protein vỏ P10 đƣợc lựa chọn bằng các phần mềm tin sinh. Kết quả phân tích tính ƣa nƣớc, khả năng nằm trên bề mặt và cấu trúc không gian của các vùng polypeptide trên P10 bằng phần mềm IEDB cho thấy 2 vùng polypeptide ở vị trí 259-425 và vị trí 365-557 đƣợc dự đoán là giàu tính kháng nguyên (Hình 3.39 và 3.40) và đảm bảo tính bảo thủ trên tất cả các mẫu SRBSDV đã phân lập ở Việt Nam. A B Hình 3.39. Dự đoán tính kháng nguyên trên protein P10 Ghi chú: Biểu đồ dự đoán tính ưa nước (A) và khả năng nằm trên bề mặt phân tử (B) của các vùng polypeptide trên P10. Vùng màu vàng: vùng polypeptide ưa nước và nằm trên bề mặt phân tử; vùng màu xanh: vùng polypeptide kỵ nước và không nằm trên phân tử. Threshold: giá trị ngưỡng. 19 Hình 3.40. Dự đoán vùng polypeptide có cấu trúc không gian có khả năng tạo epitope Ghi chú: Các vùng polypeptide có cấu trúc không gian có khả năng tạo epitope nằm ở vị trí 1-166 (A), 235-415 (B), 446-557 (C) trên P10. 2 đoạn nucleotide mã hóa chuỗi axit amin ở vị trí 259-425 và 365-557 (đặt tên là P10.1 và P10.2) đƣợc phân lập bằng kỹ thuật PCR (Hình 3.41, giếng 1 và 3). Sản phẩm PCR sau đó đƣợc nhân dòng vào vector pGEM-T. Hình 3.41. Nhân bản đoạn gen P10.1 và P10.2 bằng PCR Ghi chú: Giếng Mk: Thang chuẩn DNA 1 kb; giếng 1 và 2: PCR với cặp mồi S10-P1-Fw/ S10-P1-Rv ; giếng 3 và 4: PCR với cặp mồi S10-P2-Fw/ S10-P2-Rv; giếng 1 và 3: khuôn là pGEM/S10; giếng 2 và 4: Đối chứng âm (khuôn là H2O) Tiếp theo, đoạn gen P10.1 và P10.2 đƣợc cắt và ghép nối vào vector biểu hiện pET32a. Vector tái tổ hợp đƣợc kiểm tra bằng PCR và cắt bằng enzyme giới hạn. Kết quả thu đƣợc trên hình 3.45 cho thấy đoạn gen P10.1 và P10.2 đã đƣợc ghép nối thành công vào vector biểu hiện pET32a. Các vector pET32a/P10.1 và pET32a/P10.2 20 sau đó đƣợc giải trình tự bằng mồi T7. Hình 3.45. Kiểm tra pET32a/P10.1 và pET32a/P10.2 bằng PCR và cắt giới hạn Ghi chú: (A) PCR pET32a/P10.1; giếng 1 và 2: PCR với cặp mồi S10-P1- Fw/S10-P1-Rv; giếng 3 và 4: PCR với cặp mồi T7-Fw/T7-Rv; giếng 1 và 3: đối chứng âm (khuôn là H2O); giếng 2 và 4: khuôn là plasmid. (B) PCR pET32a/P10.2; giếng 1 và 2: PCR với cặp mồi S10-P2-Fw/S10-P2-Rv; giếng 3 và 4: PCR với cặp mồi T7-Fw/T7-Rv; giếng 1 và 3: khuôn là plasmid; giếng 2 và 4:đối chứng âm (khuôn là H2O).(C) Cắt giới hạn plasmid bằng EcoRI/XhoI; giếng 1 và 3: sản phẩm cắt giới hạn; giếng 2 và 4: plasmid nguyên bản; giếng 1 và 2: pET32a/P10.1; giếng 3 và 4: pET32a/ 10.2. iếng : Thang DN chuẩn 1 kb. Hình 3.46. Biểu hiện protein tái tổ hợp P10.1 và P10.2 trong tế bào E. coli Ghi chú: (A) Kết quả điện di dịch chiết tế bào trên SDS-PAGE 12%. (B) Polypeptide P10.1 và P10.2 phát hiện bằng kháng thể anti-His-tag (pha loãng 1: 5000). Giếng M: thang chuẩn protein; giếng 1: dịch chiết tế bào mang pET32a trống; giếng 2: thể tan của dịch chiết tế bào mang pET32a/P10.1; giếng 3: thể cặn của dịch chiết tế bào mang pET32a/P10.1; giếng 4: thể tan của dịch chiết tế bào mang pET32a/P10.2; giếng 5: thể cặn của dịch chiết tế bào mang pET32a/P10.2. 21 Polypeptide tái tổ hợp P10.1 và P10.2 đƣợc biểu hiện trong vi khuẩn E. coli Rossetta (Hình 3.46) và tinh sạch bằng cột sắc kí ái lực Ni 2+ agarose (Hình 3.47). Protein tái tổ hợp tinh sạch đƣợc sử dụng để gây đáp ứng miễn dịch trên chuột. Hình 3.1. Tinh sạch polypeptide P10.1 và P10.2 bằng sắc ký ái lực Ni-NTA Ghi chú: Mẫu protein được điện di trên gel SDS-PAGE 12%. (A) Kết quả tinh sạch polypeptide P10.1; giếng 1-4: dịch rửa cột bằng imidazol 30 mM; giếng 5-14: các phân đoạn đẩy cột bằng imidazol 250m . (B) Kết quả tinh sạch P10.2; giếng 1: dịch chiết tế bào không cảm ứng bằng IPTG; giếng 2: dịch chiết tế bào cảm ứng bằng IPTG; giếng 3: dịch rửa cột; giếng 4: thang chuẩn protein; giếng 5-12: các phân đoạn đẩy cột bằng imidazol 250m Kháng huyết thanh chuột sau 4 tuần tiêm đƣợc kiểm tra khả năng nhận mặt đặc hiệu kháng nguyên bằng kỹ thuật lai thẩm tách miễn dịch. Kết quả thu đƣợc trên hình 3.48 cho thấy kháng thể có mặt trong 2 mẫu kháng huyết thanh chuột ở độ pha loãng 1:2000 đều có khả năng nhận biết đặc hiệu với protein P10 tái tổ hợp tinh sạch cho phép kết luận việc gây kháng thể đa dòng từ polypeptide P10.1 và P10.2 tái tổ hợp trên chuột bạch đã thành công. 22 Hình 3.48. Kiểm tra đáp ứng miễn dịch của kháng huyết thanh Ghi chú: Kháng huyết thanh chuột sau khi tiêm P10.1 (giếng 1) và P10.2 (giếng 2) 4 tuần (pha loãng 1:2000) được kiểm tra bằng lai thẩm tách miễn dịch. Giếng Mk: thang protein chuẩn; giếng 1 và 2: mẫu P10 tinh sạch. Hiệu giá của kháng thể đƣợc xác định bằng kĩ thuật Dot-blot. Kết quả thu đƣợc cho thấy kháng huyết thanh tạo ra từ polypeptide P10.1 ở độ pha loãng 1:7000 (Hình 3.49 hàng 1) và P10.2 ở độ pha loãng 1:6000 (Hình 3.49 hàng 2) có thể phát hiện protein tái tổ hợp P10. Hình 3.49. Xác định hiệu giá của kháng huyết thanh Ghi chú: Hiệu giá của kháng huyết thanh kháng P10.1 (hàng 1) và P10.2 (hàng 2) được đánh giá bằng mẫu protein P10 tinh sạch. Kháng huyết thanh được pha loãng tỉ lệ 1:1000, 1:2000, 1:3000, 1:4000, 1:5000, 1:6000,1:7000 và 1:8000. 23 KẾT LUẬN 1. Đã phân lập và giải trình tự đầy đủ ba phân đoạn S7, S9 và S10 của 13 mẫu SRBSDV đại diện cho các vùng sinh thái khác nhau của Việt Nam với các kích thƣớc lần lƣợt là 2176 bp, 1849 bp và 1798 bp. Mức độ tƣơng đồng nucleotide của các mẫu virus Việt Nam với nhau dao động từ 97,6-100% và với các chủng Trung Quốc dao động từ 97,3 - 99,8%. Cây phả hệ dựa trên trình tự nucleotide cho thấy các mẫu virus Việt Nam và Tr

Các file đính kèm theo tài liệu này:

  • pdfdanh_gia_da_dang_di_truyen_va_phat_trien_ky_thuat_chan_doan_virus_lua_lun_soc_den_phuong_nam_o_viet.pdf
Tài liệu liên quan