Luận án Nghiên cứu tích hợp gen kháng bệnh bạc lá vào một số dòng/giống lúa phục vụ chọn tạo giống

LỜI CAM ĐOAN .i

MỤC LỤC. iii

DANH MỤC CHỮ VIẾT TẮT .vi

DANH MỤC BẢNG. viii

DANH MỤC HÌNH .xi

1. Tính cấp thiết của đề tài .1

2. Mục tiêu nghiên cứu.2

3. Ý nghĩa khoa học và thực tiễn của đề tài .3

4. Đối tượng và phạm vi nghiên cứu.3

5. Những đóng góp mới của đề tài .4

CHưƠNG 1. TỔNG QUAN TÀI LIỆU.5

1.1. Tổng quan về bệnh bạc lá ở lúa .5

1.1.1. Lịch sử phát hiện bệnh .5

1.1.2. Vi khuẩn gây bệnh bạc lá lúa .6

1.1.3. Các chủng sinh lý trên thế giới và ở Việt Nam.7

1.2. Tổng quan về gen kháng và bản chất của gen kháng bệnh bạc lá .10

1.3. Chỉ thị phân tử và vai trò của chỉ thị phân tử trong chọn tạo giống cây trồng.18

1.3.1. Vai trò của chỉ thị phân tử trong chọn tạo giống cây trồng.18

1.3.2. Các chỉ thị phân tử DNA dùng phổ biến trong lai tạo và chọn giống.19

1.3.3. Phương pháp chọn lọc nhờ sự hỗ trợ của chỉ thị phân tử trong chọn tạo giống

lúa (Marker Assisted Selection - MAS).22

1.4. Tình hình nghiên cứu chọn tạo giống lúa kháng bệnh bạc lá .26

1.4.1. Sàng lọc nguồn gen kháng bệnh bạc lá .26

1.4.2. Tình hình nghiên cứu chọn tạo giống lúa kháng bệnh bạc lá trên thế giới.26

1.4.3. Tình hình nghiên cứu chọn tạo giống lúa kháng bệnh bạc lá ở Việt Nam.29

1.5. Tổng quan về gen chất lượng và chỉ thị liên kết với gen chất lượng.33

1.6. Khuynh hướng nghiên cứu quy tụ nhiều gen vào 1 giống lúa .39

CHưƠNG 2. VẬT LIỆU VÀ PHưƠNG PHÁP NGHIÊN CỨU .41iv

2.1. Vật liệu .41

2.1.1. Vật liệu nghiên cứu .41

2.1.2. Các loại hóa chất .43

2.1.3. Máy móc thiết bị sử dụng.44

2.2. Nội dung nghiên cứu.44

2.3. Phương pháp nghiên cứu.45

2.3.1. Phương pháp xác định các gen ứng viên liên quan kháng bệnh bạc lá.45

2.3.2. Phương pháp thiết kế các chỉ thị SSLP.46

2.3.4. Phương pháp PCR.47

2.3.5. Phương pháp đánh giá tính kháng/nhiễm bạc lá bằng lây nhiễm nhân tạo.49

2.3.6.Thí nghiệm đồng ruộng.51

2.3.7. Phương pháp xử lý số liệu.53

CHưƠNG 3. KẾT QUẢ VÀ THẢO LUẬN.54

3.1. Xác định gen kháng bệnh bạc lá và thiết kế mồi nhận diện các gen ứng viên

kháng bệnh bạc lá.54

3.1.1. Xác định và thiết kế mồi nhận diện các gen ứng viên kháng bệnh bạc lá có

trong các giống lúa bản địa của Việt Nam .54

3.1.1.1. Xác định và thiết kế mồi nhận diện các gen ứng viên xa5 .54

3.1.1.2. Xác định và thiết kế mồi nhận diện các gen ứng viên xa13 .60

3.1.2. Xác định các gen kháng bệnh bạc lá có trong các nguồn vật liệu thu thập nhờ

sử dụng các chỉ thị liên kết.64

3.1.2.1. Kiểm tra gen ứng viên xa5 và xa13 ở các dòng/giống thu thập nhờ sử dụng

các cặp mồi thiết kế.64

3.1.2.2. Kiểm tra gen/gen ứng viên Xa4, Xa7 và Xa21 ở các dòng/giống bố mẹ .65

3.2. Đánh giá khả năng kháng/nhiễm bệnh bạc lá của các nguồn vật liệu.69

3.3. Tạo nguồn vật liệu mang đa gen/gen ứng viên kháng bệnh bạc lá .72

3.3.1. Xác định các con lai ở thế hệ BC1F1 mang đa gen/gen ứng viên kháng bệnh

bạc lá .73v

3.3.2. Xác định các con lai ở thế hệ BC2F1 mang đa gen/gen ứng viên kháng bệnh

bạc lá .78

3.3.3. Xác định các con lai ở thế hệ BC3F1 mang đa gen/gen ứng viên kháng bệnh

bạc lá .82

3.3.4. Xác định các cá thể BC3F2 mang đa gen/gen ứng viên kháng bệnh bạc lá và gen

chất lượng (Waxy, BADH2) .86

3.4.1. Đánh giá một số đặc điểm nông sinh học chính và khả năng kháng bệnh bạc

lá (lây nhiễm nhân tạo) của các dòng BC3F3 mang gen ứng viên kháng bệnh bạc lá

có nền di truyền của giống An dân 11 .99

3.4.2. Đánh giá một số đặc điểm nông sinh học chính và khả năng kháng bệnh bạc

lá (lây nhiễm nhân tạo) của các dòng BC3F3 mang gen ứng viên kháng bệnh bạc lá

có nền di truyền của giống DT39.104

3.4.3. Đánh giá một số đặc điểm nông sinh học chính và khả năng kháng bệnh bạc

lá (lây nhiễm nhân tạo) của các dòng BC3F3 mang gen ứng viên kháng bệnh bạc lá

có nền di truyền của giống Thủ Đô 1.111

3.4.4. Đánh giá một số đặc điểm nông sinh học chính và khả năng kháng bệnh bạc

lá (lây nhiễm nhân tạo) của các dòng BC3F3 mang gen kháng bệnh bạc lá có nền di

truyền của giống Bắc thơm số 7.115

3.4.5. Chọn tạo các dòng/giống lúa triển vọng .120

KẾT LUẬN VÀ ĐỀ NGHỊ.128

1. Kết luận .128

2. Đề

 

pdf181 trang | Chia sẻ: trungkhoi17 | Lượt xem: 351 | Lượt tải: 0download
Bạn đang xem trước 20 trang tài liệu Luận án Nghiên cứu tích hợp gen kháng bệnh bạc lá vào một số dòng/giống lúa phục vụ chọn tạo giống, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
ng/gen tham chiếu Nucleotit vùng CDS (%) Nucleotit vùng CDS T(U) C A G 13 Nếp bồ hóng Hải Dƣơng 22,7 25,9 27,1 24,3 321 14 Ba cho Kte 22,7 25,9 27,1 24,3 321 15 Blào sinh sái 22,7 25,9 27,1 24,3 321 16 Tép Thái Bình 22,7 25,9 27,1 24,3 321 17 Hom râu 22,7 25,9 27,1 24,3 321 18 Khấu điển lƣ 22,7 25,9 27,1 24,3 321 19 Chiêm đá 22,7 25,9 27,1 24,3 321 20 Khẩu Liến 22,7 25,9 27,1 24,3 321 21 Xƣơng gà 22,7 25,9 27,1 24,3 321 22 Nàng thơm chợ đào 22,7 25,9 27,1 24,3 321 23 Một bụi đỏ 22,7 25,9 27,1 24,3 321 24 Nàng quớt biển 22,7 25,9 27,1 24,3 321 25 Lúa gốc đỏ 22,7 25,9 27,1 24,3 321 26 OM5629 22,7 25,9 27,1 24,3 321 27 Thơm Lài 22,7 25,9 27,1 24,3 321 28 Tám xoan Hải Hậu 22,7 25,9 27,1 24,3 321 29 Nếp mặn 22,7 25,9 27,1 24,3 321 30 Nàng cờ đỏ 2 22,7 25,9 27,1 24,3 321 31 Nếp lùn 22,7 25,9 27,1 24,3 321 32 Tan Ngần 22,7 25,9 27,1 24,3 321 33 Nếp ông táo 22,7 25,9 27,1 24,3 321 34 OM3536 22,7 25,9 27,1 24,3 321 56 Bảng 3.2. Thống kê số lượng và tỉ lệ (%) axit amin vùng CDS của gen ứng viên xa5 ở một số giống lúa có trình tự tương đồng với gen tham chiếu xa5 đã công bố Axit amin Gen/giống Ala Cys Asp Glu Phe Gly His Ile Lys Leu LOC Os05g01710 4,72 2,83 3,77 9,43 4,72 3,77 1,89 4,72 7,55 10,38 Khấu giáng 4,72 2,83 3,77 9,43 4,72 3,77 1,89 4,72 7,55 10,38 Nếp mèo nƣơng 4,72 2,83 3,77 9,43 4,72 3,77 1,89 4,72 7,55 10,38 Tốc lùn 4,72 2,83 3,77 9,43 4,72 3,77 1,89 4,72 7,55 10,38 IS1.2 4,72 2,83 3,77 9,43 4,72 3,77 1,89 4,72 7,55 10,38 Tẻ Nƣơng 4,72 2,83 3,77 9,43 4,72 3,77 1,89 4,72 7,55 10,38 Ble te lo 4,72 2,83 3,77 9,43 4,72 3,77 1,89 4,72 7,55 10,38 Chiêm nhỡ Bắc Ninh 2 4,72 2,83 3,77 9,43 4,72 3,77 1,89 4,72 7,55 10,38 Khấu mặc buộc 4,72 2,83 3,77 9,43 4,72 3,77 1,89 4,72 7,55 10,38 OM6377 4,72 2,83 3,77 9,43 4,72 3,77 1,89 4,72 7,55 10,38 Coi ba đất 4,72 2,83 3,77 9,43 4,72 3,77 1,89 4,72 7,55 10,38 Chấn thơm 4,72 2,83 3,77 9,43 4,72 3,77 1,89 4,72 7,55 10,38 Nếp bồ hóng Hải Dƣơng 4,72 2,83 3,77 9,43 4,72 3,77 1,89 4,72 7,55 10,38 Ba cho Kte 4,72 2,83 3,77 9,43 4,72 3,77 1,89 4,72 7,55 10,38 Blào sinh sái 4,72 2,83 3,77 9,43 4,72 3,77 1,89 4,72 7,55 10,38 Tép Thái Bình 4,72 2,83 3,77 9,43 4,72 3,77 1,89 4,72 7,55 10,38 Hom râu 4,72 2,83 3,77 9,43 4,72 3,77 1,89 4,72 7,55 10,38 Khấu điển lƣ 4,72 2,83 3,77 9,43 4,72 3,77 1,89 4,72 7,55 10,38 Chiêm đá 4,72 2,83 3,77 9,43 4,72 3,77 1,89 4,72 7,55 10,38 Khẩu Liến 4,72 2,83 3,77 9,43 4,72 3,77 1,89 4,72 7,55 10,38 Xƣơng gà 4,72 2,83 3,77 9,43 4,72 3,77 1,89 4,72 7,55 10,38 Nàng thơm chợ đào 4,72 2,83 3,77 9,43 4,72 3,77 1,89 4,72 7,55 10,38 Một bụi đỏ 4,72 2,83 3,77 9,43 4,72 3,77 1,89 4,72 7,55 10,38 Nàng quớt biển 4,72 2,83 3,77 9,43 4,72 3,77 1,89 4,72 7,55 10,38 Lúa gốc đỏ 4,72 2,83 3,77 9,43 4,72 3,77 1,89 4,72 7,55 10,38 OM5629 4,72 2,83 3,77 9,43 4,72 3,77 1,89 4,72 7,55 10,38 Thơm Lài 4,72 2,83 3,77 9,43 4,72 3,77 1,89 4,72 7,55 10,38 Tám xoan Hải Hậu 4,72 2,83 3,77 9,43 4,72 3,77 1,89 4,72 7,55 10,38 Nếp mặn 4,72 2,83 3,77 9,43 4,72 3,77 1,89 4,72 7,55 10,38 Nàng cờ đỏ 2 4,72 2,83 3,77 9,43 4,72 3,77 1,89 4,72 7,55 10,38 Nếp lùn 4,72 2,83 3,77 9,43 4,72 3,77 1,89 4,72 7,55 10,38 Tan Ngần 4,72 2,83 3,77 9,43 4,72 3,77 1,89 4,72 7,55 10,38 Nếp ông táo 4,72 2,83 3,77 9,43 4,72 3,77 1,89 4,72 7,55 10,38 OM3536 4,72 2,83 3,77 9,43 4,72 3,77 1,89 4,72 7,55 10,38 57 Bảng 3.2. Thống kê số lượng và tỉ lệ (%) axit amin vùng CDS của gen ứng viên xa5 ở một số giống lúa có trình tự tương đồng với gen tham chiếu xa5 đã công bố (tiếp) Axit amin Gen/ giống Met Asn Pro Gln Arg Ser Thr Val Trp Tyr Số lƣợng axit amin LOC Os05g01710 3,77 2,83 0,94 4,72 2,83 9,43 10,38 8,49 0,94 1,89 106 Khâu giáng 3,77 2,83 0,94 4,72 2,83 9,43 10,38 8,49 0,94 1,89 106 Nếp mèo nƣơng 3,77 2,83 0,94 4,72 2,83 9,43 10,38 8,49 0,94 1,89 106 Tốc lùn 3,77 2,83 0,94 4,72 2,83 9,43 10,38 8,49 0,94 1,89 106 IS1.2 3,77 2,83 0,94 4,72 2,83 9,43 10,38 8,49 0,94 1,89 106 Tẻ Nƣơng 3,77 2,83 0,94 4,72 2,83 9,43 10,38 8,49 0,94 1,89 106 Ble te lo 3,77 2,83 0,94 4,72 2,83 9,43 10,38 8,49 0,94 1,89 106 Chiêm nhỡ Bắc Ninh 2 3,77 2,83 0,94 4,72 2,83 9,43 10,38 8,49 0,94 1,89 106 Khấu mặc buộc 3,77 2,83 0,94 4,72 2,83 9,43 10,38 8,49 0,94 1,89 106 OM6377 3,77 2,83 0,94 4,72 2,83 9,43 10,38 8,49 0,94 1,89 106 Coi ba đất 3,77 2,83 0,94 4,72 2,83 9,43 10,38 8,49 0,94 1,89 106 Chấn thơm 3,77 2,83 0,94 4,72 2,83 9,43 10,38 8,49 0,94 1,89 106 Nếp bồ hóng Hải Dƣơng 3,77 2,83 0,94 4,72 2,83 9,43 10,38 8,49 0,94 1,89 106 Ba cho K‟te 3,77 2,83 0,94 4,72 2,83 9,43 10,38 8,49 0,94 1,89 106 Blào sinh sái 3,77 2,83 0,94 4,72 2,83 9,43 10,38 8,49 0,94 1,89 106 Tép Thái Bình 3,77 2,83 0,94 4,72 2,83 9,43 10,38 8,49 0,94 1,89 106 Hom râu 3,77 2,83 0,94 4,72 2,83 9,43 10,38 8,49 0,94 1,89 106 Khấu điển lƣ 3,77 2,83 0,94 4,72 2,83 9,43 10,38 8,49 0,94 1,89 106 Chiêm đá 3,77 2,83 0,94 4,72 2,83 9,43 10,38 8,49 0,94 1,89 106 Khẩu Liến 3,77 2,83 0,94 4,72 2,83 9,43 10,38 8,49 0,94 1,89 106 Xƣơng gà 3,77 2,83 0,94 4,72 2,83 9,43 10,38 8,49 0,94 1,89 106 Nàng thơm chợ đào 3,77 2,83 0,94 4,72 2,83 9,43 10,38 8,49 0,94 1,89 106 Một bụi đỏ 3,77 2,83 0,94 4,72 2,83 9,43 10,38 8,49 0,94 1,89 106 Nàng quớt biển 3,77 2,83 0,94 4,72 2,83 9,43 10,38 8,49 0,94 1,89 106 Lua gốc đỏ 3,77 2,83 0,94 4,72 2,83 9,43 10,38 8,49 0,94 1,89 106 OM5629 3,77 2,83 0,94 4,72 2,83 9,43 10,38 8,49 0,94 1,89 106 Thơm Lài 3,77 2,83 0,94 4,72 2,83 9,43 10,38 8,49 0,94 1,89 106 Tám xoan Hải Hậu 3,77 2,83 0,94 4,72 2,83 9,43 10,38 8,49 0,94 1,89 106 Nếp mặn 3,77 2,83 0,94 4,72 2,83 9,43 10,38 8,49 0,94 1,89 106 Nàng cờ đỏ 2 3,77 2,83 0,94 4,72 2,83 9,43 10,38 8,49 0,94 1,89 106 Nếp lùn 3,77 2,83 0,94 4,72 2,83 9,43 10,38 8,49 0,94 1,89 106 Tan Ngần 3,77 2,83 0,94 4,72 2,83 9,43 10,38 8,49 0,94 1,89 106 Nếp ông táo 3,77 2,83 0,94 4,72 2,83 9,43 10,38 8,49 0,94 1,89 106 OM3536 3,77 2,83 0,94 4,72 2,83 9,43 10,38 8,49 0,94 1,89 106 58 Hình 3.1. Trình tự một đoạn gen ứng viên kháng bệnh bạc lá xa5 của một số giống lúa bản địa (đoạn mất 35 nucleotit) Hình 3.2. Sơ đồ thiết kế cặp mồi xa5add35 Kết quả tầm soát và so sánh trình tự locus xa5 ở một số giống lúa bản địa có trình tự tƣơng đồng với gen kháng bệnh bạc lá LOC_Os05g01710 bằng các phần mềm chuyên dụng cho thấy: tần số xuất hiện các đa hình đơn nucleotit (SNP) và các GGCTGTTTTGCATGCAGTGGCTAGAGAGAGTTCTC GGCTGTTTTGCATGCAGTGGCTAGAGAGAGTTCTC Cặp mồi xa5add35 khuếch đại vùng này Mồi 1 179 bp 144 bp 59 đoạn thêm, bớt (InDels) giữa các giống khá cao. Đặc biệt, có một đoạn trình tự mất 35 nucleotit đã đƣợc tìm thấy ở một số giống bản địa của Việt Nam không giống nhƣ gen kháng bệnh bạc lá xa5 đã đƣợc công bố (hình 3.1). Dựa vào sự sai khác về trình tự đoạn gen kháng bệnh bạc lá giữa các giống lúa, cặp mồi đặt tên là xa5add35 (có trình tự: xa5add35F: tagtggcatgggaaatatgg và xa5add35R: taggagaaactagccgtcca) đã đƣợc thiết kế nhờ sử dụng phần mềm thiết kế mồi Primer 3.0. Theo tính toán, cặp mồi này có thể khuếch đại đoạn gen với kích thƣớc 179 bp ở các giống có gen ứng viên kháng giống với công bố của thế giới và 144bp ở các giống có trình tự sai khác với đoạn trình tự gen xa5 kháng bệnh bạc lá (hình 3.2). Sử dụng cặp mồi thiết kế xa5add35F/xa5add35R để kiểm tra sự đa hình của locus gen kháng xa5 với các giống lúa trong tập đoàn lúa bản địa nghiên cứu, kết quả điện di sản phẩm PCR chỉ ra ở hình 3.3. Dựa vào sự xuất hiện của các băng có kích thƣớc 179bp và 144bp cho thấy: trong số 36 giống đã giải trình tự hệ gen thì có 19 giống lúa nghiên cứu xuất hiện băng kích thƣớc 179 bp, có nghĩa là mang gen ứng viên xa5 ở trạng thái đồng hợp kháng (đó là các giống: Tẻ Nƣơng, Ble te lo, Chiêm nhỡ Bắc Ninh 2, Khấu mặc buộc, OM6377, Chấn thơm, Khâu giáng, Coi ba đất, Nếp bồ hóng Hải Dƣơng, Ba cho K‟te, Blào sinh sái, Tép Thái Bình, Khấu điển lƣ, Nếp mèo nƣơng, Tốc lùn, Hom râu, Khẩu Liến, Chiêm đá và IS1.2). Đây là những giống có số lƣợng nucleotit vùng CDS đúng bằng gen tham chiếu xa5 đã công bố. Có duy nhất giống Tám xoan Bắc Ninh mang gen ứng viên xa5 ở trạng thái dị hợp (xuất hiện 2 băng kích thƣớc 179bp và 144bp). Mặc dù giống Tám xoan Bắc Ninh không có đủ số nucleotit vùng CDS so với gen tham chiếu đã công bố nhƣng lại có cả đoạn trình tự 179bp và 144bp tƣơng ứng bổ sung với cặp mồi xa5add35F/xa5add35R đã thiết kế. Mƣời bốn giống (Xƣơng gà, Nàng thơm chợ đào, Một bụi đỏ, Nàng quớt biển, Lúa gốc đỏ, OM5629, Thơm Lài, Tám xoan Hải Hậu, Nếp mặn, Nàng cờ đỏ 2, Nếp lùn, Tan Ngần, Nếp ông táo và OM3536) có số lƣợng nucleotit vùng CDS tƣơng đồng với gen kháng bệnh bạc lá xa5 đã công bố nhƣng khi kiểm tra bằng cặp mồi 60 xa5add35F/xa5add35R thì không có sự xuất hiện của băng kích thƣớc 179bp, điều này có thể giải thích là do sự sai khác ở vùng không dịch mã (non-coding region). Hình 3.3. Ảnh điện di sản phẩm PCR xác định gen ứng viên xa5 ở các dòng/giống lúa bản địa sử dụng cặp mồi xa5add35 Số 1-36: Các giống lúa bản địa ở bảng 2.1; M: O'RangeRuler 20bp DNA Ladder 3.1.1.2. Xác định và thiết kế mồi nhận diện các gen ứng viên xa13 Kết quả tầm soát trình tự vùng CDS (Coding DNA Sequence) và thành phần axit amin của gen ứng viên xa13 và so sánh với locus gen kháng bệnh bạc lá xa13 với mã hiệu là LOC_Os08g42350 (Xanthomonas oryzae PV. Oryzae Resistance 13) (Rice Genome Annotation Project release 5.6) đã thu nhận đƣợc 8 giống có số lƣợng nucleotit vùng CDS đúng bằng với số lƣợng nucleotit của gen kháng bệnh bạc lá xa13 LOC Os08g42350 đã công bố (924 nucleotit) (bảng 3.3). Kết quả phân tích thành phần axit amin cho thấy: các vùng CDS của 8 giống đều mã hóa các axit amin, số lƣợng axit amin đúng bằng với số lƣợng axit amin của gen kháng bệnh bạc lá xa13 đã công bố (307 axit amin). Đặc biệt, trong số 8 giống trên thì có 2 giống là Chấn thơm và Hom râu có tỷ lệ nucleotit và thành phần axit amin giống hệt với gen kháng bệnh bạc lá xa13 đã công bố. Sáu giống còn lại giống về thành phần axit amin nhƣng lại có tỷ lệ T(U) và C khác với gen tham chiếu (bảng 3.3 và 3.4). 61 Bảng 3.3. Thống kê số lượng và tỉ lệ nucleotit vùng CDS (Coding DNA Sequence) của gen ứng viên xa13 ở một số giống lúa có trình tự tương đồng với gen tham chiếu xa13 đã công bố TT Tên giống lúa và gen tham chiếu Nucleotit vùng CDS (%) Nucleotit vùng CDS T(U) C A G 1 LOC Os08g42350 20,0 37,2 14,9 27,8 924 2 Xƣơng gà 20,1 37,1 14,9 27,8 924 3 Nếp bồ hóng Hải Dƣơng 20,1 37,1 14,9 27,8 924 4 Nàng quớt biển 20,1 37,1 14,9 27,8 924 5 Chiêm đỏ 20,1 37,1 14,9 27,8 924 6 Một bụi đỏ 20,1 37,1 14,9 27,8 924 7 Chấn thơm 20,0 37,2 14,9 27,8 924 8 OM5629 20,1 37,1 14,9 27,8 924 9 Hom râu 20,0 37,2 14,9 27,8 924 Hình 3.4. Trình tự một đoạn gen ứng viên kháng bệnh bạc lá xa13 của một số giống lúa bản địa (đoạn mất 4 nucleotit) Kết quả tầm soát và so sánh trình tự locus xa13 ở một số giống lúa bản địa có trình tự tƣơng đồng với gen kháng bệnh bạc lá LOC_Os08g42350 bằng các phần mềm chuyên dụng cho thấy: tần xuất hiện các đa hình đơn nucleotit (SNP) và các đoạn thêm, bớt (InDels) giữa các giống với gen kháng bệnh bạc lá xa13 LOC_Os08g42350 và giữa các giống với nhau. Dựa vào sự sai khác ở đoạn trình tự nằm trong gen (mất 4 nucleotit) đã đƣợc tìm thấy ở một số giống lúa bản địa của Việt Nam so với trình tự gen xa13 đã công bố (hình 3.4), cặp mồi chức năng đặt tên TCAG 62 là xa13add4 (có trình tự: xa13add4F: tcactcactcactcactcaa và xa13add4R: cattagcagctagttaacttac) đã đƣợc thiết kế nhờ sử dụng phần mềm thiết kế mồi Primer 3.0, có thể khuếch đại đoạn gen với kích thƣớc khác nhau ở các giống khác nhau (hình 3.5). Bảng 3.4. Thống kê số lượng và tỉ lệ (%) axit amin vùng CDS của gen ứng viên xa13 ở một số giống lúa có trình tự tương đồng với gen tham chiếu xa13 đã công bố Gen xa13/ giống Axit amin LOC Os08g 42350 Xƣơng gà Nếp bồ hóng HD Nàng quớt biển Chiêm đỏ Một bụi đỏ Chấn thơm OM 5629 Hom râu Ala 13,68 13,68 13,68 13,68 13,68 13,68 13,68 13,68 13,68 Cys 1,63 1,63 1,63 1,63 1,63 1,63 1,63 1,63 1,63 Asp 1,63 1,63 1,63 1,63 1,63 1,63 1,63 1,63 1,63 Glu 2,61 2,61 2,61 2,61 2,61 2,61 2,61 2,61 2,61 Phe 7,17 7,17 7,17 7,17 7,17 7,17 7,17 7,17 7,17 Gly 5,54 5,54 5,54 5,54 5,54 5,54 5,54 5,54 5,54 His 0,98 0,98 0,98 0,98 0,98 0,98 0,98 0,98 0,98 Ile 5,54 5,54 5,54 5,54 5,54 5,54 5,54 5,54 5,54 Lys 4,56 4,56 4,56 4,56 4,56 4,56 4,56 4,56 4,56 Leu 11,07 11,07 11,07 11,07 11,07 11,07 11,07 11,07 11,07 Met 2,28 2,28 2,28 2,28 2,28 2,28 2,28 2,28 2,28 Asn 2,28 2,28 2,28 2,28 2,28 2,28 2,28 2,28 2,28 Pro 5,86 5,86 5,86 5,86 5,86 5,86 5,86 5,86 5,86 Gln 1,95 1,95 1,95 1,95 1,95 1,95 1,95 1,95 1,95 Arg 2,61 2,61 2,61 2,61 2,61 2,61 2,61 2,61 2,61 Ser 7,17 7,17 7,17 7,17 7,17 7,17 7,17 7,17 7,17 Thr 5,86 5,86 5,86 5,86 5,86 5,86 5,86 5,86 5,86 Val 12,37 12,37 12,37 12,37 12,37 12,37 12,37 12,37 12,37 Trp 0,98 0,98 0,98 0,98 0,98 0,98 0,98 0,98 0,98 Tyr 4,23 4,23 4,23 4,23 4,23 4,23 4,23 4,23 4,23 Số lƣợng axit amin 307 307 307 307 307 307 307 307 307 63 Theo tính toán thiết kế và so sánh với gen tham chiếu của thế giới đã công bố, cặp mồi xa13add4F/xa13add4R sẽ nhân lên băng kích thƣớc 97 bp (ở các giống mang gen ứng viên xa13 giống với trình tự thế giới công bố) và băng 93bp (ở các giống mang gen ứng viên xa13 khác với trình tự gen xa13 thế giới công bố). Kết quả kiểm tra sản phẩm PCR với cặp mồi xa13add4F/xa13add4R của cả 36 giống lúa nghiên cứu cho thấy có 8 giống lúa: Tám xoan Bắc Ninh, Tám xoan Hải Hậu, Coi ba đất, Nếp bồ hóng Hải Dƣơng, Tan ngần, Khấu điển lƣ, Hom râu, Khẩu liến có sự xuất hiện của băng kích thƣớc 97bp ở trạng thái đồng hợp, các giống còn lại xuất hiện băng có kích thƣớc là 93bp đúng với các tính toán ban đầu. Trong đó, 2 giống là Hom râu và Nếp bồ hóng Hải Dƣơng xuất hiện băng kích thƣớc 97bp, có số lƣợng nucleotit giống với gen kháng bệnh bạc lá xa13 (LOC Os08g42350) đã công bố. Sáu giống (Xƣơng gà, Nàng quớt biển, Chiêm đỏ, Một bụi đỏ, Chấn thơm, OM5629) có số lƣợng nucleotit vùng CDS tƣơng đồng với gen kháng bệnh bạc lá xa13 (LOC Os08g42350) đã công bố nhƣng khi kiểm tra bằng cặp mồi xa13add4F/xa13add4R thì không có sự xuất hiện của băng kích thƣớc 97 TCAG Cặp mồi xa13add4 khuếch đại vùng này Mồi 1 97 bp 93 bp Hình 3.5. Sơ đồ thiết kế cặp mồi xa13add4 64 bp, điều này có thể giải thích là do sự sai khác ở vùng không dịch mã (non-coding region). Ngƣợc lại, một số giống mặc dù không có đủ số nucleotit vùng CDS so với gen tham chiếu đã công bố nhƣng lại có đoạn trình tự 97bp tƣơng ứng bổ sung với cặp mồi xa13add4F/xa13add4R đã thiết kế. Hình 3.6. Ảnh điện di sản phẩm PCR xác định gen ứng viên xa13 ở các giống lúa bản địa của Việt Nam sử dụng cặp mồi xa13add4 Số 1-36: Các giống lúa bản địa ở bảng 2.1; M: O'RangeRuler 20bp DNA Ladder Nhƣ vậy, cặp mồi này có thể xác định đƣợc sự đa hình của gen ứng viên xa13 và có thể sử dụng để xác định sự có mặt của các gen ứng viên xa13 ở các thế hệ bố, mẹ và con lai phục vụ công tác nghiên cứu đánh giá khả năng kháng bệnh bạc lá của các gen ứng viên xa13 có trong các giống lúa bản địa của Việt Nam và phục vụ cho công tác chọn tạo giống lúa kháng bệnh bạc lá. 3.1.2. Xác định các gen kháng bệnh bạc lá có trong các nguồn vật liệu thu thập nhờ sử dụng các chỉ thị liên kết Ở đây, trong thí nghiệm này, 2 chỉ thị SSLP đã thiết kế là cặp mồi xa5dd35 và xa13add4 đƣợc sử dụng để nhận biết gen ứng viên xa5 và xa13. Đồng thời, các chỉ thị STS với 3 cặp mồi MP1/2, P3 và pTA248 (Ma et al., 1999, Taura et al., 2004, Ronald et al., 1992) cũng đƣợc sử dụng để nhận biết gen Xa4, Xa7 và Xa21 tƣơng ứng. 3.1.2.1. Kiểm tra gen ứng viên xa5 và xa13 ở các dòng/giống thu thập nhờ sử dụng các cặp mồi thiết kế Sử dụng 2 cặp mồi thiết kế xa5add35 và xa13add4 kiểm tra 14 dòng/giống lúa ƣu tú, kết quả kiểm tra gen ứng viên xa5 ở 14 dòng/giống ƣu tú cho thấy có 02 65 giống là QJ4 và BC15 có sự xuất hiện của băng kích thƣớc 179 bp tƣơng tự nhƣ giống IRBB5 (đối chứng dƣơng). Đối với gen ứng viên xa13, kết quả kiểm tra với 14 dòng/giống lúa ƣu tú cho thấy không có sự xuất hiện của băng kích thƣớc 97 bp, có nghĩa là các dòng/giống này không mang gen ứng viên xa13. Hình 3.7. Ảnh điện di sản phẩm PCR xác định gen ứng viên xa5 (a) và xa13 (b) ở các dòng/giống lúa ưu tú sử dụng cặp mồi xa5add35 và xa13add4 tương ứng Số 1-14: Các dòng/giống lúa ưu tú: QJ4, BQ, QP5, NPT3, Thủ đô 1, Bắc thơm kháng bệnh bạc lá, Bắc thơm số 7, BC15, Khang dân 28, Thiên ưu, RVT, DT39, Hương cốm, An dân 11; (+): IRBB5(a), IRBB13(b); (-): IR24; M: O'RangeRuler 20bp DNA Ladder Nhƣ vậy, từ 2 cặp mồi thiết kế chúng tôi đã xác định đƣợc 02 giống QJ4 và BC15 mang gen ứng viên xa5. 3.1.2.2. Kiểm tra gen/gen ứng viên Xa4, Xa7 và Xa21 ở các dòng/giống bố mẹ Trong nghiên cứu này, các chỉ thị STS (Sequence Tagged Site - vị trí đƣợc đánh dấu bởi trình tự) đó là MP1-2, P3 và pTA248 đã đƣợc sử dụng để xác định các gen Xa4, Xa7 và Xa21 tƣơng ứng có trong các dòng/giống nghiên cứu. Đây là chỉ thị cho phép xác định những vị trí đƣợc đánh dấu bằng cách sử dụng các trình tự nucleotit đã biết trƣớc của ADN trong hệ gen. STS là chỉ thị nhân bản trực tiếp những locus đã biết bằng việc sử dụng cặp mồi PCR đƣợc thiết kế, theo trình tự đoạn đầu và đoạn cuối của những locus đặc trƣng này. A B (a) (b) 66 Hình 3.8. Ảnh điện di sản phẩm PCR xác định gen ứng viên Xa7 ở các dòng/giống lúa ưu tú (a) và giống lúa bản địa (b) với cặp mồi P3 Số 1-14 (a): Các dòng/giống lúa ưu tú: : QJ4, BQ, QP5, NPT3, Thủ đô 1, Bắc thơm kháng bệnh bạc lá, Bắc thơm số 7, BC15, Khang dân 28, Thiên ưu, RVT, DT39, Hương cốm, An dân 11; (+): IRBB7 (b) và IRBB62 (a); (-): IR24; M: O'RangeRuler 20bp DNA Ladder, M100: 100 bp DNA Ladder Cặp mồi MP1-2 dùng để xác định gen Xa4 đã đƣợc thiết kế bởi Ma và cộng sự (1999). Gần đây, cặp mồi này đã đƣợc các nhà chọn tạo giống ứng dụng để sàng lọc nguồn gen kháng và lai tạo (Arif A. et al., 2008; Ullah et al., 2012; Suh et al., 2013; Sabar S. et al., 2016). Kết quả kiểm tra gen Xa4 ở 36 giống lúa bản địa và 1 số dòng/giống lúa ƣu tú thu đƣợc cho thấy: Các giống Thơm Lài, Nếp mặn, Một bụi đỏ, Nàng Cờ đỏ 2, Chấn thơm, Nếp ông táo, OM3536, IS1.2, Bắc thơm kháng bệnh bạc lá, Thiên ƣu và RVT mang gen ứng viên Xa4 đồng hợp tƣơng tự nhƣ giống IRBB4 (đối chứng dƣơng) (phụ lục 2). B (b) A (a) 67 300bp Đối với gen Xa7 thì nhiều tác giả đã sử dụng chỉ thị P3, M5, RM5509 để nhận dạng gen này (Taura et al., 2004; Porter et al., 2004; Lã Vĩnh Hoa và cs, 2010; Vũ Hồng Quảng và cs, 2011). Trong nghiên cứu này, chỉ thị P3 đã đƣợc sử dụng để nhận biết gen kháng Xa7 ở các dòng/giống lúa nghiên cứu. Kết quả điện di cho thấy: giống Lúa ngoi, Ble te lo, Kháu mặc buộc, Chấn thơm, Coi ba đất, Ba cho K‟ te, Blào sinh sái, Khấu điển lƣ, Nếp mèo nƣơng, Hom râu, QJ4 và BQ có đoạn kích thƣớc 300 bp giống nhƣ mẫu đối chứng dƣơng (IRBB7). Hình 3.9. Ảnh điện di sản phẩm PCR xác định gen ứng viên Xa21 ở các dòng/giống lúa nghiên cứu sử dụng cặp mồi pTA248 Số 1-14 (a): Các dòng/giống lúa ưu tú: : QJ4, BQ, QP5, NPT3, Thủ đô 1, Bắc thơm kháng bệnh bạc lá, Bắc thơm số 7, BC15, Khang dân 28, Thiên ưu, RVT, DT39, Hương cốm, An dân 11; Số 1-36 (b): Các giống lúa bản địa ở bảng 2.1; (+): IRBB62; (-): IR24; M: 100bp DNA Ladder (a) (b) 68 Bảng 3.5. Bảng tổng hợp các dòng/giống mang gen ứng viên kháng bệnh bạc lá TT Tên dòng/giống Xa4 xa5 Xa7 xa13 Xa21 1 Tám xoan Bắc Ninh + 2 Tám xoan Hải Hậu + 3 Tẻ Nƣơng + 4 Thơm Lài + 5 Nếp mặn + 6 Lúa Ngoi + 7 Một bụi đỏ + 8 Nàng cờ đỏ 2 + 9 Ble te lo + + 10 Chiêm nhỡ Bắc Ninh 2 + 11 Kháu mặc buộc + + 12 OM6377 + 13 Chấn thơm + + + 14 Khâu giáng + 15 Coi ba đất + + + 16 Nếp bồ hóng Hải Dƣơng + + 17 Tan ngần + 18 Ba cho K‟te + + 19 Blào sinh sái + + 20 Tép Thái Bình + 21 Khấu điển lƣ + + + 22 Nếp mèo nƣơng + + 23 Tốc lùn + 24 Hom râu + + + 25 Nếp ông táo + 26 OM3536 + 27 Khẩu Liến + + 28 Chiêm đá + 29 IS1.2 + + 30 QJ4 + + 31 BQ + 32 Bắc thơm kháng bệnh bạc lá + 33 BC15 + 34 Thiên ƣu + 35 RVT + 36 IRBB62 + + + 69 Chỉ thị pTA248 liên kết chặt với gen Xa21, đƣợc phát triển bởi Ronald và cộng sự (1992), và đã đƣợc sử dụng nhƣ là chỉ thị chức năng nhận biết gen trong các chƣơng trình chọn giống (Kameswara et al., 2010; Perumalsamy et al., 2010; Salgotra et al., 2012; Hajira et al., 2016). Để sàng lọc các nguồn gen mang gen kháng Xa21 đối với các giống lúa nghiên cứu, chỉ thị pTA248 đã đƣợc sử dụng trong nghiên cứu này. Kết quả kiểm tra PCR cho thấy các giống lúa nghiên cứu không có sự xuất hiện của băng kích thƣớc 1000bp giống nhƣ đối chứng dƣơng (IRBB62). Từ kết quả kiểm tra gen đích ở trên, chúng tôi đã xác định đƣợc sự có mặt của các gen/gen ứng viên kháng trong các nguồn vật liệu khác nhau, sử dụng là nguồn cho gen, phục vụ cho công tác chọn tạo giống lúa kháng bệnh bạc lá (bảng 3.5). Từ kết quả nhận diện gen/gen ứng viên kháng bệnh bạc lá đã xác định đƣợc 04 giống bản địa mang 3 gen ứng viên, đó là Chấn thơm, Coi ba đất, Khấu điển lƣ và Hom râu. Như vậy, đã tầm soát đƣợc 2 gen ứng viên xa5 và xa13 ở một số giống lúa bản địa của Việt Nam có trình tự và thành phần acid amin tƣơng đồng với các gen tham chiếu đã công bố trên NCBI. Từ đó, thiết kế đƣợc 2 chỉ thị chức năng (xa5add35 và xa13add4) và xác định đƣợc 4 giống đó là Chấn Thơm (Xa4, xa5 và Xa7), Hom râu, Coi ba đất và Kháu điển lƣ (xa5, Xa7 và xa13) mang 3 gen ứng viên, trong đó gen ứng viên xa5 và xa13 đƣợc nhận biết nhờ sử dụng chỉ thị chức năng đã thiết kế. Các chỉ thị này đƣợc sử dụng để phục vụ công tác nghiên cứu đánh giá tính kháng bạc lá của các gen ứng viên xa5, xa13 có trong các giống lúa bản địa của Việt Nam và phục vụ cho công tác chọn tạo giống kháng bệnh bạc lá. 3.2. Đánh giá khả năng kháng/nhiễm bệnh bạc lá của các nguồn vật liệu Từ kết quả xác định các gen/gen ứng viên kháng bệnh bạc lá và dựa vào sự phản ứng quang chu kỳ, cũng nhƣ sự chênh lệch thời gian sinh trƣởng mà 1 số giống bản địa mang 3 gen ứng viên (là giống cho gen) đã đƣợc lựa chọn để đánh giá tính kháng, cùng với nghiên cứu đánh giá khả năng kháng/nhiễm của các giống lúa 70 ƣu tú, giống lúa phổ biến trong sản xuất để từ đó lựa chọn ra các giống cho gen và nhận gen phù hợp. Hình 3.10. Khuẩn lạc cấy trên môi trường PSA đặc Hình 3.11. Đánh giá khả năng kháng/nhiễm của một số dòng/giống lúa nghiên cứu (a): Ruộng thí nghiệm các dòng lây nhiễm nhân tạo; (b): Lây nhiễm giống Chấn thơm; (c): Lây nhiễm giống QJ4; (d): Lây nhiễm dòng PQ5; (e): Lây nhiễm giống Thủ Đô 1; (f): Lây nhiễm giống Khang dân 28 Hai isolate đƣợc thu thập và phân lập từ mẫu lá nhiễm bệnh bạc lá của 2 giống BC15 (thu thập tại Nam Định) và Nếp thơm (thu thập tại Hòa Bình). Hai isolate này có tính độc khi lây nhiễm với 2 giống chuẩn nhiễm Taichung Native (TN1) và IR24. Kết quả lây nhiễm 2 isolate vi khuẩn phân lập với 24 dòng/giống nghiên cứu cho thấy: cả 3 giống bản địa đều có khả năng kháng bệnh bạc lá (từ (a) (b) (c) (d) (e) (f) 71 kháng trung bình đến kháng), trong đó giống Hom râu và Chấn thơm kháng đối với isolate AGI5.6 và kháng trung bình với isolate AGI4.1. Giống Kháu điển lƣ kháng trung bình với cả 2 isolate lây nhiễm. Bảng 3.6. Đánh giá khả năng kháng/nhiễm của các dòng/giống lúa nghiên cứu bằng lây nhiễm nhân tạo (vụ xuân 2014 - Thạch Thất, Hà Nội) TT Tên giống Gen ứng viên/gen đích Kí hiệu Isolate AGI4.1 Isolate AGI5.6 TB chiều dài vết bệnh Khả năng kháng/ nhiễm TB chiều dài vết bệnh Khả năng kháng/ nhiễm I Giống bản địa 1 Hom râu xa5, Xa7, xa13, M72 14,1 M 4,8 R 2 Kháu điển lƣ xa5, Xa7, xa13, M71 14,7 M 10,0 M 3 Chấn thơm Xa4, Xa7, xa5 M70 12,3 M 4,6 R II Dòng ƣu tú 4 QJ4 xa5, Xa7 M2 9,9 M 1,2 R 5 BQ Xa7 M3 20,6 S 7,7 M 6 QP5 M4 24,2 S 9,5 M 7 NPT3 M5 19,3 S 15,7 S 8 Thủ đô 1 M8 20,1 S 13,9 M 9 Bắc thơm kháng bệnh bạc lá Xa4 M9 26,9 S 14,8 M 10 Bắc thơm số 7 M64 21,6 S 16,5 S 11 BC15 xa5 M13 17,9 S 12,8 M 12 Khang dân 28 M15 24,9 S 15,5 S 13 Thiên ƣu Xa4 M19 15,4 S 11,9 M 14 RVT Xa4 M25 20,0 S 13,6 M 15 DT39 M26 20,0 S 15,2 S 16 Hƣơng cốm M50 21,6 S 11,6 M 17 An dân 11 M45 23,8 S 18,1 S III Giống đối chứng 18 IRBB4 Xa4 IR4 11,2 M 6,0 M 19 IRBB5 xa5 IR5 4,6 R 1,0 R 20 IRBB7 Xa7 IR7 2,4 R 1,0 R 21 IRBB13 xa13 IR13 7,2 M 4,5 R 22 IRBB21 Xa21 IR21 11,2 M 6,6 M 23 IRBB62 Xa4, Xa7, Xa21 IR62 0,5 R 0,2 R 24 IR24 (ĐC) IR24 21,2 S 16,4 S 72 Đối với các dòng/giống ƣu tú thì giống QJ4 kháng với isolate AGI5.6, kháng trung bình với isolate AGI4.1. Có 8 dòng/giống ƣu tú kháng trung bình với isolate AGI5.6 và nhiễm với isolate AGI4.1 (BQ, QP5, Thủ đô 1, Bắc thơm khán

Các file đính kèm theo tài liệu này:

  • pdfluan_an_nghien_cuu_tich_hop_gen_khang_benh_bac_la_vao_mot_so.pdf
Tài liệu liên quan