Luận văn Đánh giá sự lưu hành và tính kháng kháng sinh của vi khuẩn đường ruột enterobacteriaceae trong rau ăn sống tại một số quận nội thành Hà Nội

MỞ ĐẦU . 4

CHƯƠNG 1. TỔNG QUAN TÀI LIỆU . 7

1.1. HỌ VI KHUẨN ĐƯỜNG RUỘT ENTEROBACTERIACEAE. 7

1.1.1. Enterobacteriaceae. 7

1.1.2. Sự phân bố của Enterobacteriaceae. 8

1.1.3. Khả năng gây bệnh của Enterobacteriaceae . 9

1.1.3.1. Viêm màng não và viêm nhiễm hệ Thần kinh . 10

1.1.3.2. Nhiễm trùng đường tiết niệu . 10

1.1.3.4. Gây bệnh đường ruột . 11

1.2. KHÁNG SINH . 12

1.2.1. Lịch sử ra đời kháng sinh. 12

1.2.1.1. Cephalosporin . 13

1.2.1.2. Các kháng sinh β-lactam khác . 14

1.2.2. Cơ chế kháng kháng sinh. 14

1.2.2.1. Kháng kháng sinh . 14

1.2.2.2. Cơ chế kháng kháng sinh của vi khuẩn . 18

1.2.3. Hiện tượng kháng cephalosporine ở vi khuẩn gram âm . 22

1.2.4. Enzym β-lactamase . 23

1.2.4.1. Enzym β-lactamase phổ rộng . 25

1.2.4.2. β-lactamase AmpC . 27

1.2.4.3. Carbapenemase . 28

1.3. THỰC PHẨM – NGUỒN CHỨA ENTEROBACTERIACEAE . 29

1.3.1. Rau ăn sống – vật chủ chứa Enterobacteriaceae . 30

1.3.2. Tình hình nhiễm Enterobacteriaceae trong rau trên thế giới . 32

1.3.3. Tình hình nhiễm Enterobacteriaceae trong rau tại Việt Nam . 34

CHƯƠNG 2. NGUYÊN VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU . 36

2.1. THỜI GIAN, ĐỊA ĐIỂM VÀ ĐỐI TƯỢNG NGHIÊN CỨU . 36

pdf104 trang | Chia sẻ: honganh20 | Ngày: 04/03/2022 | Lượt xem: 99 | Lượt tải: 0download
Bạn đang xem trước 20 trang tài liệu Luận văn Đánh giá sự lưu hành và tính kháng kháng sinh của vi khuẩn đường ruột enterobacteriaceae trong rau ăn sống tại một số quận nội thành Hà Nội, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
oại thảo mộc lá (n = 6.032), hành xanh (n = 3,381), dưa đỏ (n = 3,230), cà chua (n = 4,837) và quả (n = 1,776). Nhìn chung, kết quả cho thấy tỷ lệ nhiễm vi khuẩn Enterobacteriacea trong các loại sản phẩm được nghiên cứu là khoảng 0 - 1,01%, tỉ lệ bắt gặp cao nhất trong các loại thảo mộc lá (0,79-1,30%), tiếp theo là các loại rau lá (0,30 - 0,53%), dưa đỏ (0,07 - 0,36%), hành xanh (0,03 - 0,26%), quả (0 - 0.22%) và cà chua (0 - 0.08%) [30]. Một nghiên cứu khác được thực hiện tại Phần Lan trên các loại rau được bán lẻ tại các cửa hàng gồm các loại rau cho rễ như củ cải, rau mùi tây, cà rốt và rau xanh như xà lách, hẹ, rau diếp băng, rau cần tây, cải bắp cải cho thấy sự xuất hiện của 114 vi khuẩn gram âm thuộc họ Enterobacteriaceae. Sau khi nhận dạng, các vi khuẩn được phân loại như sau: Citrobacter freundii - 21  33 chủng, Enterobacter aerogenes - 41 chủng, Erwinia carotovora - 5 chủng, Escherichia coli - 5 chủng, Hafnia spp. - 30 chủng, Klebsiella spp. - 1 chủng, Proteus vulgaris - 9 chủng, Providencia spp. - 2 chủng, và Serratia marcescens - 1 chủng. Đặc biệt từ mẫu rau diếp là loại rau ăn sống, 22 vi khuẩn đã được phân lập và phân loại vào các chi sau: Enterobacter aerogenes, Citrobacter freundii, Hafnia spp. và Escherichia coli [31]. Một nghiên cứu khác của Odigie và cộng sự thực hiện vào năm 2015 trên 100 mẫu rau được thu thập từ các thị trường ở Calabar, Nigeria đã phân lập được 105 vi khuẩn thuộc họ Enterobacteriaceae. Ba mươi vi khuẩn thuộc họ Enterobacteriaceae được phân lập từ mẫu đã được rửa bằng nước và giấm, trong đó 75 chủng vi khuẩn đã được thu thập từ các mẫu rau chưa rửa. Các loài vi khuẩn chủ yếu thuộc chi Klebsiella, Proteus và Escherichia [18]. Trong một nghiên cứu của Kim và cộng sự nhằm xác định sự hiện diện của Escherichia coli và Klebsiella pneumoniae sinh enzym và β-lactamase trên rau ăn sống. Tổng cộng 189 mẫu rau (91 rau mầm và 98 mẫu salad trộn) được thu thập tại thị trường bán lẻ ở Hàn Quốc từ tháng 10 năm 2012 đến tháng 2 năm 2013. Sự phổ biến của Escherichia coli và Klebsiella pneumoniae sinh enzym ESBL là 10,1%, trong đó 94,7% là từ các mẫu rau mầm. Tất cả các chủng vi khuẩn đều kháng với cefotaxime, và nhiều vi khuẩn sinh ESBL cũng kháng với các kháng sinh khác, bao gồm gentamicin, trimethoprim/sulfamethoxazole, và Ciprofloxacin (lần lượt là 73,7%, 63,2% và 26,3%). Enzym β-lactamase TEM-1, SHV-1, -2, -11, -12, -27, -28 và-61, và CTX-M-14, -15 và-55 được phát hiện dưới dạng đơn lẻ hoặc dạng kết hợp. Đây là báo cáo đầu tiên về sự phổ biến về loài Escherichia coli và Klebsiella pneumoniae sinh enzym ESBL trên rau tại Hàn Quốc. Kết quả của nghiên cứu này chỉ ra rằng rau ăn sống, đặc biệt là rau mầm, có thể đóng vai trò trong việc phát tán các vi khuẩn sinh ESBL lên người [32]. Bên cạnh đó sự xuất hiện và lan rộng trên toàn thế giới của họ vi khuẩn đường ruột Enterobacteriaceae sản xuất enzym carbapenemase là mối quan tâm lớn đối với sức khoẻ cộng đồng. Chuỗi cung ứng thực phẩm ngày càng được quan tâm vì đó có thể là nguồn chứa và phát tán gen kháng kháng sinh.  34 Tuy nhiên rất ít nghiên cứu tập trung vào họ vi khuẩn đường ruột sinh enzym carbapenemase, đặc biệt là trên rau. Từ tháng 1 đến tháng 4 năm 2016, tổng cộng có 87 mẫu rau tươi (rau diếp, cà chua, cà rốt, dưa chuột, bí xanh và rau mùi tây) được mua từ các chợ và cửa hàng ở thành phố Béjaia, Algeria. Trong số 87 mặt hàng thực phẩm được phân tích, 3 (3.4%) chủng Klebsiella pneumoniae kháng carbapenem thu được từ ba loại rau được mua ở hai cửa hàng khác nhau ở Béjaia, Algeria [33]. Trong nghiên cứu thực hiện tại Thụy Sĩ trên các loại rau được nhập khẩu từ Việt Nam, Zurfluh và cộng sự khi thực hiện nghiên cứu vào năm 2015 đã phát hiện ra các chủng Enterobacteriaceae sinh ESBL. 169 mẫu rau được thu thập để phân tích, trong đó có 20 mẫu rau nhập khẩu từ Việt Nam, bao gồm rau húng, rau canh giới, mồng tơi. Kết quả cho thấy sự hiện diện của 3 loài vi khuẩn Escherichia coli, Klebsiella pneumonie và Enterobacter cloacae sinh ESBL [34]. Trong một nghiên cứu khác của Zurfluh và cộng sự trong năm 2015, trên mẫu rau trộn từ Việt Nam đã phát hiện loài vi khuẩn Klebsiella variicola sinh enzym OXA-181carbapenemase. Tiếp tục nghiên cứu về Enterobacteriaceae trên rau sống được nhập từ châu Á, Năm 2016 Zurfluh đã phát hiện chủng Escherichia coli DH5-alph sinh enzym ESBL đồng thời chứa gen mcr-1 kháng Colistin trên mẫu rau từ Việt Nam . 1.3.3. Tình hình nhiễm Enterobacteriaceae trong rau tại Việt Nam Sự lưu hành của Enterobacteriaceae trong rau ăn sống tại Việt Nam có sự thay đổi về tỉ lệ giữa các nghiên cứu giữa các vùng miền khác nhau thuộc các tác giả khác nhau vào từng thời điểm khác nhau, tuy nhiên Enterobacteriaceae vẫn hiện diện với tỉ lệ cao trên các mẫu rau ăn sống đã thu thập, thường lên tới 100%. Kết quả phân tích Viện Vệ sinh Dịch tễ Trung ương năm 2011 cho thấy 96 mẫu rau được lấy tại chợ Hoàng Liệt và 118 mẫu lấy từ quận Long Biên (Hà Nội) đều nhiễm vi khuẩn Coliforms và các vi khuẩn gây ra bệnh tiêu chảy (những loại vi khuẩn có trong phân người và gia súc) [35]. Kết quả xét nghiệm nước dùng để tưới rau cho thấy có quá nhiều mầm bệnh, đặc biệt là vi khuẩn Coliforms (nguồn nước tưới chủ yếu là ao chứa nước mưa hoặc nước giếng ở hộ gia đình). Điều này chứng tỏ nguồn nước tưới tiêu đóng  35 vai trò quan trọng, có ảnh hưởng tới việc lan truyền các vi sinh vật gây bệnh. Trong nghiên cứu của Lương Đức Phẩm, trên hầu hết các loại rau cải chứa 106 - 107 tế bào Coliforms/g và phân hữu cơ không sạch mầm bệnh có thể gây ô nhiễm trên đất và cây trồng sau khi được sử dụng, nhất là đối với loại rau ăn thân và ăn lá [36]. Trong khi đó Nghiên cứu thực hiện tại Thành Phố Hồ Chí Minh và khu vực đồng bằng sông Mê Công cũng cho tỉ lệ nhiễm Enterobacteriaceae trong rau ăn sống là cao. Một nghiên cứu khác của đại học Cần Thơ thực hiện năm 2011-2012 (n=25) cho thấy Coliforms và E.coli hiện diện trong các mẫu rau với hàm lượng cao [35]. Gần đây nhất nghiên cứu về Enterobacteriaceae của Ho Le Quynh Chau và cộng sự thực hiện 2013-2014 tại Huế cho thấy 100% (n=108) mẫu rau bán ở chợ nhiễm E. coli [37]. Từ các nghiên cứu trên thế giới và tại Việt Nam trong những năm gần đây cho thấy rau ăn sống là một trong các nguồn chứa vi sinh vật gây bệnh, và có khả năng lây truyền vi khuẩn kháng lên người. Cùng với sự hiện diện của các loài vi khuẩn gây bệnh, thì con người đã sản xuất và áp dụng nhiều thế hệ kháng sinh vào quá trình chữa trị, tuy nhiên dần dần các vi khuẩn gây bệnh đã thể hiện tính kháng kháng sinh. Bên cạnh đó việc lạm dụng kháng sinh trong chăn nuôi (gia cầm, thủy hải sản) và sự lây nhiễm vi khuẩn do tiêu thụ thực phẩm vô hình chung đã gây khó khăn cho quá trình điều trị.Theo báo cáo của tổ chức y tế thế giới, kháng kháng sinh đang là thực trạng đáng báo động, đặc biệt là tại các nước đang phát triển, nơi mà quá trình sử dụng kháng sinh không được kiểm soát chặt chẽ. Tuy nhiên cho đến nay có rất ít công bố về sự lưu hành vi khuẩn Enterobacteriaceae trong rau ăn sống chứa các gen mã hóa enzym β-lactamase có khả năng kháng kháng sinh β-lactam. Đặc biệt hơn, tại Việt Nam chưa có công bố nào về tình trạng kháng kháng sinh của các vi khuẩn Enterobacteriaceae trong rau sống được bán tại các quán ăn.  36 CHƯƠNG 2. NGUYÊN VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 2.1. THỜI GIAN, ĐỊA ĐIỂM VÀ ĐỐI TƯỢNG NGHIÊN CỨU Thời gian thu thập mẫu được tiến hành vào cuối tháng 8 đến tháng 10 năm 2018. Chín mươi mẫu rau được thu thập tại các chợ, siêu thị và quán ăn phục vụ đồ ăn kèm rau ăn sống trên địa bàn 5 quận nội thành: Cầu Giấy, Nam Từ Liêm, Hà Đông, Long Biên, Hoàng Mai. Rau ăn sống (rau mùi ta, mùi tàu, bạc hà, húng quế, húng láng, ngổ, xà lách, diếp) được thu thập tại các chợ và siêu thị và cửa hàng ăn (xem Hình 2.1 & Hình 2.2). Hình 2.1 Địa điểm lấy mẫu tại một số Quận nội thành Hà Nội Hình 2.2 Rau ăn sống được bày bán tại các chợ và siêu thị Mỗi mẫu rau ăn sống (khối lượng khoảng 0.5 kg) được thu thập, bảo quản trong túi nilon vô trùng và được vận chuyển ngay về phòng thí nghiệm.  37 Các mẫu rau ăn sống sau đó được bảo quản mẫu tại phòng thí nghiệm ở nhiệt độ 4oC – 80C và được phân tích trong ngày hoặc vào ngày hôm sau. Phương pháp lấy mẫu:  Các mẫu rau ăn sống được thu thập ngẫu nhiên tại 5 Quận (theo phụ lục 1): Cầu Giấy, Nam Từ Liêm, Hà Đông, Hoàng Mai, Long Biên.  Thời gian thu thập mẫu: Tháng 8-Tháng 10/2018.  Tại mỗi sạp hàng mỗi loại rau ăn sống chỉ thu thập 1 mẫu. Mẫu sau khi thu thập được tiến hành phân tích tại Khoa Vi sinh vật – Viện kiểm nghiệm an toàn vệ sinh thực phẩm Quốc gia – Số 65 Phạm Thận Duật, Mai Dịch, Cầu Giấy, Hà Nội. 2.2. NGUYÊN VẬT LIỆU 2.2.1. Dụng cụ Túi vô trùng (Biomerieux, Pháp) Ống nghiệm thủy tinh vô trùng (Duran, Đức) Que cấy nhựa (Biologix, Mỹ) Pipettman (Effendorf, Đức) Tăm Bông vô trùng (Việt Nam) Đĩa petri (Gosselin, Pháp) Bàn dập kháng sinh (Oxoid, Mỹ) Giấy parafilm (Sigma, Đức) Hộp để chủng (Việt Nam) 2.2.2. Thiết bị Nồi hấp (Hymaraya, Nhật) Tủ sấy (Sanyo, Nhật) Cân kỹ thuật D = 0,1 ML802 (Metter Toledor, Thụy Sĩ) Tủ ấm (Memert, Đức) Tủ an toàn sinh học cấp 2 (Bio II, Anh) Máy đồng nhất mẫu (Anh)  38 2.2.3. Hóa chất Buffer Peptone water (Merck, Đức) TSA agar (Merck, Đức) VRB (BD, Mỹ) VRBG agar (BD, Mỹ) TBX agar (Oxoid, Mỹ) Mueller Hinton agar (Merck, Đức) Macconkey agar (Sigma, Đức) Khoanh giấy kháng sinh: cefazolin, cefoxitin, cefuroxime, ceftriaxone, cefotaxime, ceftazidime, cefotaxime/calvulanic axit, ceftazidime/clavulanic axit (Liofilchem, Ý) McFaland (BaCl2 – Sigma, Mỹ ; H2SO4 – Merck, Đức) 2.2.4. Chủng chuẩn Sử dụng chủng chuẩn: Escheriachia coli ATCC 25922 Salmonella 572 đã được công bố trong bài báo quốc tế năm 2014 [38] Escherichia coli ATCC 8739 2.3. PHƯƠNG PHÁP NGHIÊN CỨU Ba mươi mẫu rau ăn sống được thu thập tại 5 chợ, mỗi chợ 6 mẫu tại các sạp hàng khác nhau. Thời gian thu thập tháng 8-9/2018; Ba mươi mẫu rau ăn sống được thu thập tại 30 quán bán đồ ăn sẵn có kèm rau ăn sống (quán vịt nướng, quán phở). Thời gian thu thập tháng 8- 9/2018; Ba mươi mẫu rau ăn sống được thu thập tại 8 siêu thị và cửa hàng rau sạch. Thời gian thu thập tháng 8-10/2018. 2.3.1. Chuẩn bị và xử lý mẫu Cân mẫu: Cân 25 g (từ 0.5 kg rau đã được đồng nhất) cho vào túi vô trùng, bổ sung 225 mL đệm peptone.  39 2.3.2. Phương pháp định lượng Enterobacteriaceae ISO 21528-2:2017: Enterobacteriaceae: Định lượng các loài vi khuẩn Enterobacteriaceae lên men glucose. Các khuẩn lạc đặc trưng có màu hồng đến màu đỏ hoặc đỏ tía (có hoặc không có quầng tủa), lên men glucose và cho phản ứng oxidase âm tính được xác định là Enterobacteriaceae [39]. TCVN 7429-2:2008 (ISO 16649-2:2001): E. coli: các khuẩn lạc màu xanh lục đến xanh lam trên môi trường trypton-mật-glucuronid (TBX) được xem là E. coli [40]. TCVN 6848:2007 (ISO 4832:2006): Coliform : Định lượng các loài vi khuẩn thuộc họ vi khuẩn đường ruột Enterobacteriacea lên men lactose. Các khuẩn lạc đặc trưng là các khuẩn lạc màu đỏ ánh tía có đường kính 0,5 mm hoặc lớn hơn (đôi khi có vùng mật tủa hơi đỏ bao quanh) được xem là khuẩn lạc Coliform điển hình [41]. Cách thức tiến hành: Mẫu sau khi được đồng nhất trong đệm peptone thu được huyền phù 10-1, hút 1mL từ dịch huyền phù 10-1 cho vào 9mL nước peptone muối thu được dịch pha loãng mẫu 10-2. Tiến hành các nồng độ pha loãng tiếp theo. Hút 1 mL dịch huyền phù chứa mẫu từ các nồng độ pha loãng, cho vào đĩa petri vô trùng, đổ 15mL thạch VRBG/VRB/TBX. Để đông trong 15 phút. Lật ngược các đĩa, đem nuôi tại nhiệt độ phù hợp: 37oC/24h đối với phép thử định lượng coliform và Enterobacteriaceae; 44oC/24h đối với phép thử định lượng E. coli. Khuẩn lạc màu đỏ tía trên thạch VRB được xem là coliform; Khuẩn lạc màu xanh lục - lam trên thạch TBX được xem là E. coli; Các khuẩn lạc màu hồng – đỏ tía trên thạch VRBG, âm tính oxidase và lên men đường glucose được đếm là Enterobacteriaceae. 2.3.3. Phương pháp khoanh giấy kháng sinh 2.3.3.1. Thử tính kháng kháng sinh β-lactam Tính kháng kháng sinh của chủng vi khuẩn Enterobacteriaceae được thử nghiệm bằng các khoanh giấy kháng sinh theo qui trình hướng dẫn của tổ chức Y tế thế giới [42]:  40 Bước 1: Chuẩn bị dung dịch McFaland và tạo dung dịch chủng Enterobacteriaceae: 106 – 108 Bước 2: Sử dụng bông tăm vô trùng dàn dịch chủng Enterobacteriaceae lên đĩa thạch Muller Hinton agar Bước 3: Hong khô ở nhiệt độ phòng và đặt khoanh giấy kháng sinh có chứa kháng sinh (nồng độ và các kháng sinh được thể hiện trong Bảng 2.1) Bước 4: Đo kích thước vòng kháng, đối chiếu với kích thước của chủng đối chiếu (E. coli ATCC 25922) theo hướng dẫn của tổ chức CLSI về chuẩn kháng sinh theo Bảng 2.1 [43]. Bước 5: Đọc kết quả: kháng, nhạy cảm, không kháng. Bảng 2.1 Kháng sinh và điểm đọc kháng sinh đồ [43] Kháng sinh Tên viết tắt Nồng độ kháng sinh (µg) Điểm đọc tiêu chuẩn S I R Cephalosporin thế hệ 1 Cefazolin KZ 30 ≥15 - ≤14 Cephalosporin thế hệ 2 cefuroxime cefoxitin CXM FOX 30 30 ≥18 ≥18 15-17 15-17 ≤14 ≤14 Cephalosporin thế hệ 3 ceftriaxone cefotaxime ceftazidime CRO CTX CAZ 30 30 30 ≥23 ≥26 ≥21 20-22 23-25 18-20 ≤19 ≤22 ≤17 Chú thích: S: nhạy cảm; I: Trung gian; R: kháng 2.3.3.2. Xác định vi khuẩn Enterobacteriaceae sinh enzym β-lactamase Phân lập các chủng Enterobacteriacea có khả năng sinh enzym β- lactamase phổ rộng, AmpC β-lactamase, carbapenemase [44]. Các mẫu rau được tăng sinh trong đệm peptone, ủ tại 37oC/24h Ria chuyển lên môi trường Macconkey/ chứa 100 µ/L cefotaxime  41 Các chủng Enterobacteriacea vi khuẩn mọc trên môi trường Macconkey chứa 100 µ/g cefotaxime, được tiến hành xác định trên môi trường đặc trưng cho vi khuẩn Enterobacteriaceae (nhóm lên men đường lactose và nhóm lên men đường glucose) Chủng vi khuẩn Enterobacteriaceae sẽ được tiến hành xác định sinh enzym β-lactamase phổ rộng, AmpC β-lactamase, carbapenemase trong các thử nghiệm kháng sinh tương ứng với từng loại enzym. Tạo dịch vi khuẩn xác định tính kháng kháng sinh: thực hiện 4 bước tương tự như đã trình bày trong mục 2.4.3.1 Đo kích thước vòng kháng, đối chiếu với kích thước theo hướng dẫn của tổ chức CLSI và EUCAST về chuẩn kháng sinh [43, 45]. Xác định vi khuẩn Enterobacteriaceae sinh enzym β-lactamase phổ rộng Khẳng định sự có mặt của enzym β-lactamase phổ rộng bằng thử nghiệm kháng sinh đồ trên 4 khoanh giấy kháng sinh là cefotaxime (CTX), cefotaxime kết hợp clavulanic axit (CTL), ceftazidime (CAZ) và ceftazidime kết hợp axit clavulanic (CAL). Quá trình thử nghiệm được tiến hành song song cùng với chủng Salmonella 572. Với kích thước vòng kháng CTL và CAL lớn hơn hoặc bằng 5mm so với vòng kháng CTX và/hoặc CAZ thì khẳng định chủng vi khuẩn sinh β-lactamase phổ rộng theo hướng dẫn của tổ chức CLSI thể hiện trong Bảng 2.2 [43]. Bảng 2.2 Vi khuẩn sinh enzym ESBL [43] vi khuẩn sinh enzym ESBL Kháng sinh Khẳng định cefotaxime (CTX), CTX và clavulanic axit (CTL, 40µg) vòng kháng CTL, CAL ≥5mm so với vòng kháng CTX, CAZ ceftazidime (CAZ), CAZ và clavulanic axit (CAL, 40µg)  42 Xác định vi khuẩn Enterobacteriaceae sinh enzym AmpC β-lactamase Khẳng định sự có mặt của enzym AmpC β-lactamase bằng thử nghiệm kháng sinh đồ trên 4 khoanh giấy kháng sinh là cefotaxime (CTX), cefotaxime kết hợp cloxacillin (CTC), ceftazidime (CAZ) và ceftazidime kết hợp cloxacillin (CAC). Quá trình thử nghiệm được tiến hành song song cùng với chủng Salmonella 572. Với kích thước vòng kháng CTC và CAC lớn hơn hoặc bằng 5mm so với vòng kháng CTX và CAZ thì khẳng định chủng vi khuẩn sinh AmpC β-lactamase theo hướng dẫn của CLSI thể hiện trong Bảng 2.3 [43]. Bảng 2.3 Vi khuẩn sinh enzym AmpC β-lactamase [43] Vi khuẩn sinh enzym AmpC β-lactamase Kháng sinh Khẳng định cefotaxime (CTX), CTX và cloxacillin (CTC) vòng kháng CTL, CAL ≥5mm so với vòng kháng CTX, CAZ ceftazidime (CAZ), CAZ và cloxacillin (CAC) Xác định vi khuẩn Enterobacteriaceae sinh enzym carbapenemase Khẳng định sự có mặt của enzym carbapenemase bằng thử nghiệm kháng sinh đồ trên 5 khoanh giấy kháng sinh là meropenem (MRP), meropenem + phenylboronic axit (MR+BO), meropenem + cloxacillin (MR+CL), meropenem + EDTA (MR+ED) và temocillin (TMO). Chủng sinh enzym carbapenemase được khẳng định theo hướng dẫn của EUCAST thể hiện trong Bảng 2.4 [45]. Bảng 2.4 Xác định vi khuẩn Enterobacteriaceae sinh enzym carbapenemase [45] Kích thước vòng kháng của Meropenem và các kháng sinh khác phenylboronic axit (MR+BO) EDTA (MR+ED) cloxacillin (MR+CL) temocillin (TMO) β- lactamases ≥4 mm < 5 mm < 5 mm --- KPC < 4 mm ≥5 mm < 5 mm --- MBL ≥4 mm < 5 mm ≥5 mm --- AmpC < 4 mm < 11 mm OXA < 5 mm < 5 mm <11 OXA -48  43 Đọc kết quả: vi khuẩn sinh hay không sinh enzym β-lactamase, AmpC β-lactamase, carbapenemase. 2.3.4. Kỹ thuật MALDI – TOF định danh vi sinh vật Thiết bị VITEK MS là máy đo khối phổ MALDI-TOF sử dụng kỹ thuật MALDI (Kỹ thuật ion hóa theo cơ chế giải hấp phụ sử dụng nguồn laser với sự trợ giúp của chất nền), dựa trên sử dụng công nghệ khối phổ protein. VITEK® MS là hệ thống định danh vi khuẩn tự động, tiên tiến, sử dụng công nghệ MALDI-TOF (Matrix Assisted Laser Desorption Ionization Time-of- Flight) định danh các loài vi khuẩn được thực hiện bằng ghi nhận các dải quang phổ và phân tích các dải quang phổ với cơ sở dữ liệu của VITEK® MS (xem Hình 2.3). So sánh sự tương đồng của phổ protein từ mẫu vi sinh vật mục tiêu với cơ sở dữ liệu của gần 6000 loài vi sinh vật khác nhau. MALDI-TOF MS cho kết quả nhanh trong vài phút cho 1 mẫu, yêu cầu thể tích mẫu ít và chi phí hóa chất thấp và cho kết quả thu được là loài vi sinh vật được xác định. Hình 2.3 Nguyên lý cơ bản định danh vi khuẩn dựa trên VITEK MS  Các bước tiến hành định danh vi khuẩn bằng kỹ thuật MALDI TOF trên thiết bị VITEK MS theo hướng dẫn của nhà sản xuất thiết bị [46]. Bước 1: vi khuẩn được nuôi trên môi trường TSA ở 37oC/24h  44 Bước 2: Vi khuẩn được phết lên từng giếng của khay Bước 3: Nhỏ 0.1 µL dung dịch CHCA Bước 4: Quét mã khay, nhập mã mẫu vào phần mềm Malditof preparation Bước 5: Chạy máy Bước 6: Đăng nhập phần mềm Myla, đọc kết quả 2.3.5. Phương pháp xác định gen kháng kháng sinh Xác định gen mã hóa enzym β-lactamase bằng kỹ thuật PCR dựa trên độ dài đoạn gen khuếch đại. Thu ADN mẫu bằng xử lý nhiệt 100oC/15’. Ly tâm 13000v/4’. Thu dịch nổi. Sử dụng các cặp mồi đã được công bố bởi tác giả Li và cộng sự vào năm 2013 [47]. Tiến hành phản ứng PCR với các trình tự mồi theo Bảng 2.5  45 Bảng 2.5 Trình tự mồi của gen mã hóa enzym β-lactamase [47] TT Gen kháng Trình tự mồi (5’-3’) Đoạn khuếch đại (bp) 1. blaTEM CAGCGGTAAGATCCTTGAGA TTCATCCATAGTTGCCTGACT 661 2. blaCMY-2 ACAGAACAACAGATTGCCGATA TGTCGCTGCCGTTGATGA 856 3. blaSHV TTCGCCTGTGTATTATCTCC TTTGCTGATTTCGCTCGG 807 4. blaOXA ACCAGATTCAACTTTCAA TCTTGGCTTTTATGCTTG 590 5. blaPSE GCTCGTATAGGTGTTTCCGTTT CGATCCGCAATGTTCCATCC 575 6. BlaDHA GCCGTCTCCGTAAAGGGTAAGC GCCAGAATCACAATCGCCACCT 926 7. Bla CTX-M CGATGTGCAGTACCAGTAA AGTGACCAGAATCAGCGG  585 Chu trình phản ứng PCR: Biến tính DNA: 94°C/5 phút; 30 chu kỳ: Biến tính DNA 94°C/30s, gắn mồi 55°C/30s; kéo dài chuỗi 72°C/50s; và giai đoạn ổn định 72 °C/7 phút. Chạy điện di với gel 1.5%, chụp gel Sản phẩm PCR đại diện cho mỗi gen được tiến hành tinh sạch và giải trình tự để xác định sự chính xác của sản phẩm. Trình tự ADN của mỗi gen được tiến hành so sánh với dữ liệu của ngân hàng gen Mỹ (https://blast.ncbi.nlm.nih.gov/Blast.cgi). Các chủng Enterobacteriaceae mang gen đặc trưng sau đó được sử dụng làm đối chứng dương cho phản ứng PCR xác định gen đích. 2.4. CHỦNG ĐỐI CHỨNG Phát hiện Enterobacteriaceae trên rau, sử dụng chủng E. coli ATCC 25922.  46 Định danh vi khuẩn, sử dụng chủng E. coli ATCC 8739 Phân tích kháng sinh: sử dụng chủng Salmonella 572, được phân lập từ năm 2012 và công bố trên tạp chí Journal of Food Protection [38]. 2.6. XỬ LÝ KẾT QUẢ Số liệu được nhập vào bảng Excel và được phân tích bằng sử dụng phần mềm STATA 11.0 (StataCorp, College, TX, USA) với các biến là địa điểm thu thập mẫu và các thời điểm thu thập mẫu. Giá trị P<0.05 được sử dụng để đánh giá sự khác biệt về mặt thống kê giữa các biến. Các phép tính thống kê về sự ô nhiễm Enterobacteriaceae trên rau ăn sống theo các loại hình kinh doanh được tiến hành theo phương pháp phân tích bảng với mỗi biến nghiên cứu được kiểm tra bằng 2xn chi square trong Stata.  47 CHƯƠNG 3. KẾT QUẢ VÀ THẢO LUẬN 3.1. ĐÁNH GIÁ SỰ LƯU HÀNH VI KHUẨN ENTEROBACTERIACEAE TRONG RAU SỐNG 3.1.1. Đánh giá tỉ lệ nhiễm vi khuẩn Enterobacteriaceae trong rau sống Chín mươi mẫu rau sống được thu thập tại 03 loại hình kinh doanh là các chợ, quán bán đồ ăn có kèm rau ăn sống, và siêu thị thuộc 5 Quận nội thành Hà Nội (Phụ lục 1) (n=30 đối với mỗi loại hình kinh doanh) và tiến hành phân tích phát hiện và định lượng vi khuẩn thuộc họ vi khuẩn đường ruột Enterobacteriaceae gồm Coliform (nhóm vi khuẩn Enterobacteriacea lên men lactose), Enterobacteriaceae (nhóm vi khuẩn Enterobacteriacea lên men glucose) và Escherichia coli với tỉ lệ dương tính tương ứng là 100% (90 mẫu, n=90), 100% (90 mẫu, n=90), 86% (77 mẫu, n=90). Kết quả phân tích của nghiên cứu này tương đồng với các kết quả được thực hiện tại Long Biên và Hoàng Mai năm 2011 của Viện Vệ sinh dịch tễ trung ương với 100% mẫu rau nhiễm Coliform (n=204) [35]. Kết quả này cũng tương đương với phát hiện Coliform trên rau trong nghiên cứu của tác giả Nguyễn Thị Thu Hà và cộng sự thực hiện tại Cần Thơ năm 2011-2012 (n=25) và nghiên cứu của Ho Le Quynh Chau và cộng sự thực hiện tại Huế năm 2013-2014 (n=108) [35], [37]. Mức nhiễm E. coli là 100% trong nghiên cứu của tác giả Nguyễn Thị Thu Hà và Ho Le Quynh Chau, cao hơn kết quả nghiên cứu của chúng tôi do có sự khác biệt trong thiết kế thí nghiệm từ địa điểm lấy mẫu đến số lượng mẫu. Kết quả nghiên cứu của chúng tôi có sự tương đồng về sự hiện diện của vi khuẩn đường ruột Enterobacteriaceae với các nghiên cứu của các tác giả khác trên thế giới, tuy khác nhau về tỉ lệ nhiễm. Nghiên cứu của Ljevaković- Musladin và cộng sự thực hiện thu thập 243 mẫu rau ăn sống tại khách sạn, nhà hàng và các cửa hàng bán lẻ từ năm 2011-2018 tại Croatia cho thấy có 39,5% mẫu nhiễm Enterobacteriaceae [48]. Một nghiên cứu khác được thực hiện tại Ấn Độ bởi Al-Kharousi và cộng sự trong năm 2014 cho thấy tỉ lệ nhiễm Enterobacteriaceae trong rau là 91% và E. coli là 22% [49].  48 Sự nhiễm các vi khuẩn đường ruột họ Enterobacteriaceae có tỉ lệ cao trên rau ăn sống được xác định có thể do lây nhiễm trong quá trình trồng trọt bắt nguồn từ nguồn nước tưới và đất và 1 nguyên nhân thường thấy tại các nước đang phát triển là rau có thể được rửa tại nguồn nước ô nhiễm trước khi phân phối ra thị trường. Trong sản xuất nông nghiệp, rau nhiễm các vi sinh vật gây bệnh có thể liên quan tới bao gồm sử dụng nước ao và nước sông để rửa rau, cách thức xử lý rau của người trồng rau và lưu trữ rau ở những nơi bị ô nhiễm. Thông tin có sẵn về hàm lượng vi khuẩn trong nước rửa cũng như rau và sự ô nhiễm sản phẩm thực vật bởi mầm bệnh của con người là một thực tế đã biết. Ở Ấn Độ, rau được rửa hầu hết trong các vùng nước có sẵn, như sông hoặc ao có sẵn ở khu vực lân cận nơi sản xuất. Sau nông dân, những người bán rau những nhân tố quan trọng góp phần vào sự phát tán các mầm bệnh từ nguồn nước lên rau, các loại rau khác nhau được bày bán trên sạp hàng, tất cả rau trong sạp thường xuyên được tưới nước (để giữ cho chúng tươi trong mùa hè nóng và khô) với nguồn nước từ cùng một xô trong nhiều ngày mà không khử trùng xô. Điều này có thể dẫn đến một lượng đáng kể vi sinh vật chỉ điểm như Coliform, Escherichia coli nhiễm lên rau tại các sạp hàng bán lẻ [50]. Từ các sạp hàng bán lẻ, rau được phân phối tới các cửa hàng bán đồ ăn sẵn có phục vụ rau ăn sống đã làm tăng nguy cơ phát tán mầm bệnh Enterobacteriaceae lây truyền qua thực phẩm lên người. Không chỉ tại các nước đang phát triển mà tại đất nước phát triển như Hoa Kỳ, Gelting và Baloch đã báo cáo 2 vụ dịch bệnh tại Hoa Kỳ có liên quan trực tiếp đến việc tiêu thụ rau bị nhiễm mầm bệnh từ nước tưới. Trong lần đầu tiên, rau cải bó xôi đóng gói tươi từ một trang trại duy nhất ở California được coi là nguồn gốc của vụ dịch E. coli O157: H7 năm 2006 gây ra hơn 200 ca bệnh và 5 người chết. Nước ngầm được sử dụng làm nước tưới và gây ô nhiễm tầng nước mặt được xác định là các yếu tố đóng góp liên quan đến vụ dịch này. Trong lần thứ

Các file đính kèm theo tài liệu này:

  • pdfluan_van_danh_gia_su_luu_hanh_va_tinh_khang_khang_sinh_cua_v.pdf
Tài liệu liên quan