Luận văn Đánh giá tính đa dạng di truyền loài vên vên (anisoptera costata) đang bị đe dọa trong rừng nhiệt đới Đông Nam Bộ

Lời cam đoan. I

Lời cảm ơn. II

Danh mục bảng. IV

Danh mục hình. V

Danh mục từ viết tắt. VI

MỞ ĐẦU 1

1. Đặt vấn đề . . . 1

2. Mục tiêu và nội dung nghiên cứu . . 2

2.1. Mục tiêu: 2

2.2. Nội dung nghiên cứu:. . 2

3. Cở sở khoa học và ý nghĩa thực tiễn: . . 3

3.1. Cơ sở khoa học: . 3

3.2. Ý nghĩa thực tiễn 3

CHƯƠNG 1. TỔNG QUAN TÀI LIỆU . . 4

1.1. Tổng quan về cây họ Dầu . . 4

1.2. Loài Vên vên . . . 5

1.3. Đặc điểm nơi sống của loài Vên vên tại mỗi địa điểm khảo sát được

mô tả như sau: . 7

1.4. Các nghiên cứu đa dạng di truyền loài Dầu . . 11

1.4.1. Tình hình nghiên cứu trong nước . 11

1.4.2. Tình hình nghiên cứu trên thế giới . 14

1.5. Đánh giá đa dạng di truyền bằng chỉ thị phân tử. 16

1.5.1. Quần thể và tính đa dạng di truyền của quần thể . 16

1.5.2. Một số kỹ thuật trong nghiên cứu đa dạng di truyền và tiến hóa phân

tử. 17

pdf71 trang | Chia sẻ: honganh20 | Ngày: 05/03/2022 | Lượt xem: 109 | Lượt tải: 1download
Bạn đang xem trước 20 trang tài liệu Luận văn Đánh giá tính đa dạng di truyền loài vên vên (anisoptera costata) đang bị đe dọa trong rừng nhiệt đới Đông Nam Bộ, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
ng hệ sinh thái. Đa dạng di truyền: là sự phong phú những biến dị trong cấu trúc di truyền của các cá thể bên trong loài hoặc giữa các loài; những biến dị di truyền bên trong hoặc giữa các quần thể. Đa dạng loài: là sự phong phú về các loài được tìm thấy trong các hệ sinh thái tại một vùng lãnh thổ xác định thông qua việc điều tra, kiểm kê. Đa dạng hệ sinh thái: là sự phong phú về các kiểu hệ sinh thái khác nhau ở trên cạn cũng như ở dưới nước tại một vùng nào đó. Hệ sinh thái là hệ thống các sinh vật và môi trường tác động lẫn nhau mà ở đó thực hiện quá trình trao đổi vật chất, năng lượng và thông tin. Nơi sống của mỗi loài được thiết lập trong quá trình hình thành loài. Phân cắt xảy ra khi nơi sống bị chia nhỏ và bị cô lập với nhau tạo nên sự phá vỡ nơi sống. Tác nhân gây ra phân cắt bao gồm mở rộng đất nông nghiệp, khai thác quá mức nguồn tài nguyên sinh vật và xây dựng các khu dân cư. Phân cắt đe doạ đến tính thống nhất sinh thái đã được hình thành trong lịch sử phát triển loài và là một trong những nguyên nhân gây ra sự tuyệt chủng. Suy giảm diện tích nơi sống ảnh hưởng đến kích thước quần thể và phân bố lại các mảnh nơi sống còn lại sẽ ảnh hưởng đến sự phát tán của loài. Hậu quả của quá trình phân cắt thường làm hệ sinh thái suy giảm chức năng và mất nơi sống. Các quần thể nhỏ và bị cô lập trong các mảnh nơi sống còn lại dễ bị tổn thương và ít có khả năng thích nghi khi điều kiện môi trường sống của chúng bị thay đổi. Tất nhiên, hậu quả sẽ dẫn đến mất tính đa dạng di truyền ở cả 2 mức độ quần thể và loài và cuối cùng nhiều loài bị đe dọa tuyệt chủng. 1.5.2. Một số kỹ thuật trong nghiên cứu đa dạng di truyền và tiến hóa phân tử Nhờ sự phát triển của các kỹ thuật sinh học phân tử, như: RAPD, AFLP, RFLP, SSR, SNP, cho phép con người có thể đánh giá mối quan hệ di truyền giữa các cá thể, quần thể và các xuất xứ sinh vật một cách nhanh chóng [30, 31, 32]. Trong đó, chỉ thị RAPD là một trong những chỉ thị đã được sử dụng khá phổ biến để đánh giá đa dạng di truyền ở nhiều loài cây rừng, như: Lim xanh 18 [33], cây họ Dầu [34], Sao lá hình tim (Hopea cordata Vidal) [35], họ Song mây [36, 37], Sao mạng Cà Nà (Hopea reticulate Tardicu) [38], Tràm bản địa (Melaleuca cajuputi) [39] và Dầu rái (Dipterocarpus alatus Roxb.) [40]. Kỹ thuật RAPD RAPD (Random Amplified Polymorphism DNA – đa hình các đoạn DNA được khuếch đại ngẫu nhiên) do William phát minh năm 1990. Phương pháp này đã sử dụng cùng một số mồi ngẫu nhiên (mồi ngẫu nhiên là các đoạn oligo nucleotide bao gồm khoảng 7 đến 12 Nucleotide) nhằm thực hiện phản ứng PCR để nhân các đoạn DNA đặc trưng của các mẫu nghiên cứu. Nếu các mẫu nghiên cứu có bộ gen giống nhau hoàn toàn, sản phẩm PCR thu được gồm các đoạn DNA hoàn toàn giống nhau về kích thước và cấu trúc. Khi bộ gen của các mẫu nghiên cứu có sự khác biệt nhau, kết quả PCR sẽ nhân được các đoạn khác biệt nhau [36]. Những thuận lợi của RAPD về mặt kỹ thuật là dễ thực hiện và dễ thành công, không cần biết trước trình tự bộ gen của đối tượng cần nghiên cứu, dễ thao tác, chất lượng DNA khuôn không cần độ tinh sạch cao, thời gian thực hiện nhanh, khả năng nhân bản cao. Chi phí để thực hiện kỹ thuật này tương đối thấp. Trong nghiên cứu, để đánh giá tính đa dạng di truyền và nhận diện chỉ thị phân tử ngoài việc sử dụng kỹ thuật RAPD thì cần phải kết hợp thêm các kỹ thuật cao cấp khác để sản phẩm có độ tin cậy cao. Kỹ thuật RAPD cũng có những hạn chế nhất định. Điển hình như độ chính xác, tính ổn định không cao, khả năng xuất hiện các băng đa hình thấp và độ tin cậy thấp. Kỹ thuật RFLP RFLP (Restriction fragment length Polymorphism – chiều dài các đoạn DNA đa hình được cắt bởi các enzyme giới hạn). Kỹ thuật này sử dụng đặc điểm của các enzyme giới hạn khác nhau, tạo nên các đoạn cắt DNA khác nhau được nhận biết bằng điện di đồ. Bản đồ di truyền cho kết quả RFLP có sự chính xác cao, thường xuyên được sử dụng trong nghiên cứu sự khác biệt trong cấu trúc bộ gene của các cá thể, các loài sinh vật, nhằm chỉ ra sự khác biệt giữa các mẫu nghiên cứu, xác định nguồn gốc hoặc mức độ tiến hóa giữa của các loài sinh vật [36]. Kỹ thuật này được dùng rộng rãi từ đầu thập niên 80 đến nay. Kỹ 19 thuật RFLP được sử dụng cho một số tính trạng để kiểm tra sự phân ly di truyền dựa theo quy luật Mendel, hoặc được ứng dụng trong chọn giống động vật, chọn giống thực vật hoặc so sánh sự khác nhau giữa các cá thể, các loài sinh vật,... Kỹ thuật RFLP được thực hiện trên nguyên lý cắt enzyme giới hạn. DNA của mẫu nghiên cứu sau khi được tách chiết và tinh sạch sẽ được cắt với cùng 1 số loại enzyme giới hạn. Mỗi enzyme giới hạn sẽ nhận biết và đồng thời cắt đặc hiệu DNA ở những vị trí xác định. Vì vậy, các bộ gen có cấu trúc khác nhau sẽ cho ra số lượng và kích thước các đoạn cắt DNA khác nhau, những bộ gen giống nhau thì sẽ cho ra số lượng, kích thước các đoạn cắt giống nhau, kích thước và số lượng các đoạn cắt này sẽ quan sát được trên điện di đồ. Kỹ thuật SSR SSR (simple sequence repeat) hay còn gọi là vi vệ tinh (Microsatellite), là những đoạn trình tự DNA đơn giản lặp lại nối tiếp và chỉ gồm 1 – 6 bp. Các SSR trong cơ thể sinh vật nhân chuẩn là phổ biến ở cả động vật và thực vật. Tuy nhiên, tùy vào từng loài mà số lượng các nucleotide ở mỗi đơn vị lặp lại có thể thay đổi từ một đến hàng chục và số lượng đơn vị lặp lại có thể biến đổi từ hai đến hàng chục lần hoặc có thể nhiều hơn. Chỉ thị phân tử SSR được sử dụng phổ biến trong chọn giống, lập bản đồ gen có ích, xây dựng bản đồ di truyền, nghiên cứu di truyền liên kết hay di truyền quần thể. Các loại SSR bao gồm:  Satellite là đoạn trình tự lặp lại 1 lần mà có thể cấu tạo tới vài phần trăm của genome kích thước có thể lớn tới 5 Mb. Thường tập trung ở vùng tâm động của nhiễm sắc thể do đó nó ít khi được sử dụng nhiều trong quá trình lập bản đồ gen ở gần vùng tâm động.  Minisatellite có mặt tại hàng trăm hoặc hàng nghìn vị trí khác nhau trên genome mà ở đó một đơn vị được lặp lại từ 0,5 kb cho tới 30 kb. Để phát hiện ra, người ta có thể dùng phương pháp mẫu dò phóng xạ. Những thông tin này phải tạo nên thông tin đặc biệt riêng cho từng cá thể như kiểu “dấu vân tay” ở người. Nó được sử dụng với mục đích xác định mối quan hệ trong gia đình và nguồn gốc của các mẫu vật. 20  Microsatellite là các đoạn lặp lại ngắn 3 – 6 bp và kích thước mỗi locus là 15 – 100 bp. Được sử dụng nhiều bởi vì nó đơn giản hơn, phân bố đều trên genome. Các thông tin về đa allele của một locus trên nhiều locus cùng một lúc có thể phân tích một cách đơn giản và nó có thể đủ lớn cho các phương pháp thống kê để đưa ra nhiều thông tin bổ ích về cấu trúc quần thể, phả hệ, khoa học hình sự. Có tính đa dạng rất cao là những allele đồng trội nó có các tính chất cần thiết cho một marker. Tần số đột biến lớn, nó tuân theo quy luật mendel, vị trí của nó trên nhiễm sắc thể có thể xác định được bằng PCR từ một lượng DNA rất nhỏ. Thuận lợi to lớn của phương pháp phân tích SSR này mang lại là biểu hiện số lượng lớn băng đa hình. Có khả năng phân biệt được các cá thể khi có sự kết hợp với các locus làm cho phương pháp này rất hữu dụng trong các thí nghiệm phân tích mối quan hệ di truyền. SSR là marker đồng trội, do đó, dị hợp tử có thể được xác định một cách dễ dàng trong quá trình thực nghiệm. Tính đồng trội của SSR sẽ gia tăng được sự hiệu quả và độ chính xác của các phép toán di truyền quần thể dựa trên những marker này so với những marker khác như RAPD và AFLP. Hơn nữa, việc xác định dị hợp tử ở thế hệ F1 sẽ làm cho những phân tích phả hệ, sự lai giống, dòng gen trở nên dễ dàng hơn. Hạn chế của chỉ thị này là quá trình thiết kế primer chi phí cao liên quan đến trình tự mồi chính xác cho loài quan tâm không hề có sẵn. 21 CHƯƠNG 2. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 2.1. Vật liệu 2.1.1. Vật liệu nghiên cứu Đối tượng nghiên cứu gồm 109 mẫu vỏ cây hoang dã thuộc 5 quần thể loài Vên vên (Anisoptera costata) thu ở rừng phòng hộ Tân Phú (tỉnh Đồng Nai), Khu Bảo tồn Thiên nhiên Đồng Nai (Đồng Nai), Vườn Quốc gia Cát Tiên (Đồng Nai), Vườn Quốc gia Lò Gò – Xa Mát (Tây Ninh) và Vườn Quốc gia Bù Gia Mập (Bình Phước) (Bảng 2.1 và Hình 2.1). Mẫu vỏ cây được thu thập từ cây trưởng thành với đường kính trên 30 cm. Mẫu được thu ngẫu nhiên dọc theo tuyến khảo sát dài khoảng 3 km. Bảng 2.1. Địa điểm và số mẫu thu thập cho nghiên cứu Quần thể Địa điểm Số mẫu Tọa độ Độ cao so với mặt biển (m) TPH Rừng phòng hộ Tân Phú (Đồng Nai) 23 11ᴼ06’ Bắc 107ᴼ25’ Đông 116 – 127 BGM Vườn Quốc gia Bù Gia Mập (Bình Phước) 19 11ᴼ13’ Bắc 107ᴼ10’ Đông 400 – 450 CAT Vườn Quốc gia Cát Tiên (Đồng Nai) 20 11ᴼ44’ Bắc 107ᴼ27’ Đông 110 – 120 MDA Khu Bảo tồn Thiên nhiên và Văn hóa Đồng Nai (Mã Đà) 22 11ᴼ07’ Bắc 107ᴼ09’ Đông 98 – 119 LGXM Vườn Quốc gia Lò Gò – Xa Mát (Tây Ninh) 25 11ᴼ21’ Bắc 106ᴼ02’ Đông 10 – 20 22 Hình 2.1. Bản đồ địa điểm thu mẫu 2.1.2. Thiết bị và hóa chất được sử dụng trong nghiên cứu Cối, chày sứ, ống eppendorf 1,5ml và 2ml, đầu côn pipet các loại đều được hấp vô trùng. Một số thiết bị khác như máy li tâm lạnh, bể điện di và bộ nguồn, máy chụp ảnh gel, máy ổn nhiệt, máy soi UV, máy khuấy (votex) và lò vi sóng. Hóa chất tách chiết đã được sử dụng bao gồm: ni tơ lỏng, CTAB (Cetyl trimethyl ammonium bromide), Tris – HCl (pH = 8,0), NaCl, ETDA (Etylen Diamin Tetra Acetic), hỗn hợp phenol – chloroform – isoamyl alcohol (25:24:1), ethanol 75%, Isopropanol, agarose 0,8%, acrylamide, bis – acrylamide, TAE 1x, loading dye 6x và redgel. 23 2.1.3. Hóa chất và công thức pha Các hóa chất và công thức pha được trình bày ở các bảng dưới đây: Bảng 2.2. Công thức pha dung dịch đệm rửa (washing buffer) 10ml STT Tên hoá chất Nồng độ gốc Nồng độ làm việc Lượng pha 1 Tris – HCl 1 M 100 mM 1000 µl 2 EDTA 0,5 M 5 mM 100 µl 3 Sodium metabisulfit (NaH2PO4) 0,5% 0,05 g 4 H2O Dẫn H2O đến 10 ml Bảng 2.3. Công thức pha đệm CTAB (Cetyl trimethyl ammonium bromide) 10ml STT Tên hoá chất Nồng độ gốc Nồng độ làm việc Lượng pha 1 NaCl 3 M 1,5 M 5000 µl 2 Tris – HCl 1 M 100 mM 1000 µl 3 EDTA 0,5 M 20 mM 400 µl 4 CTAB 4% 0,4 g 5 PVP 10% 1 g 6 H2O Dẫn H2O đến 10 ml 24 2.2. Phương pháp nghiên cứu 2.2.1. Phương pháp thu mẫu và bảo quản mẫu vỏ cây Vên vên Mẫu Vên vên sẽ được thu từ phần thân cây (vỏ cây). Sau khi thu nhận được, mẫu Vên vên sẽ được bảo quản trong túi ni lông chứa silicagel tại thực địa và tủ -20OC trong phòng thí nghiệm trước khi tiến hành tách chiết DNA tổng số. 2.2.2. Phương pháp tách chiết DNA tổng số DNA tổng số được tách chiết từ các mẫu vỏ thân cây theo phương pháp của Doyle & Doyle (1987) có cải tiến cho phù hợp với điều kiện phòng thí nghiệm [41]. 2.2.3. Phương pháp định lượng DNA Quang phổ kế cho phép định lượng tương đối nồng độ DNA có trong mẫu. Vì vậy, DNA tổng số sẽ được định lượng trên máy Nanodrop hoặc điện di trên gel agarose 0,8%. Sau khi loại RNA bằng enzyme RNAase, nồng độ DNA sẽ được pha loãng đến 10ng/µl. 2.2.4. Quy trình tiến hành tách chiết DNA gồm các bước sau đây: Bước 1: Lấy khoảng 200 mg mẫu. Nghiền mẫu với nitơ lỏng bằng cối chày sứ vô trùng thành dạng bột mịn và chuyển ngay vào ống eppendorf 2 ml. Mỗi ống eppendorf chứa khoảng 10mg bột nghiền. Bước 2: Bổ sung 800 µl đệm rửa vào ống eppendorf 2 ml, votex tạo thành dịch đồng nhất. Ly tâm 13000 v/p trong 5 phút. Loại bỏ dịch nổi (lặp lại bước này 1 – 2 lần). Bước 3: Bổ sung 800 µl đệm tách chiết, đảo nhẹ tạo thành hỗn hợp đồng nhất, ủ 1 tiếng ở 65oC (thỉnh thoảng đảo đều). Bước 4: Để nguội 5 phút ở nhiệt độ phòng. Bước 5: Bổ sung 800 µl hỗn hợp phenol : chloroform : isoamylalcohol (25:24:1), votex để tạo thành dịch đồng nhất. Ly tâm 13000 v/p trong 15 phút, hút dịch nổi cho vào ống eppendorf 1,5 ml mới. Bước 6: Bổ sung 800 µl chloroform : isoamylalcohol (24:1), votex để tạo dịch đồng nhất. Ly tâm 13000 v/p trong 15 phút, hút dịch nổi cho vào ống eppendorf 1,5 ml mới. 25 Bước 7: Bổ sung Isopropanol lạnh vào mẫu theo tỷ lệ (Vmẫu : Visopropanol = 1:1) đảo nhẹ để ở tủ - 20ᴼC trong 1 tiếng rưỡi. Bước 8: Sau khi lấy trong tủ âm ra mang đi ly tâm ngay, ly tâm 13000 v/p trong 15 phút ở 4ᴼC, loại bỏ dịch nổi, thu tủa. Bước 9: Bổ sung 700 µl cồn 70%. Ly tâm 13000 v/p trong 15 phút ở 4ᴼC, loại cồn thu tủa (lặp lại từ 1 – 2 lần). Bước 10: Làm khô DNA ở nhiệt độ phòng. Hoà tan DNA trong 100 µl H2O deion. Bước 11: Bổ sung 2 µl RNase (10 mg/ml), ủ ở 37ᴼC trong 1 giờ. Bước 12: Điện di kiểm tra kết quả trên gel Agarose 0,8% Bước 13: Cất mẫu vào tủ lạnh ở - 20ᴼC để bảo quản 2.2.5. Phương pháp PCR Cách tiến hành Nồng độ DNA của các mẫu sẽ được định lượng bằng máy Nanodrop 2000 để khi đưa mẫu vào mỗi ống phản ứng thì thể tích DNA khuôn luôn xấp xỉ nhau trong tổng thể tích 15 µl/phản ứng. Chu trình nhiệt được thực hiện trên máy Gene PCR system 9700 (Bảng 2.5). Phản ứng PCR được tiến hành trong thể tích là 15 µl trong đó chứa các thành phần và nồng độ của các chất tham gia phản ứng được trình bày ở bảng 2.4. Bảng 2.4. Các thành phần phản ứng PCR Thành phần phản ứng Thể tích (µl) Nước khử ion vô trùng 1 Master Mix Dream Taq Green 2X 7,5 Primer SSR_F (100 pmol/µl) 1,25 Primer SSR_R (100 pmol/µl) 1,25 DNA mẫu 4 Tổng thể tích 15 26 Bảng 2.5. Chu trình phản ứng PCR Bước Phản ứng Nhiệt độ (ᴼC) Thời gian Chu kỳ 1 Biến tính 94 3 phút 35 2 Biến tính 94 30 giây 3 Gắn mồi 54 30 giây 4 Kéo dài chuỗi 72 30 giây 5 Hoàn tất kéo dài chuỗi 72 10 phút 6 Kết thúc phản ứng 4 ∞ Bảng 2.6. Trình tự mồi sử dụng trong nghiên cứu đa dạng di truyền loài Vên vên TT Mồi Trình tự mồi (5’-3’) Số nucleotide lặp lại Kính thước sản phẩm (bp) Nhiệt độ bắt cặp (OC) Nguồn trích dẫn 1 Dipt1 F: ATGCTTACCACCAATGTGAATG R: CTCGCAGCAGAACAACTTTCTA (GA)6 117 – 153 54 Isagi et al., 2002 2 Dipt2 F: TAGGGCATATTGCTTTCTCATC R: CTTATTGCAGTCATCAAGGGAA (AG)15 219 – 249 54 Isagi et al., 2002 3 Dipt3 F: TGGCAAACAAGCTACTGTTCAT R: CAT GGG TTAGCAACCTACACA (TA)8 169 – 205 52 Isagi et al., 2002 4 Dipt4 F: CTT CCC TAA ATT CCC CAA TGT T R: TAATGGTGTGTGTACCAGGCA (AG)15 198 – 216 55 Isagi et al., 2002 5 Dipt5 F: ACAATGAAACTTGACCACCCAT R: CAAAAGGACATACCAGCCTAGC (GA)24 212 – 240 55 Isagi et al., 2002 6 Dipt6 F: GCT ATT GGC AAG GAT GTT CA R: CTT ATG AGA TCA ATT TGA CAC (CT)8(CA)10 CT(CA)4CTCA 148 – 212 56 Terauchi, 1994 7 Dipt7 F: ATG TCC ATG TTT GAG TG R: CAT GGA CAT AAG TGG AC (CT)8CA(CT)5 CACCC(CTCA)3 CT(CA)10 168 – 218 54 Isagi et al., 2002 8 Dipt8 F: ATC TGT TCT TCT ACA AGC C R: TTA GAA CTT GAG TCA GAT AC (CT)4TT(CT)5 156 – 192 54 Ujino et al., 1998 27 2.2.6. Phương pháp điện di Điện di trên gel agarose Điện di trên gel áp dụng trong sinh học phân tử là một kĩ thuật để phân tích các phân tử DNA, RNA hay protein dựa trên các đặc điểm vật lý của chúng như kích thước, hình dạng hay điểm đẳng điện tích (isoelectric point). Kĩ thuật này sử dụng một dung dịch đệm (buffer) để dẫn diện và tạo điện trường đều, một bản gel (thường là agarose hay polyacrylamide) đóng vai trò là thể nền để phân tách các phân tử, và các chất nhuộm khác nhau (ethidium bromide, bạc, xanh Coomassie) để phát hiện vị trí các phân tử trên gel sau khi điện di. Kĩ thuật điện di hoạt động nhờ vào lực kéo của điện trường tác động vào các phân tử tích điện và kích thước lỗ của thể nền (gel). DNA là đại phân tử sinh học mang điện tích âm, khi đặt trong môi trường có điện trường các phân tử DNA có kích thước khác nhau sẽ di chuyển từ cực âm sang cực dương với tốc độ khác nhau tùy thuộc vào kích thước. Gel agarose là loại gel được sử dụng phổ biến và thông dụng nhất, thao tác đơn giản, thường được sử dụng để phân tích những đoạn DNA có kích thước khoảng 0,5 – 20 kb. Chúng tôi thực hiện điện di kiểm tra DNA tổng số và sản phẩm PCR trên gel Agarose 0,8%; sử dụng đệm TAE 1X, nhuộm gel bằng GelRedTM Nucleic Acid gel Stain, thực hiện trên thiết bị điện di của hãng Biorab. Điện di gel Polyacrylamide. Điện di sản phẩm PCR trên gel Polyacrylamide 6% trong 100 ml dung dịch đệm TAE 1X, nhuộm bằng GelRedTM Nucleic Acid gel Stain và chụp ảnh trên máy soi gel của hãng CLEARVER. Các bước tiến hành pha nồng độ gel polyacrylamide 6% như sau: - Chuẩn bị dung dịch: 30% acrylamide (gồm bis – acrylamide), TAE 1X, 10% ammonium persulphate. - Lau sạch hai tấm kính dùng làm khuôn gel và miếng đêṃ bằng KOH/methanol hoặc ethanol. Xử lý bề mặt của hai tấm kính bằng dung dịch silicon để ngăn gel dính chặt vào hai tấm kính gây rách gel lúc lấy nó ra khỏi khuôn sau khi điện di xong. 28 - Tính toán thể tích của các dung dịch dùng để tạo polyacrylamide gel trên cơ sở kích thước tấm kính, độ dày của miếng đệm. - Bổ sung 20 µl TEMED vào mỗi 60 ml dung dịch tạo polyacrylamide gel, trộn hỗn hợp bằng cách vortex. Rót dung dịch tạo gel vào giữa hai tấm kính. Gắn nhanh lược vào, tránh bọt khí ở răng lược (giếng). Đỉnh của răng lược phải hơi cao hơn mép gel. Nếu cần, bổ sung một ít dung dịch tạo gel để làm đầy mép gel. - Cho phép acrylamide polymer hóa trong khoảng 60 phút ở nhiệt độ trong phòng, bổ sung thêm dung dịch tạo gel nếu thấy gel co vào nhiều. - Sau khi polymer hóa hoàn toàn, rút lược cẩn thận, tháo băng dính ra khỏi đáy khuôn gel. Gắn khuôn gel vào buồng điện di và làm đầy buồng điện di bằng đệm TAE 1X, dùng pipette để phá các bọt khí ra khỏi đáy gel và các giếng bằng đệm TAE 1X. - Trộn các mẫu DNA với một lượng thích hợp của đệm 6x gel – loading dye. Đặt mẫu vào trong giếng bằng micropipette. - Đưa bản gel vào bể điện di trong khoảng 1 tiếng rưỡi với hiệu điện thế 120V và cường độ dòng điện là 150V. - Chụp ảnh gel dưới đèn UV. 2.2.7. Mã hóa số liệu và xử lí số liệu Mã hóa số liệu Để có thể mã hóa số liệu phân tích hình ảnh điện di đồ, cần phải nhập số liệu vào file excel. Sau đó, sử dụng một số phần mềm như GenAlex 6.5 hay Structure 3.2.1, để đọc số liệu. Ở phần mềm này, việc kí hiệu sự suất hiện allele thường là kích thước allele. Mã hoá các phổ điện di cho mỗi bản gel được tiến hành cẩn thận và thí nghiệm được lặp lại cho đến khi đạt được kết quả Xử lí số liệu Việc kiểm định giả thiết cho các locus đa hình và giữa các quần thể được thực hiện ở mức ý nghĩa p = 0,05 và phân tích AMOVA (analysis of molecular variance) nhằm xác định sự khác biệt di truyền giữa các quần thể nghiên cứu. 29 Đánh giá các thông số đa dạng di truyền quần thể của loài Vên vên nghiên cứu, bao gồm: Tần số allele, số allele trung bình (NA) cho mỗi locus, hệ số gen dị hợp tử quan sát (HO), hệ số gen dị hợp tử kỳ vọng (HE), hệ số tương đồng và hệ số khoảng cách di truyền giữa các quần thể, và mức độ khác nhau giữa các quần thể (FST) được thực hiện bằng phần mềm GenAIEx [42] và phần mềm Arlequin 3.1 [43]. Giá trị FISIIM (hệ số cận noãn) được hiệu đính cho tần số alen lặn trên cơ sở mô hình cận noãn cho mỗi cá thể (Individual In breeding Model – IIM) sử dụng phần mền INEst [44]. Hiệu quả của mỗi cặp mồi sẽ được phân tích thông qua các chỉ số PIC (Polymorphism Information Content – hàm lượng thông tin) được xác định bằng phần mềm CERVUS. Sử dụng 2 mô hình đột biến TPM (two – phase model) và SSM (stepwise mutation model) để đánh giá hiện tượng thắt cổ chai của quần thể bằng phần mềm BOTTLENECK v.1.2 [45]. Phân tích cấu trúc quần thể và loài, chúng tôi sử dụng phần mềm STRUCTURE [46] và STRUCTURE HARVER [47]. Xác định nhóm gen phù hợp dựa trên gía trị ΔK của Evanno et al. (2005) [48]. 30 CHƯƠNG 3. KẾT QUẢ NGHIÊN CỨU VÀ THẢO LUẬN 3.1. Kết quả tách chiết DNA tổng số và điện di sản phẩm PCR Tách chiết DNA là bước đầu tiên và rất quan trọng trong nghiên cứu sinh học phân tử nói chung. Tách chiết DNA tổng số nhằm mục đích thu nhận DNA ra khỏi cấu trúc tế bào. Điều quan trọng nhất là thu nhận được DNA ở trạng thái còn nguyên vẹn không bị phân hủy và không lẫn nhiều tạp chất để có nguồn nguyên liệu chất lượng tốt cho các thí nghiệm tiếp theo. Các mẫu vỏ của các cây Vên vên đã được tách chiết theo phương pháp CTAB các bước tiến hành như mục 2.2.4 ở chương 2. Hình 3.1. Kết quả điện di DNA tổng số tách chiết từ một số mẫu vỏ cây Vên vên thu ở rừng nhiệt đới Đông Nam Bộ trên gel agarose 0,8% DNA tổng số của 109 mẫu vỏ thân cây trưởng thành thuộc 5 quần thể ở rừng nhiệt đới Đông Nam Bộ (Hình 3.1) đã được tách chiết thành công với chất lượng DNA cao. 31 Hình 3.2. Sản phẩm điện di PCR trên gel polyacrylamide 6% với một số mồi A: Dipt01, B: Dipt02, C: Dipt03, D: Dipt04; M: marker phân tử 100bp; giếng 1 – 24 thứ tự của các mẫu Vên vên Kết quả điện di kiểm tra DNA trên gel agarose 0,8% cho thấy DNA tổng số thu được khá tốt, DNA không bị đứt gãy. DNA tổng số của một số mẫu được trình bày ở hình 3.1. Kết quả đo OD cho chỉ số OD260/OD280 của các mẫu luôn nằm trong khoảng 1,8 đến 2,0 (chỉ số cho biết dung dịch DNA có độ tinh khiết cao). 32 Để đánh giá mức độ đa dạng di truyền quần thể và loài của 109 cá thể thu được từ 5 quần thể loài Vên vên (A. costata) chúng tôi tiến hành nghiên cứu với 8 cặp mồi SSR (Bảng 2.6). Sau khi hoàn thành phản ứng PCR, sản phẩm được điện di trên gel polyacrylamide 6% để phân tích đa hình DNA của các mẫu nghiên cứu. Hình ảnh các băng vạch xuất hiện trên bản điện di sau đó được chụp lại trên máy soi gel của hãng CLEARVER.. Hình ảnh điện di sản phẩm PCR trên gel polyacrylamide 6% của một số cá thể thu được từ 5 quần thể loài Vên vên ở Đông Nam Bộ với một số cặp mồi SSR được trình bày ở hình 3.2. 3.2. Đánh giá hiệu quả chỉ thị marker SSR Với 8 cặp mồi microsatellite, đã xác định được 23 allele khác nhau, với kích thước dao động từ 117 bp đến >300 bp. Tám locus nghiên cứu đều cho kết quả đa hình với loài Vên vên nghiên cứu. Số allele trung bình 2,5 cho một locus. Dao động từ 2 allele ở locus Dipt3, Dipt5 và Dipt8 tới 4 allele ở locus Dipt2 và Dipt6. Allele lặn cho mỗi locus được trình bày ở bảng 3.1. Kết quả chỉ ra 7 locus đều có allele lặn, trừ locus Dipt4. Tần số allele lặn dao động từ 0,005 ở Dipt7 đến 0,146 ở Dipt1. Giá trị PIC đã cũng được xác định cho 8 locus đa hình (Bảng 3.1). Hệ số PIC (Polymorphic Information Content) phản ánh khả năng cho đa hình của các cặp mồi SSR. Hệ số PIC của cặp mồi nào cao thì khả năng cho đa hình càng cao và ngược lại. Giá trị PIC được tính toán cho tất cả các cặp mồi SSR đa hình. Giá trị PIC thấp nhất (0,204) được tìm thấy ở cặp mồi Dipt4 và cao nhất (0,413) được tìm thấy ở cặp mồi Dipt6; giá trị PIC trung bình là 0,31. 33 Bảng 3.1. Số allele,tần số allele lặn và giá trị PIC cho 8 locus Mồi Trình tự mồi (5’-3’) Kính thước sản phẩm (bp) Nhiệt độ bắt cặp (OC) Số allele PIC Allele lặn Dipt1 F: ATGCTTACCACCAATGTGAATG R: CTCGCAGCAGAACAACTTTCTA 117 – 153 54 3 0,407 0,146 Dipt2 F: TAGGGCATATTGCTTTCTCATC R: CTTATTGCAGTCATCAAGGGAA 219 – 249 54 4 0,359 0,097 Dipt3 F: TGGCAAACAAGCTACTGTTCAT R: CAT GGG TTAGCAACCTACACA 169 – 205 52 2 0,214 0,087 Dipt4 F: CTT CCC TAA ATT CCC CAA TGT T R: TAATGGTGTGTGTACCAGGCA 198 – 216 55 3 0,204 no Dipt5 F: ACAATGAAACTTGACCACCCAT R: CAAAAGGACATACCAGCCTAGC 212 – 240 55 2 0,246 0,099 Dipt6 F: GCT ATT GGC AAG GAT GTT CA R: CTT ATG AGA TCA ATT TGA CAC 148 – 212 56 4 0,413 0,084 Dipt7 F: ATG TCC ATG TTT GAG TG R: CAT GGA CAT AAG TGG AC 168 – 218 54 3 0,403 0,005 Dipt8 F: ATC TGT TCT TCT ACA AGC C R: TTA GAA CTT GAG TCA GAT AC 156 – 192 54 2 0,229 0,143 Kết quả giá trị PIC này của loài Vên vên trung bình 0,309, giá trị này cao hơn so với loài Dầu mít (Dipterocarpus costatus) cũng ở rừng nhiệt đới Tân Phú [49]. Giá trị này đã phản ánh các cặp mồi SSR nghiên cứu đã cung cấp những thông tin có giá trị về đặc điểm của Vên vên ở rừng nhiệt đới Đông Nam Bộ. 3.3. Kết quả phân tích đa dạng di truyền loài Vên vên 3.3.1. Tần số allele của các cặp SSR ở mức độ quần thể Số allele trong một locus bao gồm từ 2 allele ở 3 locus Dipt8, Dipt5 và Dipt3; 3 allele ở 3 locus Dipt1, Dipt4 và Dipt7; và 4 allele ở 2 locus còn lại, Dipt2 và Dipt6. Từ bảng 3.2 đã chỉ ra sự khác biệt giữa các allele trong mỗi locus tại những quần thể khác nhau. 34 Bảng 3.2. Tần số allele cho mỗi locus của 5 quần thể ở Đông Nam Bộ Locus Allele Quần thể BGM CAT MDA TPH LGXM Dipt1 N 19 20 22 23 25 117bp 0,605 0,750 0,614 0,500 0,160 133bp 0,395 0,250 0,386 0,500 0,740 153bp 0,000 0,000 0,000 0,000 0,100 Dipt2 N 19 20 22 23 25 169bp 0,000 0,175 0,045 0,130 0,040 177bp 0,7

Các file đính kèm theo tài liệu này:

  • pdfluan_van_danh_gia_tinh_da_dang_di_truyen_loai_ven_ven_anisop.pdf
Tài liệu liên quan