Luận văn Phân lập vi khuẩn khử sulphate (srb) để ứng dụng trong xử lý nước thải axit từ hoạt động khai thác khoáng sản

 

MỞ ĐẦU.1

Chương 1 – TỔNG QUAN TÀI LIỆU.2

1.1. AMD (Acid Mine Drainage) và các vấn đề môi trường liên quan .2

1.1.1. Sự hình thành AMD .2

1.1.2. Ảnh hưởng của AMD tới môi trường .5

1.1.2.1. Ô nhiễm nguồn nước do AMD .5

1.1.2.2. Ô nhiễm đất do AMD 6

1.1.2.3. Tình trạng ô nhiễm do AMD ở Việt Nam 8

1.1.2.4. Hiện trạng quản lý và xử lý AMD ở Việt Nam .11

1.2. Xử lý AMD 12

1.2.1. Xử lý AMD bằng phương pháp hóa học .12

1.2.2. Xử lý AMD bằng phương pháp sinh học 13

1.2.2.1. Cơ sở khoa học của công nghệ .13

1.2.2.2. Một số quy trình công nghệ xử lý AMD nhờ SRB 14

1.2.2.3. Các yếu tố ảnh hưởng tới quá trình xử lý AMD bằng SRB.16

1.3. Đặc tính sinh học của SRB.18

1.3.1. Phân bố của SRB trong tự nhiên.19

1.3.2. Đa dạng về di truyền của SRB.20

1.3.3. Đặc điểm sinh lý của SRB.22

1.3.3.1. Nhu cầu dinh dưỡng của SRB.22

1.3.3.2. Các yếu tố ảnh hưởng tới sinh trưởng của SRB.23

 

doc81 trang | Chia sẻ: mimhthuy20 | Lượt xem: 570 | Lượt tải: 0download
Bạn đang xem trước 20 trang tài liệu Luận văn Phân lập vi khuẩn khử sulphate (srb) để ứng dụng trong xử lý nước thải axit từ hoạt động khai thác khoáng sản, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
omate hay uranium, các hợp chất chứa clo, theo đó mà SRB có vai trò quan trọng trong các quá trình phân hủy sinh học, loại bỏ chất độc ô nhiễm trong môi trường (Muyzer và Stams, 2008). 1.3.3.2. Các yếu tố ảnh hưởng tới sinh trưởng của SRB Nhiệt độ, pH, độ muối. SRB có thể sinh trưởng trong dải pH rộng (5,5 – 9,0), tuy nhiên tốt nhất ở điều kiện kiềm nhẹ với pH trong khoảng 7,0 – 7,8 (Pfennig và cs, 1981). Nhiệt độ sinh trưởng tối ưu nằm trong khoảng 28 – 38°C đối với SRB ưa ấm (Widdel, Pfennig, 1984). Dải muối từ 1 – 4% NaCl thích hợp đối với sự sinh trưởng của hầu hết SRB (Ollivier và cs, 1994). Tuy nhiên, quá trình khử sulfate do vi khuẩn còn được quan sát ở các môi trường khắc nghiệt có nhiệt độ, pH hay độ mặn đặc biệt (Zeikus và cs, 1983). Nồng độ sulfide. Sulfide có tính độc cao đối với tế bào sinh vật, gây phá hủy các protein và bất hoạt tế bào (Postgate, 1984). Phần lớn vi sinh vật chỉ có khả năng hoạt động ở môi trường không có sulfide hoặc sulfide ở nồng độ thấp. Đối với SRB, sự kết tủa các kim loại nguyên tố vết ở dạng sulfide kim loại là cần thiết để giảm nồng độ sulfide trong môi trường, tạo điều kiện cho sự sinh trưởng (Bharathi và cs, 1990). Ngoài ra, các polymer ngoại bào ở SRB có tác dụng bảo vệ tế bào khỏi sự ảnh hưởng của chất độc ở mức độ nhất định (Teitzel and Parsek, 2003). Trạng thái của sulfide phụ thuộc vào pH của môi trường. Tại pH 7, sulfide tồn tại ở cả dạng H2S và S2-, nhưng chủ yếu là ở dạng H2S (Perry và Green, 1984). Theo Speece (1983), trong hai dạng tồn tại của sulfide chỉ có H2S có khả năng đi vào trong màng tế bào và gây ức chế. 1.3.3.3. Cạnh tranh của SRB với các nhóm vi khuẩn khác trong môi trường Trong môi trường kỵ khí có thế oxy hóa khử thấp và có sẵn nguồn cơ chất phù hợp, SRB cạnh tranh với các vi sinh vật kỵ khí khác như vi khuẩn khử nitrate, vi khuẩn khử Fe(III), vi khuẩn sinh acetate và cổ khuẩn sinh metan (methanogens) (hình 1.5). Cặp oxy hóa khử SO42-/HS- ở mức khoảng -0,2 mV, sau các cặp O2/H2O, NO3-/N2, Fe3+/Fe2+, có nghĩa là năng lượng tạo ra khi oxy hóa một chất hữu cơ bằng sulfate sẽ thấp hơn so với oxy hóa bằng oxy, nitrate hay Fe(III). Tuy nhiên thế oxy hóa khử và hàm lượng sulfate trong môi trường có thể quyết định khả năng cạnh tranh của quá trình khử sulfate với các quá trình khác (Schink và cs, 2006). Bên cạnh đó, sản phẩm trao đổi chất sulfide của SRB còn là yếu tố ức chế thứ cấp đối với các loài vi sinh vật khác khi sinh trưởng trên cùng một loại cơ chất (Stams và cs, 2003). Hình 1.5. Các cặp oxy hóa khử quan trọng của chu trình chuyển hóa vật chất trong tự nhiên (Thauer và cs, 1977) Đối với cổ khuẩn sinh methane, SRB sẽ cạnh tranh về các cơ chất chung như hydro và acetate. Trong trường hợp thế oxy hóa khử thấp hơn - 0,2 mV thì methanogen chiếm ưu thế do có ái lực với cơ chất cao hơn SRB (Schink và cs, 2006). Tuy nhiên, nếu hàm lượng sulfate trong môi trường ở mức cao thì SRB vẫn có thể cạnh tranh được với methanogen để sử dụng nguồn cơ chất cho quá trình khử sulfate thành sulfide (Brysch và cs, 1987; Weijma và cs, 2002). Giữa các loài SRB, Desulfovibrio spp. có ái lực cao nhất với sulfate, tiếp đó là các loài Desulfobulbus và Desulfobacter (Laanbroek và cs, 1984). Chương 2 – NGUYÊN VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 2.1. Nguyên vật liệu 2.1.1. Các mẫu nước thải Mẫu nước thải để làm giàu SRB được thu thập từ một số hệ thống xử lý nước thải ở điều kiện kỵ khí tại Quảng Ngãi, Bình Dương, và Bắc Ninh. Mẫu nước thải AMD để thử nghiệm xử lý trong mô hình phòng thí nghiệm được thu thập từ mỏ than Tràng Khê, Quảng Ninh. 2.1.2. Hóa chất Các hóa chất được sử dụng trong nghiên cứu vi sinh vật đều là những hóa chất có tiêu chuẩn chất lượng cao của các hãng cung cấp lớn như Merck, Sigma. Hóa chất và một số kit dùng cho sinh học phân tử do các hãng Bioneer – Hàn Quốc, Fermentas – Đức, Qiagen – Mỹ, ABI – Mỹ, BioRad – Mỹ cung cấp. 2.1.3. Thiết bị, dụng cụ Nghiên cứu được thực hiện tại phòng Sinh thái Vi sinh vật, Viện Vi sinh vật và Công nghệ sinh học – ĐHQGHN, sử dụng các thiết bị chuyên môn dùng trong vi sinh vật học, sinh học phân tử và hóa phân tích đạt tiêu chuẩn quốc tế. Bể ổn nhiệt Jeio Tech, Hàn Quốc Máy đo pH Horiba, Nhật Bản Máy ly tâm Eppendoff, Đức Máy ly tâm siêu tốc Beckman Counter, Mỹ Máy PCR Eppendoff, Đức Máy điện di ngang Nyx Technik, Mỹ Máy DGGE DcodeTM universal Mutation Detection System BioRad, Mỹ Máy GelDoc BioRad, Mỹ Máy đo quang phổ UV – Vis (GBC instrument, Úc) Kính hiển vi quang học Olympus, Nhật Bản Kính hiển vi phản pha và huỳnh quang Zeiss, Đức Ngoài ra, một số thiết bị, dụng cụ cần thiết khác được sử dụng trong quá trình nuôi cấy vi khuẩn kỵ khí như bình N2, CO2, ống nghiệm nút xoáy, pipet pasteur, bình serum, nút cao su, bình duran, màng lọc vi khuẩn 2.2. Phương pháp nghiên cứu 2.2.1. Làm giàu và phân lập SRB Bảng 2.1. Môi trường khoáng nước ngọt dành cho vi khuẩn khử sulfate (Widdel, Bak, 1992) Thành phần Nước cất 1 lít Na2SO4 4 g NaCl 1 g MgCl2.6H2O 0,4 g CaCl2.2H2O 0,15 g KCl 0,5 g MgSO4.7H2O 0,25 g NH4Cl 0,25 g KH2PO4 0,2 g Khử trùng môi trường ở 121oC, lấy ra ở 80oC, sục khí N2 trong 5 phút, làm nguội, sau đó bổ sung các chất sau (đã khử trùng riêng) (ml/lít môi trường): Hỗn hợp vitamin (bảng 2.2) 1 ml Hỗn hợp vi lượng (bảng 2.2) 1 ml Vitamin B1 (Thiamin) 1 ml Vitamin B12 1 ml Na- Lactate 1 M 10 ml NaHCO3 1 M 30 ml Chỉnh pH ở 7 – 7,2, sau đó san môi trường sang các bình serum hoặc ống nghiệm rồi sục khí N2 trong 30 giây, đậy bình và ống nghiệm bằng nút cao su có kẹp nhôm hay nút vặn có lỗ hở, sử dụng ngay hoặc bảo quản trong tối. Bảng 2.2. Thành phần hỗn hợp vi lượng và vitamin (Widdel, Bak, 1992) Hỗn hợp vi lượng Hỗn hợp Vitamin (trong đệm phosphate) Thành phần mg/Lít Thành phần mg/100 ml đệm HCl 25% (7,7 M) 13 ml Na2HPO4/NaH2PO4 25 mM pH 7,1: 100 ml FeSO4.7H2O 200 4-Aminobenzoic acid 4 H3BO3 30 D(+)- Biotin (Vitamine H) 1 MnCl2.4H2O 100 Nicotinic acid (Niacin) 10 CoCl2.6H2O 190 Calcium-D(+)- Pantothenat 5 NiCl2.6H2O 24 Pyridoxin 2 HCl 15 CuCl2.2H2O 2 Lipoic acid 1,5 ZnSO4.7H2O 144 Folic acid 4 Na2MoO4.2H2O 36 Na-2- Mercaptoethan sulfonat 25 Thêm nước cất đến 1000 ml Làm giàu SRB. SRB trong mẫu nước thải thu thập về được làm giàu bằng cách cấy vào bình serum chứa môi trường dịch thể kỵ khí nước ngọt cho vi khuẩn khử sulfate (bảng 2.1) với tỷ lệ 10%, nuôi trong tủ ấm 30oC. Các lần cấy truyền tiếp theo được tiến hành sau mỗi 5 – 7 ngày nuôi cấy theo tỷ lệ 10% thể tích. Qua mỗi lần cấy truyền, số lượng SRB trong mẫu được tăng lên. Phân lập SRB. Mẫu làm giàu lần 4 được dùng để phân lập SRB. Việc phân lập được tiến hành theo phương pháp pha loãng trên dãy ống thạch bán lỏng (1%) với môi trường có thành phần tương tự môi trường dùng trong làm giàu (Widdel, Bak, 1992). Ống thạch bán lỏng sau khi bổ sung nguồn vi sinh vật (10%) từ mẫu làm giàu được sục khí N2 và ủ ở tư thế đảo ngược tại 30oC trong bóng tối. Khuẩn lạc đơn phát triển trong các ống pha loãng được tách bằng pipet Pasteur và chuyển sang môi trường dịch thể. 2.2.2 Xác định điều kiện sinh trưởng tối ưu Nhiệt độ. Các chủng SRB thuần khiết được nuôi cấy trong môi trường dịch thể kỵ khí có pH = 7, ở các nhiệt độ: 15oC, 20oC, 25oC, 30oC, 37oC. Sinh trưởng của SRB được đánh giá thông qua xác định nồng độ sulfide và sinh khối (OD600) theo thời gian (được xác định 1 lần/ngày trong 5 ngày). pH. Các chủng SRB thuần khiết và hỗn hợp chủng SRB được nuôi cấy trong môi trường dịch thể kỵ khí có pH khác nhau: pH 4, pH 5, pH 6, pH 7, pH 8 trong tủ ấm 30oC. Sinh trưởng của SRB được đánh giá thông qua xác định nồng độ sulfide và sinh khối (OD600) theo thời gian (được xác định 1 lần/ngày trong 5 ngày). Độ muối. Các chủng SRB thuần khiết được nuôi trong môi trường dịch thể kỵ khí ở pH 7, có độ muối khác nhau là 0, 1, 5, 10, 15, 20, 25 g/l. Sinh trưởng của SRB được đánh giá thông qua xác định nồng độ sulfide và sinh khối (OD600) theo thời gian (được xác định 1 lần/ngày trong 5 ngày). Chất cho điện tử. Các chủng SRB thuần khiết được nuôi cấy trong môi trường dịch thể kỵ khí có bổ sung các chất cho điện tử khác nhau như lactate, acetate, methanol (10 mM mỗi loại) và sulfate (28 mM) là chất nhận điện tử duy nhất. Sinh trưởng của SRB được đánh giá sau 5 ngày nuôi cấy thông qua xác định nồng độ sulfide và sinh khối (OD600). Chất nhận điện tử. Các chủng SRB thuần khiết được nuôi cấy trong môi trường dịch thể kỵ khí có bổ sung lactate (10 mM) là chất cho điện tử và một trong các chất nhận điện tử khác như Fe(III)-citrate (20 mM), Na-nitrate (5 mM). Dịch nuôi với sulfate (28 mM) là đối chứng dương. Sinh trưởng của SRB được đánh giá sau 5 ngày nuôi cấy thông qua xác định sinh khối (OD600). 2.2.3. Tách DNA tổng số từ mẫu môi trường và chủng thuần khiết DNA tổng số của mẫu làm giàu và các mẫu thí nghiệm xử lý AMD trên mô hình được tách chiết theo phương pháp do Zhou và cộng sự (1996) mô tả với cải biến về nồng độ đệm phosphate (tăng từ 100 mM lên 120 mM) trong đệm tách (gồm: 100 mM Tris (pH 8);100 mM EDTA (pH 8); 120 mM đệm phosphate (Na2HPO4/NaH2PO4); 1,5 M NaCl; 1% CTAB). Các bước tiến hành như sau: Trộn 2 ml mẫu môi trường với 5,4 ml đệm tách DNA trong ống falcol 15 ml. Phá tế bào bằng phương pháp sốc nhiệt trong nitơ lỏng và bể ổn nhiệt ở 37oC, lặp lại 5 lần. Bổ sung 40 µl proteinase K (10 mg/ml), lắc ngang với tốc độ 225 vòng/phút trong 30 phút ở 37oC. Thêm 600 µl SDS (20%), ủ ở 65oC trong 2 giờ, 25 phút đảo lộn đầu một lần. Bổ sung với lượng tương đương PCI về thể tích, sau đó trộn đều. Ly tâm 6000 vòng/phút trong 10 phút ở nhiệt độ phòng. Thu lấy phần dịch phía trên sang ống mới, lặp lại bước trên 1 lần. Thu lấy phần dịch phía trên sang ống mới, bổ sung 0,6 lần thể tích isopropanol, ủ ở nhiệt độ phòng trong 1 giờ. Ly tâm thu kết tủa DNA ở 12000 vòng/ phút trong 25 phút ở nhiệt độ phòng. Đổ phần dịch ở trên, rửa kết tủa với 10 ml ethanol 80%, ly tâm 12000 vòng/phút trong 15 phút ở nhiệt độ phòng. Đổ ethanol, để khô ở nhiệt độ phòng. Hòa tan DNA trong 50 µl nước MQ đã khử trùng, chuyển DNA sang ống eppendorf 1,5 ml và giữ ở -20oC. DNA genome của chủng thuần khiết được tinh sạch theo phương pháp của Marmur (1961), gồm các bước như sau: 1 ml dịch tế bào được ly tâm 5000 – 10 000 vòng/ phút trong 5 phút, sau đó rửa với 1 ml đệm TE (pH 8) rồi hòa tế bào trong 0,5 ml 5 mM EDTA (pH 8). Thêm 50 µl lysozym (40 mg/ml), trộn đều, ủ trong bể ổn nhiệt ở 37oC trong 1 giờ. Thêm 50 µl SDS (20%) và 50 µl proteinase K (4 mg/ml), trộn đều và ủ trong bể ổn nhiệt ở 55oC trong 1 giờ. Thêm 400 µl PCI, trộn đều trong 1- 3 phútt, ly tâm 13000 vòng/phút ở 4oC trong 15 phút. Lặp lại bước vừa rồi thêm 1 lần. Chuyển lớp dịch trong ở trên sang ống eppendorf mới. Thêm 1/10 thể tích dung dịch 3M Na-acetate (pH 5,2) và 2 lần thể tích dung dịch 2-propanol (đó để lạnh -20oC), trộn đều và giữ ở -20oC trong vòng 15 phút đến 1 giờ. Ly tâm 13000 vòng/phút ở 4oC trong 15 phút, chắt phần dịch phía trên để thu kết tủa DNA. Rửa DNA trong ethanol 70% (đó để lạnh -20oC) trong 1 phút, ly tâm 13 000 vòng/ phút, đổ cồn, làm khô DNA ở nhiệt độ phòng. Hòa tan DNA trong 50 µl MQ vô trùng (hoặc đệm TE) và bảo quản tại -20°C cho các thí nghiệm tiếp theo. Sản phẩm DNA được kiểm tra trên gel agarose 1% trong đệm TAE tại 100 V trong thời gian 15 phút. Sau khi điện di, gel agarose được nhuộm trong dung dịch ethidium bromide (5 mg/ml) trong 15 phút, sau đó rửa nước và chụp ảnh dưới tia UV trên máy GelDoc (BioRad). 2.2.4. Phương pháp điện di biến tính DGGE Hình 2.1. Vị trí đoạn gen 16S rDNA được sử dụng trong phân tích DGGE ở Lactobacillus plantarum (Lopez và cs, 2003). Khuếch đại đoạn gen 16S rDNA (550 bp). Vùng V3 - V5 của gen 16S rDNA với độ dài 550 bp (hình 2.1) được khuếch đại trong phản ứng PCR sử dụng cặp mồi GM5F (CCTACGGGAGGCAGCAG) và 907R (CCGTCAATTCCTTTRAGTTT) (Muyzer và cs, 1993). Để tạo tính ổn định cho việc phân tách các trình tự DNA trên gel điện di biến tính, kẹp GC gồm 40 bp (CGCCCGCCGCGCGCGGCGGCCGGGGCGGGGGCACGGGGGG) được gắn vào đầu 5’ của mồi GM5F. “Touch-down” PCR (bảng 2.5) được sử dụng để tăng độ đặc hiệu và giảm sự hình thành các sản phẩm phụ. Bảng 2.5. Thành phần phản ứng và chu kỳ nhiệt của PCR cho DGGE. Thành phần phản ứng Thể tích (µl) Chu kỳ nhiệt của “touch-down” PCR H2O MQ 27 Taq polymerase được đưa vào phản ứng sau bước biến tính đầu tiên ở 94○C trong 1 phút khi nhiệt độ đạt 80○C. Nhiệt độ gắn mồi được đặt cao hơn 10○C so với nhiệt độ lý thuyết (tức là 65○C). Sau mỗi chu kỳ, nhiệt độ gắn mồi giảm đi 0,5○C cho tới khi đạt tới 55○C, ở nhiệt độ này phản ứng tiến hành thêm 15 chu kỳ. Thời gian kéo dài chuỗi của mồi là 3 phút. 10x Taq buffer 5 BSA (3 mg/ml) 5 MgCl2 (20 mM) 4 dNTP (2,5 mM mỗi loại) 4 Mồi GM5F-GC (50 pmol/µl) 1 Mồi 907R (50 pmol/µl) 1 DNA khuôn 2 Taq polymerase (5 u/µl) 1 Tổng thể tích phản ứng 50 DGGE. Điện di được tiến hành trên gel polyacrylamide 6% với dải biến tính urea/formamid từ 30% đến 60%. Quá trình điện di được thực hiện bằng bộ điện di DcodeTM System (BioRad) trong đệm TAE, ở nhiệt độ 60°C, tại 200 V, trong 3,5 giờ. Sau khi điện di, gel polyacrylamide được nhuộm trong dung dịch ethidium bromide (5 mg/ml) trong 30 phút, sau đó rửa nước và chụp ảnh dưới tia UV trên máy GelDoc (BioRad). Cắt băng và thôi gel. Băng điện di được cắt, rửa và thôi trong nước qua đêm tại 4°C. Dịch thôi DNA được dùng làm khuôn để thực hiện phản ứng PCR như chu trình nhiệt của phản ứng PCR cho DGGE (bảng 2.5) với cặp mồi GM5F (không có kẹp GC) và 907R. Sản phẩm PCR tiếp theo được tinh sạch bằng kít (Bioneer, Hàn Quốc) và giải trình tự. 2.2.5. Giải trình tự gen 16S rDNA và dựng cây phân loại Gen 16S rDNA (~1500 bp) của các chủng SRB thuần khiết được khuếch đại trong phản ứng PCR sử dụng cặp mồi 27F (AGAGTTTGATCCTGGCTCAG) và 1492R (GGTTACCTTGTTACGACT T) ( Weisburg và cs, 1991) với thành phần và chu trình phản ứng ở bảng 2.6. Bảng 2.6. Phản ứng PCR khuyếch đại gen 16S rDNA. Thành phần phản ứng Thể tích (µl) Nhiệt độ (oC) Thời gian Số chu kỳ H2O MQ 13,5 94 3 phút 10x buffer 2,5 94 30 giây 35 BSA (3 mg/ml) 2,5 55 45 giây MgCl2 (20 mM) 2 72 1,5 phút dNTP (2,5 mM) 2 72 7 phút Mồi 27F (50 pmol/µl) 0,5 Mồi 1492R (50 pmol/µl) 0,5 Taq polymerase (5u/µl) 0,5 DNA Khuôn 1 Tổng thể tích phản ứng 25 Gen 16S rDNA của các chủng thuần khiết (~1500 bp) và sản phẩm PCR từ các băng điện di biến tính (550 bp) sau khi tinh sạch bằng kít tinh sạch sản phẩm PCR (Bioneer - Hàn Quốc) được tiến hành phản ứng đọc trình tự với ABI Prism BigDye Terminator cycle sequencing kit và đọc trình tự trên máy tự động 3110 Avant Appied Biosystems. Trình tự gen sau đó được phân tích, so sánh với trình tự 16S rDNA của các loài có liên quan hiện đã công bố trên Database DDBJ/EMBL/GenBank sử dụng phần mềm BLAST Search. Cây phân loại được dựng theo phương pháp neighbour-joining (Saitou và Nei, 1987), trong đó định dạng cây được tiến hành dựa trên 1000 phép so sánh đa chiều (Felsenstein, 1985). 2.2.6. Phân tích hóa học 2.2.6.1. Định lượng Fe(II) bằng thuốc thử phenanthrolin (DIN 38406 E1-1, 1983) Nguyên lý: O-phenanthrolin phản ứng với Fe(II) tạo phức có màu tím đỏ trong khoảng pH 3 - 9, đo được ở bước sóng 510 nm. Nồng độ Fe(II) cho phép đo là 0,01 - 5 mg/l. Kết quả của phép đo có thể bị ảnh hưởng bởi ion Mn và Cu. Chuẩn bị: Dung dịch HCl 25% (rửa dụng cụ): Dụng cụ được rửa bằng HCl 25% và tráng bằng nước cất trước khi sử dụng Dung dịch H2SO4 loãng (hạ pH): H2SO4 đặc : nước = 1 : 4 (thể tích). Dung dịch ammonium acetate 5,2 M (đệm): CH3COONH4 40 g CH3COOH 50 ml Nước cất đủ 100 ml Dung dịch hydroxyl ammonium chloride 1,4 M (khử Fe3+ thành Fe2+) NH2OH. HCl 10 g Nước cất đủ 100 ml Dung dịch phenanthrolin 21 mM (Tạo phức): C12H9ClN2.H2O 0,5 g Nước cất đủ 100 ml (Bảo quản trong lọ tối, hạn sử dụng trong 1 tuần) Dung dịch chuẩn: FeSO4.7H2O 2,78 mg HCl 25% 6,25 ml Nước cất đủ 100 ml Tiến hành: Sau khi thu mẫu, lập tức hạ pH tới 1 bằng dung dịch H2SO4 loãng (1% thể tích). Thêm vào 50 ml mẫu 5 ml dung dịch ammonium acetate và 2 ml dung dịch hydroxyl ammonium chloride, trộn đều bằng vortex, hỗn hợp phải có pH nằm trong khoảng 3,4 - 5,5 (tối ưu là 4,5). Thêm 2 ml dung dịch phenanthrolin, trộn đều. Thêm nước cho tới 100 ml, trộn đều. Giữ ở nhiệt độ phòng trong 15 phút. Đo OD tại bước sóng 510 nm. Đường chuẩn được tiến hành với nồng độ Fe(II) từ 5 - 50 µM. 2.2.6.2. Định lượng sulfate (Dinh và cs, 2004) Nguyên lý: SO42- kết hợp với Ba2+ tạo kết tủa BaSO4 theo phương trình: Ba2+ + SO42- → BaSO4 kết tủa trắng. Hàm lượng sulfate được xác định thông qua hàm lượng chất kết tủa BaSO4 tạo thành. Chuẩn bị Dung dịch BaCl2 0,2 M trong HCl 0,2 M Ống nghiệm thủy tinh nhỏ Màng lọc nitrocellulose 0,2 µm Bộ dụng cụ hút chân không Tiến hành Sấy màng lọc ở 105oC trong 2 h, sau đó cân xác định trọng lượng. Hút 1 ml dung dịch BaCl2 0,2 M / HCl 0,2 M vào ống nghiệm thủy tinh. Bổ sung 1 ml mẫu (đã ly tâm) vào ống nghiệm trên, trộn đều (vortex), giữ ở nhiệt độ phòng trong 5 phút. Lọc tủa qua màng nitrocellulose nhờ bộ dụng cụ hút chân không. Lấy màng lọc ra và sấy ở 105oC trong 2 h, sau đó cân lại màng lọc. Tính toán lượng chất kết tủa tạo thành, suy ra hàm lượng sulfate trong mẫu theo công thức: Hàm lượng sulfate (M) = (Y –X) / 233 Y: Khối lượng màng sau lọc (gam); X: Khối lượng màng trước lọc (gam) 2.2.6.3. Xác định nồng độ sulfide (Cord-Ruwisch, 1985) Nguyên lý: Ion S2- phản ứng với ion Cu2+ tạo CuS có màu nâu đen dạng huyền phù, đo được nhanh ở bước sóng 480 nm. Chuẩn bị: Dung dịch CuSO4 5 mM trong HCl 50 mM Ống nghiệm thủy tinh nhỏ Tiến hành: Hút 4 ml dung dịch CuSO4 5 mM / HCl 50 mM vào ống nghiệm Thêm 100 µl mẫu vào ống nghiệm, đảo đều. Đo nhanh ở bước sóng 480 nm. Đường chuẩn được tiến hành với nồng độ S2- từ 0 – 20 mM 2.2.7 Thiết kế mô hình xử lý AMD Nguồn AMD: Nguồn AMD được thu thập từ mỏ than Tràng Khê ở Quảng Ninh có các đặc điểm lý hóa như sau: pH = 4 Nồng độ sắt = 200 mg/l (tương đương 3,57 mM) Nồng độ sulfate = 1320 mg/l (tương đương 13,75 mM) Giá thể: Phoi bào được lót dưới lớp đáy của bể xử lý Nguồn vi sinh vật: Dịch làm giàu SRB sau lần cấy truyền thứ 4 (E1-4) Chu trình xử lý: AMD từ bể điều hòa (1) được chảy vào bể xử lý (2) có chứa cơ chất, giá thể cho vi sinh vật và nguồn SRB. pH và nồng độ sulfate được xác định 1 lần/ ngày. Khi pH tăng lên và nồng độ sulfate giảm đến mức đạt yêu cầu, phần AMD đã được xử lý sẽ được chuyển sang bể chứa 3 theo nguyên lý chảy tràn (hình 2.1). 3 2 1 Hình 2.2. Mô hình xử lý AMD trong phòng thí nghiệm. 1) Bể điều hòa chứa AMD đầu vào; 2) Bể xử lý AMD bằng SRB; 3) Bể lắng chứa nước thải đầu ra. Mô hình xử lý AMD được hoạt động với nguồn cơ chất cho SRB sinh trưởng được bổ sung từ bên ngoài là methanol hoặc nước thải có hàm lượng hữu cơ cao. Chương 3 - KẾT QUẢ VÀ THẢO LUẬN 3.1. Làm giàu và phân lập vi khuẩn khử sulfate (SRB) từ các mẫu nước thải Nguồn nước thải sử dụng để làm giàu SRB gồm có nước trong hồ sinh học xử lý nước thải từ nhà máy chế biến thủy sản ở Bình Dương (E1), nước thải trong bể biogas (E2) và nước thải sau biogas (E3) của nhà máy rượu Hà Nội tại Yên Phong, Bắc Ninh. Các mẫu được lấy từ lớp bùn đáy và nước ở độ sâu 10 - 20 cm trên bề mặt đáy, giữ trong bình Duran đóng kín và đưa về phòng thí nghiệm. Vi khuẩn khử sulfate (SRB) được làm giàu từ các mẫu nước thải đã thu thập ở trên trong môi trường khoáng dịch thể chứa sulfate (28 mM) làm chất nhận điện tử duy nhất và Na-Lactate (10 mM) là chất cho điện tử. pH môi trường trong thí nghiệm làm giàu là 6,5 – 6,8, nhiệt độ nuôi cấy là 30°C. Sự sinh trưởng của SRB trong các mẫu làm giàu được nhận biết sau 5 – 7 ngày nuôi cấy thông qua sản phẩm trao đổi chất sulfide trong phản ứng tạo kết tủa CuS màu nâu với dung dịch CuCl2 (xem chương 2). Cấy truyền dịch làm giàu được thực hiện sau mỗi 5 – 7 ngày khi dịch nuôi có mật độ tế bào cao và tạo nhiều sulfide. Hình 3.1. Hàm lượng sulfide của các mẫu làm giàu ở lần cấy truyền thứ 4. E1-4: Mẫu làm giàu với nước thải từ nhà máy chế biến thủy sản ở Bình Dương sau 4 lần cấy truyền. E2-4: Mẫu làm giàu với nước thải trong bể biogas của nhà máy rượu Hà Nội sau 4 lần cấy truyền. E3-4: Mẫu làm giàu với nước thải sau biogas của nhà máy rượu Hà Nội sau 4 lần cấy truyền. Sau 4 lần cấy truyền, hàm lượng sulfide trong các mẫu làm giàu với các nguồn nước thải khác nhau được định lượng để so sánh mức sinh trưởng của SRB trong đó (hình 3.1). Có thể nhận thấy mẫu làm giàu với nước thải từ nhà máy chế biến thủy sản ở Bình Dương (E1-4) sau 4 lần cấy truyền có chứa SRB với hoạt tính cao hơn hai mẫu còn lại (hình 3.1). Trên cơ sở đó, mẫu này (hình 3.2a) được sử dụng để tiến hành phân lập các chủng SRB thuần khiết. Việc phân lập được tiến hành trên dãy ống thạch bán lỏng (1%) chứa môi trường khoáng kỵ khí có chất cho và nhận điện tử tương ứng là lactate và sulfate (Widdel, Bak, 1992). Các khuẩn lạc đơn hình thành trong ống thạch (hình 3.2b) được tách riêng bằng đầu pipet Pasteur và chuyển sang ống nghiệm chứa môi trường dịch thể kỵ khí dành cho SRB. (a) (b) Hình 3.2. Làm giàu và phân lập vi khuẩn khử sulfate từ mẫu nước thải. (a) – Mẫu làm giàu vi khuẩn SRB E1-4; (b) – Khuẩn lạc SRB hình thành trong ống thạch bán lỏng Ba chủng SRB được phân lập từ ống pha loãng 10-8 dựa trên hình thái khác nhau của khuẩn lạc (bảng 3.1). Bảng 3.1. SRB phân lập được từ dịch làm giàu với mẫu nước thải E1-4 Tên chủng Đặc điểm hình thái khuẩn lạc Hình dạng tế bào Đặc điểm chuyển động của tế bào SR2 Hình múi khế 4 cạnh, màu đen Hình que, có độ dài khác nhau tùy thuộc thời gian và điều kiện nuôi cấy, kích thước tế bào nhỏ nhất 1×3,5 μm (hình 3.3) Không chuyển động SR3 Hình múi khế 3 cạnh, màu đen Hình ovan đơn hoặc xếp chuỗi, kích thước 1×1,5-2 μm (hình 3.3) Chuyển động chậm SR4 Hình đĩa lồi 2 mặt, màu đen Hình phẩy khuẩn, kích thước 1×2-3 μm (hình 3.3) Chuyển động nhanh SR2 SR3 SR4 Hình 3.3. Hình thái tế bào của ba chủng SRB thuần khiết phân lập được từ mẫu dịch làm giàu với nước thải 3.2. Vị trí phân loại của ba chủng SRB dựa trên trình tự gen 16S rDNA DNA genome của 3 chủng SRB thuần khiết được tách theo phương pháp của Marmur (1961), sau đó sản phẩm được kiểm tra bằng điện di trên gel agarose 1% (hình 3.4). Marker SR2 SR3 SR4 5000 bp Hình 3.4. DNA genome của ba chủng SRB phân lập được DNA tổng số được dùng làm khuôn trong phản ứng PCR để nhân gen 16S rDNA. Với cặp mồi được thiết kế dựa trên trình tự bảo thủ của gen 16S rDNA của E. coli thì theo lý thuyết sản phẩm PCR thu được phải có độ dài xấp xỉ 1500 bp. Kết quả kiểm tra bằng điện di sản phẩm PCR trên gel agarose 1% cho thấy các băng có kích thước khoảng 1500 bp đúng như lý thuyết. Băng DNA rất rõ, không bị đứt gãy, có độ tinh sạch cao, có thể sử dụng trong các phản ứng tiếp theo (hình 3.5). Sản phẩm PCR được tinh sạch bằng bộ kit PCR purification Kit (Bioneer, Hàn Quốc) theo hướng dẫn của nhà sản xuất. Sản phẩm PCR sau khi tinh sạch bằng Kit được kiểm tra hàm lượng DNA và độ tinh sạch thông qua phương pháp so màu ở bước sóng 260 nm. Marker SR2 SR3 SR4 ĐC(-) 1500 bp Hình 3.5. Điện di kiểm tra sản phẩm PCR khuyếch đại gen 16S rDNA của các chủng SRB phân lập được trên gel agarose 1%. Trình tự gen 16S rDNA được đọc với 3 đoạn mồi 27F, 800F và 1492R (các số tương ứng với các vị trí nucleotide trên gen 16S rDNA ở E. coli). Đoạn gen 16S rDNA gần đủ của mỗi chủng sau đó được tạo ra bằng việc cắt các đoạn trùng lặp và ghép nối các trình tự có được với 3 đoạn mồi nói trên sử dụng công cụ tạo trình tự Contig trong phần mềm BioEdit. Sau đó chuỗi trình tự này được so sánh với các gen 16S rDNA đã được công bố trên ngân hàng gen bằng chương trình BLAST Search, theo đó độ tương đồng của các chủng SRB phân lập được so với các chủng đã công bố như sau: Chủng SR2 có độ tương đồng 98% so với Desulfomicrobium baculatum. Chủng SR3 có độ tương đồng 98% so với Desulfobulbus propionicus. Chủng SR4 có độ tương đồng 98% so với Desulfovibrio magneticus. Vị trí phân loại của ba chủng SRB mới phân lập so với các loài SRB có liên hệ gần gũi dựa trên trình tự gần đủ của gen 16S rDNA được biểu diễn trên cây phân loại ở hình 3.6. Trên cơ sở so sánh trình tự gen 16S rDNA, ba chủng SRB mới phân lập được định danh tương ứng là Desulfomicrobium sp. SR2, Desulfobulbus sp. SR3 và Desulfovibrio sp. SR4. Hình 3.6. Cây phân loại neibourgh joining dựa trên trình tự gen 16S rDNA gần đủ của các chủng SRB mới phân lập so sánh với các loài SRB có quan hệ gần gũi. Escherichia coli (g-Proteobacteria) được chọn làm outgroup. 3.3. Nghiên cứu đặc điểm sinh học của các chủng SRB mới phân lập Để có thể sử dụng các chủng SRB mới phân lập trong các ứng dụng thực tế, chúng tôi tiến hành nghiên cứu các đặc điểm sinh lý của chúng, cụ thể là ảnh hưởng của các điều kiện môi trường như nhiệt độ, pH, nồng độ muối tới sinh trưởng cũng như các chất cho và nhận điện tử có thể phục vụ sinh trưởng. 3.3.1. Ảnh hưởng của nồng độ muối trong môi trường Độ mặn là một trong các yếu tố môi trường quan trọng ảnh hưởng đến sinh lý của vi khuẩn trong tự nhiên,

Các file đính kèm theo tài liệu này:

  • docluanvanthacsi_dinhdangword_168_4206_1869850.doc
Tài liệu liên quan